Skip to main content
NCBI home page
Springer logoLink to Springer
. 2026 Apr 11;58(3):223. doi: 10.1007/s11250-026-04978-y

The role of Zearalenone in epigenetic modifications of candidate genes in Nellore heifers

Lethissia Amorim da Silva Coelho 1, Rondineli Pavezzi Barbero 1, Pedro Ruiz Martins Tapajos Pereira 1, Carolina Emiliano Bastos Polido 2, Ana Clara Souza Resende de Aguiar 2, Huarrisson Azevedo Santos 2, Marco Roberto Bourg de Mello 1, Elisandra Lurdes Kern 3, Denise Carleto Andia 4, Marina Mortati Dias Barbero 3,✉
PMCID: PMC13070089  PMID: 41964794

Abstract

Mycotoxins are toxic secondary metabolites produced by fungi that proliferate in stored feeds such as grains and silage. Zearalenone (ZEN) is a frequently detected mycotoxin with well-known estrogenic activity. This study aimed to evaluate the effects of ingesting ZEN-contaminated feed on the methylation and hydroxymethylation of CpG islands located in the candidate genes CYP1A1, CYP21A2, and CYP1B1 in Nellore heifers. Twenty heifers were confined for 12 weeks during the finishing phase and assigned to two groups: a control group (non-contaminated feed) and a ZEN-treated group (approximately 300 ppb). After slaughter, liver samples were collected, and genomic DNA was extracted. DNA was treated with T4-β-glucosyltransferase and digested with the restriction enzymes MspI and HpaII. CpG island methylation and hydroxymethylation were quantified by real-time PCR. Statistical analyses were performed using analysis of variance followed by t-tests, and p-values were adjusted for multiple comparisons using the false discovery rate (FDR). No significant differences were observed in methylation or hydroxymethylation levels of CYP1A1 between groups after FDR adjustment. In contrast, animals exposed to ZEN-contaminated feed exhibited increased DNA methylation in the CpG island of CYP1B1, and this effect remained statistically significant after FDR correction. For CYP21A2, differences in hydroxymethylation observed in the unadjusted analysis were attenuated after FDR adjustment and are therefore interpreted as a trend. These findings indicate that ZEN exposure induces gene-specific epigenetic modulation in the liver of Nellore heifers, with a robust effect observed for CYP1B1. The results highlight the importance of monitoring ZEN contamination in cattle feed and support the need for further studies integrating epigenetic, transcriptomic, and endocrine analyses to clarify the biological implications of mycotoxin exposure in beef cattle.

Keywords: CpG island, CYP1A1, CYP21A2, CYP1B1

Introduction

Mycotoxins are secondary metabolites that are naturally produced by fungi, usually as a defense mechanism against these microorganisms as they mature (Kemboi et al. 2020). Food contamination by mycotoxins can occur both in field conditions and during storage, and is influenced by intrinsic and extrinsic factors such as the environment, climatic conditions, and fungal species involved (Hussein and Brasel 2001). This contamination can compromise the quality of plants and consequently affect the animals that consume them (Freire et al. 2007). Toxic effects range from skin lesions to more severe manifestations, such as hepatotoxicity, nephrotoxicity, neurotoxicity, hematotoxicity, genotoxicity, and, in extreme cases, death. Acute and chronic toxicities of mycotoxins have been extensively studied, highlighting the various toxicological pathways involved. Therefore, understanding the toxicity mechanisms induced by mycotoxins is essential for implementing preventive measures and protecting human and animal health.

Increasing demand for food has driven the intensification of livestock production, including beef cattle farming. To optimize weight gain and productivity, grains and silage are widely used in cattle feeding as they contribute to reducing the production cycle of animals (Barbero et al. 2021). However, these feedstuffs present a high risk for mycotoxin contamination (Custódio et al. 2019). In ruminants, ingested Zearalenone (ZEN) is converted into α-zearalenol and β-zearalenol by ruminal microorganisms (Kemboi et al. 2020). α-zearalenol has a higher estrogenic potency than ZEN because it can be converted into zeranol, a compound with anabolic effects. However, its toxic impact is reduced owing to lower absorption, and when absorbed, it is converted into β-zearalenol in the liver (Kuiper-Goodman et al. 1987; Rai et al. 2020). β-Zearalenol, in turn, exerts toxic effects on endometrial cells, although its affinity for estrogen receptors is low (Bottalico et al. 1985). Although ruminants are less sensitive to ZEN exposure than monogastric animals due to the metabolism of this toxin in the rumen (Fink-Gremmels 2008; Liu and Applegate 2020), its elimination can be compromised in cases of ruminal acidosis, leading to increased ZEN bioavailability and potential toxic effects (Takagi et al. 2011). In studies with pigs, Doll et al. (2004) detected ZEN and its metabolites in both bile and liver, demonstrating the persistence of the toxin in the organism.

As reviewed by Zhang (2015), the effects of diet on epigenetic mechanisms, including DNA methylation patterns, have been widely studied. DNA methylation involves the addition of a methyl group to cytosine (C), located within a CpG island in the gene promoter region (Zhang 2015). The study of methylation patterns is justified by their impact on the regulation of gene expression.

Evidence from nutrigenomic studies indicates that diet can influence DNA methylation processes, thereby modulating gene expression (Maugeri and Barchitta 2020). The degradation of mycotoxins primarily occurs in the liver, and oxidation is one of the key steps in this process (Tolosa et al. 2021). Some enzymes involved in mycotoxin degradation belong to the cytochrome P450 gene superfamily (Berenbaum et al. 2021). If adverse effects occur in the reproductive system of animals, they may be linked to the failure of ZEN degradation and the consequent methylation of the genes responsible for this process.

When the mycotoxin ZEN is ingested, part of its detoxification process occurs in the liver, where cytochrome P450 family enzymes play a crucial role. In studies on mice, for instance, genes from this family showed altered expression in the liver following exposure to ZEN (Duca et al. 2010). In pigs, Gajecka et al. (2017) demonstrated that exposure to low doses of ZEN affects multiple biological targets within an organism. These authors reported that ZEN-induced hyperestrogenism results in changes in the mRNA activity of selected enzymes, including those in the cytochrome P450 family, affecting the regulation of host steroid hormones, bacterial gene virulence, and detoxification processes. Additionally, they observed reduced intestinal activity, leading to energy deficits.

This study hypothesized that ZEN ingestion by Nellore heifers may alter the methylation patterns of genes involved in the degradation of this mycotoxin, specifically those encoding proteins of the cytochrome P450 family, including CYP1A1, CYP21A2, and CYP1B1. Understanding the gene regulation mechanisms in response to ZEN intoxication may contribute to a better understanding of detoxification processes in cattle and aid in developing strategies to mitigate the effects of this mycotoxin.

Materials and methods

Animals, treatments, and sample collection

Twenty non-pregnant, healthy Nellore heifers (Bos taurus indicus) aged ≥ 18 months with an initial average body weight of 330 ± 30 kg were used in this study. The animals were divided into two groups: 10 heifers in the control group and 10 that consumed ZEN-contaminated feed (concentrate). At the beginning of the experiment, all animals were weighed and fed a diet composed of 70% forage and 30% concentrate (on a dry matter basis) to evaluate two treatments: (1) control (non-contaminated feed) and (2) ZEN-contaminated feed (± 300 ppb). This dose is considerably lower than the lethal dose for cattle (Chang et al. 2017) and is commonly found in feedlot diets (Custódio et al. 2019). The feeding protocol was described by Pião et al. (2023). After 84 days of confinement, the animals were slaughtered in a commercial slaughterhouse, and liver samples were collected. The study was approved by the Ethics Committee on Animal Use of the IZ/UFRRJ (Approval No. 0028-10-2018).

DNA extraction and quantification

DNA was extracted from the liver samples using the DNeasy Blood & Tissue Kit (QIAGEN), following the manufacturer’s specifications. DNA integrity was assessed by electrophoresis on 1% agarose gel. DNA was quantified using the Qubit™ fluorometer (Invitrogen™) and the Qubit dsDNA BR Assay Kit. The quality of the extracted DNA was analyzed using a NanoDrop 2000 spectrophotometer. Subsequently, the DNA was stored at -20 °C until further analysis.

Candidate genes, CpG island identification and primer design

The selection of candidate genes was based on the degradative activity attributed to the cytochrome P450 (CYP) gene family (Berenbaum et al. 2021), with particular focus on CYP1A1, CYP21A2, and CYP1B1, as consistently reported in the literature (Frizzell et al. 2013; Kalayou et al. 2014; Mróz et al. 2022; Zepnik et al. 2001).

CpG islands were identified using the Genome Browser (https://genome.ucsc.edu/). Islands located near or within the candidate gene regions were selected. Based on the CpG island DNA sequence, a pair of primers was designed (Table 1) using Primer3Plus software (Untergasser et al. 2012) with Bos taurus ARS-UCD 2.0 as the reference genome. Primer quality was verified using the Beacon Designer-Free Edition tool (http://www.premierbiosoft.com/).

Table 1.

Location of CpG islands and primers designed for each candidate gene

Candidate Gene CpG Island Location Primer Sequence
CYP1A1 21: 33951871.33952098 F: CTATGGGGACGTGCTGCA
R: AGAGTCTGGGTTGAAGGTCA
CYP21A2 23: 27327147.27327896 F: TGCTCCCGAGTCACTTACAA
R: ATAACGACCATGCCCTCAGG
CYP1B1 11: 20473998.20477669 F: CTTGTGATGCGTGGGTTCTC
R: CGCCTCTCTATGACCCGATT
Open in a new tab

Quantitative PCR assay for DNA methylation and hydroxymethylation

Genomic DNA was initially treated with T4-β-glucosyltransferase (T4-BGT) (Thermo Scientific™), an enzyme that adds a glucose moiety to 5-hmC, allowing for differentiation between DNA methylation and hydroxymethylation. Each sample was analyzed under three experimental conditions (Fig. 1): (1) without glucosylation and without restriction enzyme treatment (control), (2) glucosylated and treated with the restriction enzyme MspI, and (3) glucosylated and treated only with the restriction enzyme HpaII.

Fig. 1.

Fig. 1

Open in a new tab

Workflow of DNA glucosylation, restriction enzyme digestion, and qPCR amplification used to estimate DNA methylation and hydroxymethylation levels. Each DNA sample was analyzed under three experimental conditions

Samples subjected to glucosylation (two tubes per DNA sample) were prepared with the following components: 0.4 µg of DNA, 2 µL of 10X Epi Buffer 4, 2 µL of 10X UDP-glucose, 0.4 µL of T4-BGT, and 7.6 µL of nuclease-free water, for a final volume of 20 µL. Non-glucosylated samples were prepared as follows: 0.4 µg of DNA, 2 µL of 10X Epi Buffer 4 (2 µL 10X UDP-glucose, and nuclease-free water (8 µL), resulting in a final volume of 20 µL. All the samples were incubated at 37 °C for 15 min, followed by enzyme inactivation at 65 °C for 20 min.

Next, MspI (Invitrogen™, Thermo Scientific™), HpaII (Invitrogen™ by Thermo Scientific™), or water (for the control) was added to the respective tubes, bringing the final volume to 25 µL, followed by incubation at 37 °C for 1 h. The samples treated with HpaII were incubated at 65 °C for 10 min to inactivate the enzyme.

Quantification of DNA methylation and hydroxymethylation was performed using a methylation-sensitive restriction enzyme–based qPCR approach, in which amplification reflects the presence or absence of enzyme cleavage rather than transcript abundance. In this context, classical qPCR quality controls applied to gene expression analyses, such as primer efficiency derived from serial dilutions and single-peak melting curves, are not mandatory, as discussed by Kurdyukov and Bullock (2016).

Real-time quantitative PCR (qPCR) was performed using each primer pair. The samples were amplified for 40 cycles using the StepOnePlus Real-Time PCR System (Applied Biosystems). The reaction mix was performed in a final volume of 10 µL containing 50ng/µL of DNA, 40 µM of gene-specific primer pair, 5 µL of Fast SYBR® Green Master Mix 2x (Applied Biosystems), and 3 µL of nuclease-free water. The temperature and cycle duration followed the instructions for Fast SYBR ® Green Master Mix. The melting curve was obtained in the temperature range of 60 °C to 95 °C, increments of 0.3 °C per cycle, a stabilization time of 30 s per increment, and continuous fluorescence acquisition in the SYBR™ Green channel.

Data analysis was conducted using the comparative Cq (cycle quantification) method, with sample normalization based on the control reaction (treated only with T4-BGT, without enzyme digestion) as the calibrator (Assis et al. 2018).

The Cq values obtained by qPCR were used to estimate the levels of methylation (M) and hydroxymethylation (H), as described by Assis et al. (2018), using the following calculations:

graphic file with name d33e565.gif
graphic file with name d33e568.gif

Where HpaII represents the Cq values obtained from samples treated with the HpaII restriction enzyme, MspI represents the Cq values obtained from samples treated with the MspI restriction enzyme, and calibrator refers to the samples that were not subjected to any enzymatic treatment.

Statistical analysis

Statistical analyses were conducted using datasets in which animals were identified according to their experimental group (control or ZEN-treated). Data were subjected to analysis of variance (ANOVA, α < 0.05\alpha < 0.05α < 0.05), followed by t-test comparisons using the agricolae package (Mendiburu 2021) in R software (R Core Team 2026). To control for multiple testing across genes and epigenetic variables, p-values were adjusted using the false discovery rate (FDR) according to the Benjamini–Hochberg procedure (Benjamini and Hochberg 1995). Adjusted p-values (p_adj) < 0.05 were considered statistically significant.

Results

The CpG islands analyzed were located in the following genomic regions (Table 1): for CYP1A1, within the gene region, specifically exon 2, corresponding to the first portion of the coding sequence; for CYP1B1, within the gene region, encompassing exons 2 and 3 as well as a downstream segment; and for CYP21A2, within the gene region, spanning exons 6 to 8.

The quantity and quality of the extracted DNA were suitable for analysis, except for one sample from the treatment group, which was excluded from the statistical analysis. The CpG island regions of the candidate genes CYP1A1, CYP21A2, and CYP1B1 were successfully amplified using qPCR. Statistical analyses were performed based on estimated methylation and hydroxymethylation values (Tables 2 and 3). The Fig. 2 provides a visual comparison of DNA methylation and hydroxymethylation levels between control and ZEN-treated groups, highlighting the gene-specific epigenetic responses.

Table 2.

Statistical analysis using the t-test for the comparison of transformed methylation values between animals in the control and treatment groups

Gene Animals M STD Se Min Max D p-value p-adj (FDR)
CYP1A1 C (10) 22.82 0.5274 0.1976 22.14 24.03 0.3605 0.2263 0.2371
T(9) 22.46 0.7192 0.2083 20.81 23.14
CYP21A2 C(10) 22.69 0.5700 0.2707 22.10 23.64 -0.7755 0.0652 0.1304
T(9) 23.46 1.0900 0.2854 22.00 25.80
CYP1B1 C(10) 28.51 1.9722 0.5354 24.40 32.00 -2.5900 0.0040 0.0240
T(9) 31.10 1.3105 0.5644 28.20 32.30
Open in a new tab

where C (10) = control group (non-contaminated feed; n = 10 animals); T (9) = ZEN-treated group (n = 9 animals), H = estimated value of hydroxymethylation, STD = Standard deviation, se= standard error, Min= minimum value of H, and Max= maximum value of H, D= difference, p_adj = p-value adjusted by FDR (Benjamini–Hochberg)

Table 3.

Statistical analysis using the t-test for the comparison of transformed hydroxymethylation values between animals in the control and treatment groups

Gene Animals H STD Se Min Max D p-value p-adj (FDR)
CYP1A1 C(10) 1.2010 0.4400 0.0142 1.13 1.27 0.0254 0.2371 0.2716
T(9) 1.1755 0.0463 0.0150 1.10 1.23
CYP21A2 C(10) 1.1280 0.0458 0.0110 1.06 1.19 0.04022 0.0231 0.0693
T(9) 1.0877 0.0156 0.0116 1.06 1.11
CYP1B1 C(10) 1.1210 0.0369 0.0096 1.05 1.17 0.0221 0.1326 0.1989
T(9) 1.0988 0.0208 0.0101 1.07 1.13
Open in a new tab

where C (10) = control group (non-contaminated feed; n = 10 animals); T (9) = ZEN-treated group (n = 9 animals), H = estimated value of hydroxymethylation, STD = Standard deviation, se= standard error, Min= minimum value of H, and Max= maximum value of H, D= difference, p_adj = p-value adjusted by FDR (Benjamini–Hochberg).

Fig. 2.

Fig. 2

Open in a new tab

Comparison of DNA methylation and hydroxymethylation levels in CpG island regions of CYP1A1, CYP21A2, and CYP1B1 between control (C) and ZEN-treated (T) Nellore heifers. Boxes represent interquartile ranges, horizontal lines indicate medians, and points represent individual animals. Control group: n = 10; ZEN-treated group: n = 9. One sample from the ZEN-treated group was excluded due to sample loss

To control for multiple comparisons across genes and epigenetic variables, p-values were adjusted using the false discovery rate (FDR) according to the Benjamini–Hochberg procedure (Benjamini and Hochberg 1995). Adjusted p-values (FDR) are reported in Tables 2 and 3 and were used to determine statistical significance.

No significant differences were observed in the CpG island region of CYP1A1 for either methylation or hydroxymethylation after FDR adjustment, indicating that consumption of ZEN-contaminated feed did not induce detectable epigenetic changes in this gene under the experimental conditions evaluated.

For CYP21A2, a difference in hydroxymethylation was observed between the control and treatment groups in the unadjusted analysis; however, this effect did not remain statistically significant after FDR correction and is therefore interpreted as a trend. Methylation levels in this gene did not differ significantly between groups after adjustment.

In contrast, CYP1B1 showed a significant increase in DNA methylation in animals exposed to ZEN-contaminated feed compared with the control group, and this effect remained statistically significant after FDR correction. No significant differences were detected in hydroxymethylation levels for this gene.

Discussion

Given that the CpG islands analyzed were located within gene regions, the observed methylation patterns may be relevant for gene regulation. The literature suggests a correlation between CpG island methylation in both the promoter and exonic regions, which impacts gene expression regulation (Brenet et al. 2011; Hisano et al. 2003; Li et al. 2018). Additionally, as reviewed by Shayevitch (2018), methylation in exonic regions may also be associated with alternative splicing, thereby influencing transcript diversity from a single gene.

In a previous study conducted on the same animals used in this experiment, no significant differences were observed in dry matter intake, digestibility, or performance of heifers (Pião et al. 2023). However, significant alterations were reported in reproductive parameters, particularly oocyte quality (Silva et al. 2021). In the present study, both significant and non-significant epigenetic changes were detected, which may be partially explained by the extensive degradation of ZEN by ruminal microbiota, potentially limiting systemic exposure and contributing to gene-specific epigenetic responses. This microbiota is responsible for degrading approximately 90 to 100% of ingested ZEN (Upadhaya et al. 2010).

Cytochrome P450 enzymes play a central role in hepatic xenobiotic metabolism; therefore, epigenetic modulation of CYP genes may affect the efficiency of ZEN detoxification. Previous studies have shown that CYP1A1 and CYP1B1 are expressed in the liver and participate in the metabolism of xenobiotics, including mycotoxins (Guruge et al. 2009; Li et al. 2017; Zepnik et al. 2001). Therefore, epigenetic regulation of these genes may influence hepatic responses to ZEN exposure.

Although CYP1A1 is associated with detoxification processes, Mróz et al. (2022) observed a reduction in its expression in gilts that ingested ZEN, suggesting a possible suppressive effect on CYP1A1. In the present study, no changes were observed in the methylation patterns of the analyzed CpG island in this gene region, suggesting that under the evaluated conditions, ZEN did not influence the epigenetic regulation of CYP1A1 under the experimental conditions evaluated.

CYP1B1 is also involved in the endogenous metabolism of steroid hormones (Li et al. 2017). Among these hormones, estradiol is the primary sex hormone in female mammals. According to Hayes et al. (1996), CYP1B1 plays a key role in its metabolic degradation pathway. The molecular structure of this mycotoxin is similar to that of mammalian 17β-estradiol, leading to hyperoestrogenic syndromes (Zinedine et al. 2007). In the present study, increased DNA methylation in the CpG island of CYP1B1 was observed in animals exposed to ZEN-contaminated feed, and this effect remained statistically significant after FDR correction, reinforcing the robustness of this finding. Given that the analyzed CpG island is located within the gene body, these methylation changes may be associated with altered transcript processing, including potential effects on alternative splicing.

Moreover, the increased methylation of CYP1B1 in animals exposed to ZEN may contribute to impaired estradiol metabolism and accumulation of estrogenic activity, possibly influencing reproductive efficiency. This hypothesis aligns with previous findings in these same animals, where Silva et al. (2021) observed reduced oocyte quality after ZEN exposure. Therefore, the epigenetic modulation of CYP1B1 may represent a mechanistic link between ZEN ingestion and reproductive impairments in cattle.

The CYP21A2 gene encodes cytochrome P450 21-hydroxylase, an enzyme involved in steroid hormone biosynthesis, particularly within glucocorticoid and mineralocorticoid pathways (Forest 2004; Mizrachi et al. 2011). This enzyme plays a central role in the metabolism of C21 steroid hormones (Grinberg et al. 2000). Previous gene expression studies in human cell cultures exposed to the mycotoxin alternariol (AOH) have demonstrated upregulation of CYP21A2 (Frizzell et al. 2013; Kalayou et al. 2014). Although AOH and ZEN are distinct compounds, both exhibit estrogenic properties, which may account for similar regulatory effects on steroidogenic pathways (Demaegdt et al. 2016; Freire et al. 2007; Stypuła-Trębas et al. 2017; Yang et al. 2018; Rogowska et al. 2019).

In the present study, no significant effect on DNA methylation of CYP21A2 remained after FDR correction; however, a trend toward altered hydroxymethylation was observed. While this finding should be interpreted with caution, it may indicate biologically relevant modulation of steroidogenic pathways, especially considering the well-established endocrine-disrupting effects of ZEN.

Conclusion

This study demonstrated that ingestion of zearalenone (ZEN)-contaminated feed induced gene-specific epigenetic alterations in Nellore heifers. Increased DNA methylation of CYP1B1 remained statistically significant after FDR correction, indicating robust epigenetic modulation potentially associated with xenobiotic metabolism. In contrast, the trend toward altered hydroxymethylation observed for CYP21A2 should be interpreted as suggestive rather than definitive evidence of epigenetic regulation, possibly affecting steroid hormone biosynthesis pathways. No epigenetic changes were detected in CYP1A1, reinforcing the gene-specific nature of the response to ZEN exposure. These findings highlight the importance of monitoring ZEN contamination in animal feed and emphasize the need for further studies integrating epigenetic, transcriptomic, and endocrine approaches to clarify its implications for cattle physiology and productivity.

Acknowledgements

The authors thank the state funding agency Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ, Grant #E-26/010.002539/2019 - Ref. 211.426/2019) for financial support.

Author contributions

Lethissia Amorim da Silva Coelho: Formal analysis, Investigation, Writing - Original Draft. Rondineli Pavezzi Barbero: Resources, Data Curation. Pedro Ruiz Martins Tapajos Pereira: Investigation, Writing - Original Draft. Carolina Emiliano Bastos Polido Investigation. Ana Clara Souza Resende de Aguiar: Investigation, Writing - Original Draft. Huarrisson Azevedo Santos: Resources, Writing - Review & Editing. Marco Roberto Bourg de Mello: Resources, Data Curation. Elisandra Lurdes Kern: Formal analysis. Denise Carleto Andia: Methodology. Marina Mortati Dias Barbero: Conceptualization, Resources, Writing - Original Draft, Supervision, Funding acquisition.

Funding

The Article Processing Charge (APC) for the publication of this research was funded by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) (ROR identifier: 00x0ma614).

Data availability

The data used in this study are available upon request. The authors are committed to providing full access to the relevant data for interested researchers to promote transparency and reproducibility of the results.

Declarations

Use of artificial intelligence

The authors declare the assistance of artificial intelligence tools for the grammatical review of this manuscript.

Use of animals in research

The experimental procedures were approved by the “Animal Care and Use Committee” from the Universidade Federal de Rural do Rio de Janeiro (Institute of Animal Science: #0028-10-2018).

Conflict of interest

The authors have no conflict of interest to declare.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Assis RIF, Wiench M, Silvério KG, da Silva RA, da Silva Feltran G, Sallum EA, Casati MZ, Nociti FH, Andia DC (2018) RG108 increases NANOG and OCT4 in bone marrow-derived mesenchymal cells through global changes in DNA modifications and epigenetic activation. PLoS One 13(12). 10.1371/journal.pone.0207873 [DOI] [PMC free article] [PubMed]
  2. Barbero RP, Ribeiro ACC, Moura AM, Longhini VZ, Mattos TFA, Barbero MM (2021) Production potential of beef cattle in tropical pastures: a review. Ciênc Anim Bras 22. 10.1590/1809-6891v22e-69609
  3. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: A practical and powerful approach to multiple testing. J Roy Stat Soc: Ser B (Methodol) 57:289–300 [Google Scholar]
  4. Berenbaum MR, Bush DS, Liao LH (2021) Cytochrome P450-mediated mycotoxin metabolism by plant-feeding insects. Curr Opin Insect Sci 43:85–91. 10.1016/j.cois.2020.11.007 [DOI] [PubMed] [Google Scholar]
  5. Bottalico A, Visconti V, Logrieco A, Solfrizzo M, Mirocha CJ (1985) Occurence of zearalenols (diastereomeric mixture) in corn stalk rot and their production by associated fusarium species. Appl Environ Microbiol 49:547–551. 10.1128/aem.49.3.547-551.1985 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brenet F, Moh M, Funk P, Feierstein E, Viale AJ, Socci ND, Scandura JM (2011) DNA methylation of the first exon is tightly linked to transcriptional silencing. PLoS One 6. 10.1371/journal.pone.0014524 [DOI] [PMC free article] [PubMed]
  7. Chang H, Kim W, Park JH, Kim D, Kim CR, Chung S, Lee C (2017) The occurrence of zearalenone in south korean feedstuffs between 2009 and 2016. Toxins (Basel) 9:1–15. 10.3390/toxins9070223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Custódio L, Prados LF, Yiannikouris A, Holder V, Pettigrew J, Kuritza L, de Resende FD, Siqueira GR (2019) Mycotoxin contamination of diets for beef cattle finishing in feedlot. Rev Bras Zootec 48:1–12. 10.1590/RBZ4820190079 [Google Scholar]
  9. Demaegdt H, Daminet B, Evrard A, Scippo ML, Muller M, Pussemier L, Callebaut A, Vandermeiren K (2016) Endocrine activity of mycotoxins and mycotoxin mixtures. Food Chem Toxicol 96:107–116. 10.1016/j.fct.2016.07.033 [DOI] [PubMed] [Google Scholar]
  10. Doll S, Danicke S, Schnurrbusch U (2004) The effect of increasing concentrations of Fusarium toxins in piglet diets on histological parameters of the uterus and vagina. Arch Anim Nutr 58:413–417. 10.1080/00039420400004987 [DOI] [PubMed] [Google Scholar]
  11. Duca R-C, Mabondzo A, Bravin F, Delaforge M (2010) In Vivo Effects of Zearalenone on the Expression of Proteins Involved in the Detoxification of Rat Xenobiotics Radu-Corneliu. Environ Toxicol 27:98–108. 10.1002/tox [DOI] [PubMed] [Google Scholar]
  12. Fink-Gremmels J (2008) Mycotoxins in cattle feeds and carry-over to dairy milk: A review. Food Addit. Contam. - Part Chem Anal Control Expo Risk Assess 25:172–180. 10.1080/02652030701823142 [DOI] [PubMed] [Google Scholar]
  13. Forest MG (2004) Recent advances in the diagnosis and management of congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Hum Reprod Update 10:469–485. 10.1093/humupd/dmh047 [DOI] [PubMed] [Google Scholar]
  14. Freire F, das CO, Vieira IGP, Guedes MIF, Mendes FNP (2007) Micotoxinas: Importância na Alimentação e na Saúde Humana e Animal, 1st ed. Fortaleza
  15. Frizzell C, Ndossi D, Kalayou S, Eriksen GS, Verhaegen S, Sørlie M, Elliott CT, Ropstad E, Connolly L (2013) An in vitro investigation of endocrine disrupting effects of the mycotoxin alternariol. Toxicol Appl Pharmacol 271:64–71. 10.1016/j.taap.2013.05.002 [DOI] [PubMed] [Google Scholar]
  16. Gajecka M, Zielonka L, Gajecki M (2017) Activity of zearalenone in the porcine intestinal tract. Molecules 22:1–25. 10.3390/molecules22010018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Grinberg AV, Hannemann F, Schiffler B, Müller J, Heinemann U, Bernhardt R (2000) Adrenodoxin: Structure, stability, and electron transfer properties. Proteins Struct Funct Genet 40:590–612. 10.1002/1097-0134(20000901)40:4<590::AID-PROT50>3.0.CO;2-P [DOI] [PubMed] [Google Scholar]
  18. Guruge KS, Yamanaka N, Hasegawa J, Miyazaki S (2009) Differential induction of cytochrome P450 1A1 and 1B1 mRNA in primary cultured bovine hepatocytes treated with TCDD, PBDD/Fs and feed ingredients. Toxicol Lett 185:193–196. 10.1016/j.toxlet.2009.01.002 [DOI] [PubMed] [Google Scholar]
  19. Hayes CL, Spink DC, Spink BC, Cao JQ, Walker NJ, Sutter TR (1996) 17β-estradiol hydroxylation catalyzed by human cytochrome P450 1B1. Proc Natl Acad Sci U S A 93:9776–9781. 10.1073/pnas.93.18.9776 [DOI] [PMC free article] [PubMed]
  20. Hisano M, Ohta H, Nishimune Y, Nozaki M (2003) Methylation of CpG dinucleotides in the open reading frame of a testicular germ cell-specific intronless gene, Tact1/Actl7b, represses its expression in somatic cells. Nucleic Acids Res 31:4797–4804. 10.1093/nar/gkg670 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hussein HS, Brasel JM (2001) Toxicity, metabolism, and impact of mycotoxins on humans and animals. Toxicology 167:101–134. 10.1016/S0300-483X(01)00471-1 [DOI] [PubMed] [Google Scholar]
  22. Kalayou S, Hamre AG, Ndossi D, Connolly L, Sørlie M, Ropstad E, Verhaegen S (2014) Using SILAC proteomics to investigate the effect of the mycotoxin, alternariol, in the human H295R steroidogenesis model. Cell Biol Toxicol 30:361–376. 10.1007/s10565-014-9290-5 [DOI] [PubMed] [Google Scholar]
  23. Kemboi DC, Antonissen G, Ochieng PE, Croubels S, Okoth S, Kangethe EK, Faas J, Lindahl JF, Gathumbi JK (2020) A review of the impact of mycotoxins on dairy cattle health: Challenges for food safety and dairy production in sub-Saharan Africa. Toxins (Basel) 12:1–25. 10.3390/toxins12040222 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kuiper-Goodman T, Scott PM, Watanabe H (1987) Risk assessment of the mycotoxin zearalenone. Regul Toxicol Pharmacol. 10.1016/0273-2300(87)90037-7 [DOI] [PubMed] [Google Scholar]
  25. Kurdyukov S, Bullock M (2016) DNA methylation analysis: choosing the right method. Biology 5:3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li F, Zhu W, Gonzalez FJ (2017) Potential role of CYP1B1 in the development and treatment of metabolic diseases. Pharmacol Ther 178:18–30. 10.1016/j.pharmthera.2017.03.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li S, Zhang J, Huang S, He X (2018) Genome-wide analysis reveals that exon methylation facilitates its selective usage in the human transcriptome. Brief Bioinform 19:754–764. 10.1093/bib/bbx019 [DOI] [PubMed] [Google Scholar]
  28. Liu J, Applegate T (2020) Zearalenone (ZEN) in livestock and poultry: dose, toxicokinetics, toxicity and estrogenicity. Toxins (Basel) 12. 10.3390/toxins12060377 [DOI] [PMC free article] [PubMed]
  29. Maugeri A, Barchitta M (2020) How dietary factors affect dna methylation: Lesson from epidemiological studies. Med 56:1–26. 10.3390/medicina56080374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mendiburu F (2021) Package ‘agricolae’: statistical procedures for agricultural research
  31. Mizrachi D, Wang Z, Sharma KK, Gupta MK, Xu K, Dwyer CR, Auchus RJ (2011) Why Human Cytochrome P450c21 is a Progesterone 21- Hydroxylase. Biochemistry 50:3968–3974. 10.1021/bi102078e [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mróz M, Gajecka M, Brzuzan P, Zołnierczyk SL, Zielonka Ł, Gajecki MT (2022) Carry-over of zearalenone and its metabolites to intestinal tissues and the expression of CYP1A1 and GSTπ1 in the colon of gilts before puberty. Toxins (Basel) 14 [DOI] [PMC free article] [PubMed]
  33. Pião DDO, Roberto M, Mello BDE, Mortati M, Barbero D, Lopes A, Silva DA, Moura AM, Barbero RP (2023) Does the Mycotoxin Ingestion By Beef Heifers on Feedlot Change the Productive Parameters ? Biosci J 39:1–5. 10.14393/BJ-v39n0a2023-64329 [Google Scholar]
  34. Rai A, Das M, Tripathi A (2020) Occurrence and toxicity of a fusarium mycotoxin, zearalenone. Crit Rev Food Sci Nutr 60:2710–2729. 10.1080/10408398.2019.1655388 [DOI] [PubMed] [Google Scholar]
  35. R Core Team (2026) R: a language and environment for statistical computing. R Foundation for Statistical Computing. https://www.r-project.org/
  36. Rogowska A, Pomastowski P, Sagandykova G, Buszewski B (2019) Zearalenone and its metabolites: Effect on human health, metabolism and neutralisation methods. Toxicon 162:46–56. 10.1016/j.toxicon.2019.03.004 [DOI] [PubMed] [Google Scholar]
  37. Shayevitch R, Askayo D, Keydar I, Ast G (2018) The importance of DNA methylation of exons on alternative splicing. RNA 24:1351–1362. 10.1261/rna.064865.117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Silva L, de Mello A, Oliveira MRB, de Pião D, Silenciato LN, de Quadros TCO, de Souza AH, Barbero RP (2021) Effects of experimental exposure to zearalenone on reproductive system morphometry, plasma oestrogen levels, and oocyte quality of beef heifer. Reprod Domest Anim 56:775–782. 10.1111/rda.13917 [DOI] [PubMed] [Google Scholar]
  39. Stypuła-Trębas S, Minta M, Radko L, Jedziniak P, Posyniak A (2017) Nonsteroidal mycotoxin alternariol is a full androgen agonist in the yeast reporter androgen bioassay. Environ Toxicol Pharmacol 55:208–2011. 10.1016/j.etap.2017.08.036 [DOI] [PubMed] [Google Scholar]
  40. Takagi M, Uno S, Kokushi E, Shiga S, Mukai S, Kuriyagawa T, Takagaki K, Hasunuma H, Matsumoto D, Okamoto K, Shahada F, Chenga T, Deguchi E, Fink-Gremmels J (2011) Measurement of urinary zearalenone concentrations for monitoring natural feed contamination in cattle herds: On-farm trials. J Anim Sci 89:287–296. 10.2527/jas.2010-3306 [DOI] [PubMed] [Google Scholar]
  41. Tolosa J, Rodríguez-Carrasco Y, Ruiz MJ, Vila-Donat P (2021) Multi-mycotoxin occurrence in feed, metabolism and carry-over to animal-derived food products: A review. Food Chem Toxicol 158:112661. 10.1016/j.fct.2021.112661 [DOI] [PubMed] [Google Scholar]
  42. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG (2012) Primer3-new capabilities and interfaces. Nucleic Acids Res 40:1–12. 10.1093/nar/gks596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Upadhaya SD, Park MA, Ha JK (2010) Mycotoxins and their biotransformation in the rumen: A review. Asian-Australasian J Anim Sci 23:1250–1260. 10.5713/ajas.2010.r.06 [Google Scholar]
  44. Yang D, Jiang X, Sun J, Li, Xia, Li X, Jiao R, Peng Z, Li Y, Bai W (2018) Toxic effects of zearalenone on gametogenesis and embryonic development: A molecular point of review. Food Chem Toxicol 119:24–30. 10.1016/j.fct.2018.06.003 [DOI] [PubMed] [Google Scholar]
  45. Zepnik H, Pähler A, Schauer U, Dekant W (2001) Ochratoxin A-induced tumor formation: Is there a role of reactive Ochratoxin A metabolites? Toxicol Sci 59:59–67. 10.1093/toxsci/59.1.59 [DOI] [PubMed] [Google Scholar]
  46. Zhang N (2015) Epigenetic modulation of DNA methylation by nutrition and its mechanisms in animals. Anim Nutr 1:144–151. 10.1016/j.aninu.2015.09.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zinedine A, Soriano JM, Moltó JC, Mañes J (2007) Review on the toxicity, occurrence, metabolism, detoxification, regulations and intake of zearalenone: An oestrogenic mycotoxin. Food Chem Toxicol 45:1–18. 10.1016/j.fct.2006.07.030 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used in this study are available upon request. The authors are committed to providing full access to the relevant data for interested researchers to promote transparency and reproducibility of the results.

Articles from Tropical Animal Health and Production are provided here courtesy of Springer

RESOURCES