Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Mar 4;16:12117. doi: 10.1038/s41598-026-42559-z

The TRAF6/SPP1 axis participates in osteoarthritis progression through regulating the catabolism and anabolism of cartilage matrix

Jiapei Yao 1,#, Jiliu Huang 1,#, Chongrui Li 2,#, JingJing Shang 3, Xiaolong Lin 4, Xindie Zhou 1,5,✉, Yaojun Lu 1,✉
PMCID: PMC13077072  PMID: 41781493

Abstract

Osteoarthritis (OA), a widespread form of degenerative joint disorder, is characterized by the gradual deterioration of articular cartilage.Serving as a versatile signaling mediator, tumor necrosis factor receptor-associated factor 6 (TRAF6) plays a key role in regulating cartilage matrix metabolism by controlling inflammatory mediators. This investigation examines the TRAF6/SPP1 pathway’s dual role in cartilage matrix remodeling during OA pathogenesis. Through integrated approaches including in vitro chondrocyte models, gene manipulation techniques, molecular assays (qRT-PCR, Western blot), and preclinical animal studies, we establish that TRAF6-mediated upregulation of secreted phosphoprotein 1 (SPP1) drives both matrix degradation and repair mechanisms in OA joints. Experimental evidence further demonstrates SPP1’s capacity to modulate chondrocyte-specific genetic markers, thereby influencing tissue degeneration and regenerative processes. These results elucidate the central regulatory mechanism of the TRAF6/SPP1 signaling cascade in OA pathophysiology.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-42559-z.

Keywords: OA, TRAF6, SPP1, Decomposition of cartilage matrix, Cartilage matrix Anabolism

Subject terms: Biological techniques, Diseases, Medical research

Introduction

OA, a commonly seen degenerative joint condition, is mainly characterized by the gradual breakdown of articular cartilage. The balance between anabolic and catabolic activities maintains the homeostasis of the cartilage matrix, and this equilibrium is disturbed in OA1. This imbalance results in the breakdown of the cartilage matrix outpacing its synthesis, leading to cartilage degeneration. The degradation of the matrix is primarily mediated by enzymes, such as matrix metalloproteinases (MMPs)2. Increased activity of these enzymes in OA accelerates the breakdown of key matrix components, including collagen and proteoglycans, further promoting cartilage degeneration3. Cartilage matrix synthesis is also closely linked to the metabolic activity of chondrocytes.

TRAF6 serves as a versatile signaling regulator participating in cytokine signal transduction mechanisms4. In OA pathogenesis, TRAF6 upregulation is markedly observed in both synovial tissues and articular cartilage, highlighting its central involvement in disease advancement5. Research indicates that TRAF6 contributes to the production of inflammatory mediators by activating inflammatory signaling pathways. As an example, higher TRAF6 expression in synoviocytes that have been stimulated with IL-1β boosts the expression of matrix metalloproteinase-13 (MMP13) and p-p65 (the active variant of NF-κB)6. Notably, therapeutic interventions targeting TRAF6 demonstrate enhanced chondrogenic differentiation capacity in mesenchymal stem cells, facilitating articular cartilage repair processes7. These collective insights establish TRAF6 as a key molecular driver in OA pathophysiology and tissue remodeling mechanisms.

Secreted phosphoprotein 1 (SPP1), an acidic phosphoglycoprotein characterized by an arginine-glycine-aspartic acid (RGD) motif, exhibits significant associations with OA. Emerging evidence indicates SPP1 participates in cartilage matrix remodeling through TRAF6-mediated pathways, influencing both degradation and synthesis processes in OA pathophysiology. Research demonstrates elevated SPP1 expression in OA-affected joints modulates chondrocyte survival via PI3K-AKT pathway activation, with heightened levels exacerbating apoptotic mechanisms that accelerate cartilage deterioration. This glycoprotein additionally stimulates matrix metalloproteinase production, particularly MMP-13, which facilitates collagen II and proteoglycan breakdown within articular tissues, culminating in progressive structural damage8. Both TRAF6 and SPP1 are involved in chondrocyte apoptosis and matrix degradation, collectively driving the pathological progression of OA. We hypothesize that SPP1, as a downstream effector of TRAF6, contributes to both the catabolism and anabolism of the cartilage matrix in OA. To explore this hypothesis, we conducted functional analyses examining the roles of TRAF6 and SPP1 in osteoarthritis development, along with their molecular interactions. These investigations aim to advance our understanding of the complex pathophysiological mechanisms underlying OA and illuminate the regulatory networks controlling inflammatory responses, chondrocyte death, and extracellular matrix breakdown. This research aims to establish a theoretical foundation that will facilitate the creation of enhanced therapeutic approaches for OA treatment.

Methods and materials

Materials and antibody

The following antibodies were utilized in this study: TRAF6 (ab227560, Abcam, Cambridge, UK), Hyaluronan synthase 1 (HAS1) (PA5-95599, Invitrogen, USA), β-actin (ab8226, Abcam, UK), and 4′−6-diamidino-2-phenylindole (DAPI) (ab285390, Abcam, UK), all sourced from Abcam. Additional reagents included MMP13 (18165-1-AP, Proteintech, USA), SPP1 (22952-1-AP, Proteintech, USA), and type II collagen alpha 1 chain (COL2A1) (ab307674, Abcam, UK) antibodies acquired from Proteintech. The tissue inhibitor of metalloproteinase 1 (TIMP1) (sc-21734, Santa Cruz, California, USA) antibody was procured from Santa Cruz Biotechnology. Fibronectin fragment (FN-f) preparations followed established protocols as referenced previously9. Recombinant proteins including SPP1 (Eg0754, Proteintech, USA) and osteogenic protein-1 (OP1) (HZ-1229, Proteintech, USA) were obtained from Proteintech. Gibco (Thermo Fisher Scientific, USA) served as the source for fetal bovine serum, and Lipofectamine 2000 (catalog number: 11668019) was purchased commercially.

Reagents including TRIzol (15596026) and Lipofectamine 3000 were acquired from Invitrogen (Carlsbad, CA). Reverse transcription kits and SYBR Green PCR MasterMix for molecular biology applications were purchased from Applied Biosystems (Thermo Fisher Scientific). The protein quantification reagents (P0010S) originated from Beyotime Biotechnology (Shanghai).

Primary chondrocyte isolation and culture procedures

To isolate primary cartilage cells, standardized laboratory protocols were implemented using articular cartilage harvested from Male Sprague-Dawley rats aged 4 weeks. The excised tissue underwent triple PBS rinsing followed by mechanical fragmentation into 1–2 mm2 fragments. Tissue digestion was initiated using a 0.25% trypsin solution and allowed to proceed for 30 min, succeeded by enzymatic treatment with 2 mg/mL collagenase type II solution for four hours under controlled conditions (37℃). Cells were harvested through centrifugation at 1000 rpm for 5 min, after which the pellet was reconstituted using DMEM/F-12 medium enriched with 10% fetal bovine serum (Gibco, USA) and 1% antibiotic-antimycotic supplement. For experimental purposes, chondrocytes at passages 2–3 were selected and maintained in a CO2 incubator (5% CO2, 37℃) under humidified conditions. To ensure optimal cell viability, culture medium was replaced at 48-hour intervals.

Cell transfection

To modulate TRAF6 expression levels, Lipofectamine 2000-mediated transfection was conducted following the supplier’s protocols when cellular monolayers achieved 80% confluency. For co-transfection experiments, either siRNA-TRAF6 or pcDNA3.1-TRAF6 constructs were introduced to suppress or enhance TRAF6 expression respectively. The transfection protocol involved initial dilution of genetic material in Opti-MEM serum-reduced medium (Gibco), followed by combination with Lipofectamine 2000 using manufacturer-specified proportions. These prepared complexes were administered to cells maintained in serum-depleted DMEM/F-12 medium, with subsequent incubation for 6 h at 37℃ under 5% CO₂ humidified conditions. After the incubation period, the culture medium was replaced with complete DMEM/F-12 containing 10% fetal bovine serum, and the cells were further cultured for 42 h before proceeding with subsequent experimental steps10.

Reverse transcription quantitative PCR (RT-qPCR)

Chondrocyte samples were processed with TRIzol reagent (Invitrogen) for total RNA isolation. Equal quantities of RNA underwent reverse transcription employing a commercial cDNA synthesis kit (Applied Biosystems). Gene expression quantification was conducted through SYBR Green-based qRT-PCR (Applied Biosystems) in strict accordance with standardized protocols. A thermal cycling program was employed, beginning with a 10-minute initial denaturation phase at 95℃, subsequently performing 40 cycles of amplification. Each cycle comprised 15 s of denaturation at 95℃ and a 60-second combined annealing/extension phase at 60℃. This thermal profile was established as ideal for all primer pairs through Tm value calculations and subsequent verification via temperature gradient testing.The expression levels of target genes were quantified via the comparative threshold cycle approach(2 − ΔΔCt), with β-actin used as the endogenous reference. Detailed primer sequences appear in Table 1.

Table 1.

qPCR primer sequences for target gene.

Primers Forward (5′–3′) Reverse (5′–3′)
rMMP13 CCTGGAGCCCTGATGTTTC TGGGTCACACTTCTCTGGTG
rCOL2A1 CTGGGAATGTCCTCTGCGAT AGGTTCTCCTTTCTGCCCCT
rSPP1 CCAGCCAAGGACCAACTACA AGTGTTTGCTGTAATGCGCC
rβ-actin CTGTCCACCTTCCAGCAGAT AGCTCAGTAACAGTCCGCC

Western blot analysis

Chondrocyte proteins across experimental groups were isolated through RIPA buffer-mediated lysis. Total protein concentrations were determined utilizing a BCA protein assay kit (P0010S, Beyotime) according to the supplier’s instructions. Protein lysates (40 µg per lane) underwent electrophoretic separation via SDS-PAGE before being electrotransferred onto PVDF membranes11. Following the transfer procedure, membranes underwent blocking treatment through incubation in TBST buffer (Tris-buffered saline containing 0.1% Tween-20) with 5% non-fat milk for 1 h at ambient temperature. Membranes received overnight incubation at 4℃ with specific primary antibodies: MMP13 (1:1000), SPP1 (1:1000), COL2A1 (1:1000), and β-actin (1:5000) as loading control. After performing three washes with TBST buffer, the membranes underwent incubation with horseradish peroxidase-linked secondary antibodies (diluted 1:5000) for 2 h at 37℃. Protein signals were subsequently visualized through enhanced chemiluminescence detection. Protein visualization was achieved through enhanced chemiluminescence (ECL) detection systems (Thermo Fisher Scientific), with signal documentation performed via autoradiography.

Immunofluorescence staining

At room temperature, chondrocytes were fixed with 4% paraformaldehyde for 15 min, followed with 0.1% Triton X solution for 20 min. Then the samples were treated with 1% bovine serum albumin (BSA) for 20 min, followed by incubation with primary antibodies at 4℃ for 8 h. Following triple PBS washing cycles, secondary antibody application (1:500 dilution) proceeded for 60 min. Nuclear counterstaining utilized DAPI solution before fluorescence microscopic examination. Digital image acquisition employed specialized imaging software.

Tissues acquisition

Six osteoarthritic cartilage specimens were obtained from patients who underwent total knee arthroplasty surgery, whereas five healthy control tissue samples were collected from individuals receiving hip arthroplasty due to femoral neck fractures. All specimens were acquired from Changzhou Second Hospital Affiliated to Nanjing Medical University. All collected specimens were promptly frozen at −80℃ to facilitate subsequent analyses. The study protocol was reviewed and approved by the Ethics Committee of Changzhou Second Hospital Affiliated to Nanjing Medical University, and written informed consent was obtained from each participant before tissue collection.

Animal models and ethics compliance

Male Sprague-Dawley rats (8–10 weeks of age, body weight ranging from 300 to 350 g) were purchased from Changzhou Cavens Laboratory Animal Center. Randomization was applied to fifteen animals, which were thereby separated into three experimental cohorts.: control group given saline injections (n = 5), OA model group administered normal saline (n = 5), and OA/SPP1 intervention group treated with recombinant SPP1 protein (n = 5). All animal experiments were performed in accordance with the ARRIVE guidelines.

In the OA group establishment, destabilization of the medial meniscus (DMM) procedure was conducted without compromising articular cartilage or ligamentous structures. To evaluate experimental outcomes, subjects were sacrificed upon completion of the study period through humane euthanasia protocols. Animals were anesthetized via intraperitoneal administration of sodium pentobarbital at a dose of 50 mg/kg body weight, followed by cervical dislocation to guarantee rapid and humane termination of vital functions.​.

Surgical interventions and subsequent animal care protocols were performed following national regulatory guidelines and institutional animal welfare committee standards. The Laboratory Animal Ethics Committee at Zhejiang University provided ethical clearance for this study (Reference Number: ZJU20241083; Date of Approval: January 15, 2024). All experiments were performed according to China’s Laboratory Animal Management Regulations and the ethical guidelines of the NIH Guide for the Care and Use of Laboratory Animals.​.

Histological and immunohistochemical staining

After fixation in 4% paraformaldehyde over a 48-hour period, knee joint specimens underwent decalcification using 10% EDTA solution maintained at 4℃ throughout a month-long process. Following sequential ethanol dehydration, osseous samples were paraffin-embedded. Using a microtome, 5-µm histological sections were prepared and subsequently subjected to ​Safranin O-Fast Green along with hematoxylin-eosin staining protocols as specified by the manufacturer (Sigma–Aldrich). Antigen retrieval involved thermal treatment of bone sections in either citrate buffer (pH 6.0) or antibody-specific retrieval solutions, maintained at 95–100℃ for 30 min. After the slides had cooled naturally to room temperature, they were subjected to three 5-minute washes with PBS. Prior to carrying out the immunohistochemical procedures, endogenous peroxidase activity was inhibited by immersing the slides in a 3% hydrogen peroxide solution for 20 min.Tissue sections received 60-minute room temperature incubation with 5% bovine serum albumin blocking agent to reduce nonspecific interactions before application of primary antibodies targeting TRAF6 (1:100) and MMP13.

Tissue sections were incubated overnight at 4℃ with primary antibodies against TRAF6 and TIMP1 (both at 1:100 dilution) dissolved in 3% BSA blocking solution. After performing three PBS washes, tissue sections underwent incubation with appropriate species-specific secondary antibodies at room temperature for a 60-minute period. Prior to fluorescence microscopic observation, cell nuclei were counterstained with DAPI for 5 min12.

Statistical analysis

Experimental results are expressed as mean ± standard error. Statistical comparisons utilized Student’s t-test for pairwise group analyses and one-way ANOVA for multi-group evaluations. Data analysis was performed with GraphPad Prism version 9.0 and SPSS version 25.0. P value less than 0.05 was defined as statistically significant.

Results

Biological functions of TRAF6 in chondrocytes

To explore the functional significance of TRAF6, we employed siRNA-mediated gene silencing coupled with RNA-Seq profiling in both control chondrocytes and TRAF6-deficient cells. The comparative transcriptomic analysis visualized in Fig. 1A through a volcano plot revealed SPP1 as the most prominently altered gene. Subsequent GO term analysis demonstrated TRAF6’s regulatory influence on critical biological mechanisms encompassing cell cycle control, mitotic progression, chromatin architecture maintenance, and nucleic acid metabolism (Figs. 1B-D). Complementary KEGG pathway13 mapping further associated TRAF6 with multiple functional categories spanning cellular signaling networks, systemic physiological processes, and disease pathogenesis mechanisms (Figs. 1E-F).

Fig. 1.

Fig. 1

Functional enrichment of chondrocytes after TRAF6 knockdown was identified by RNA sequencing. A Volcano plot shows the number of DEGs found in both groups. B Gene ontology (GO) enrichment analysis. C, D GO annotation analysis. E KEGG pathway analysis. F Reactome annotation analysis.

TRAF6 and SPP1 affect the progression of OA

To investigate TRAF6 and SPP1 expression patterns in human osteoarthritis progression, we conducted comparative gene expression profiling between healthy control subjects and individuals diagnosed with OA. Histological examinations through HE and SO staining demonstrated diminished chondrocyte populations accompanied by structural abnormalities in the extracellular matrix of OA-affected cartilage (Fig. 2A). Immunohistochemical evaluations revealed marked upregulation of SPP1 and MMP13 alongside decreased COL2A1 and TIMP1 expression levels in OA specimens, with concurrent elevation of TRAF6 protein expression as illustrated in Fig. 2B and C. These collective observations strongly implicate both TRAF6 and SPP1 in OA pathogenesis. Considering SPP1’s secretory characteristics, our findings support its potential regulatory function in maintaining cartilage matrix homeostasis during disease progression.

Fig. 2.

Fig. 2

Expression of components expressed in human cartilage matrix. A HE staining was used to detect cartilage degeneration in different groups. Histological examination of cartilage matrix alterations was performed using Safranin O-fast green staining technique (scale bar: 20 μm). B, C Immunohistochemistry was used to observe the expression of SPP1, COL2A1, TRAF6, MMP13 and TIMP1 in articular chondrocytes of different groups. *p < 0.05, **p < 0.01, ***p < 0.001.

TRAF6/SPP1 axis in the synthesis and catabolism of OA cartilage matrix

Following confirmation of TRAF6 and SPP1’s potential roles in OA pathogenesis, subsequent investigations focused on deciphering TRAF6-mediated regulation mechanisms governing SPP1 expression to better characterize their functional interplay. Experimental modulation through introducing TRAF6 knockdown and overexpression constructs into OA chondrocytes demonstrated a dose-dependent correlation between TRAF6 levels and SPP1 transcriptional activity (Figs. 3A-B). This regulatory relationship was quantitatively verified through complementary molecular techniques, with both mRNA quantification (qRT-PCR) and protein detection (immunoblotting) revealing TRAF6’s stimulatory influence on SPP1 expression (Figs. 3C-E).

Fig. 3.

Fig. 3

Effect of TRAF6 on SPP1 expression in chondrocytes. A, B Immunofluorescence was used to detect the expression of SPP1 in different groups. The scale bar = 50 μm. C qRT-PCR analysis of SPP1 mRNA expression in different groups. D, E Western blot analysis of SPP1 protein expression levels in different groups. TRAF6-KD: TRAF6 low expression vector intervention; TRAF6-OE: intervention with TRAF6 high expression vector, the same below.

Following the confirmation of TRAF6’s regulatory influence on SPP1, subsequent investigations focused on elucidating how SPP1 modulates OA pathogenesis. Initial experiments assessed the impact of FN-f treatment, SPP1 administration, and their combination on chondrocyte COL2A1 and MMP13 expression patterns. Analytical data revealed marked downregulation of COL2A1 in FN-f-induced OA chondrocytes relative to controls (p < 0.01), whereas SPP1 intervention substantially upregulated this cartilage matrix component (p < 0.001) (Figs. 4A-C). In contrast, MMP13 levels exhibited a notable elevation following FN-f exposure (p < 0.01 versus normal chondrocytes), which was effectively counteracted by SPP1 treatment (p < 0.001) (Figs. 4B-C). These differential expression patterns received consistent verification through complementary qRT-PCR assays and Western blot validations (Figs. 4D-F). The collective evidence substantiates SPP1’s functional involvement in controlling extracellular matrix breakdown processes characteristic of OA pathology.

Fig. 4.

Fig. 4

Role of SPP1 in matrix catabolism in chondrocytes. A, C Immunofluorescence was used to detect the expression of COL2A1 in different groups. The scale bar = 50 μm. B, C Immunofluorescence was used to detect the expression of MMP13 in different groups. The scale bar = 50 μm. D The mRNA expression levels of COL2A1 and MMP13 in different groups were analyzed by qRT-PCR. E, F Western blot was used to analyze the protein expression of COL2A1 and MMP13 in different groups.

To investigate SPP1’s role in cartilage matrix synthesis, we administered the chondrogenic inducer OP1 and evaluated its combinatorial effects with SPP1 on OA chondrocytes. Quantitative analysis revealed OP1 treatment markedly enhanced COL2A1 expression compared to controls (p < 0.05), while combined SPP1 + OP1 exposure produced substantially amplified collagen production (p < 0.001) (Figs. 5A-C). Conversely, MMP13 levels showed significant suppression under OP1 treatment (p < 0.001), with maximal inhibition observed in the dual-treatment cohort (p < 0.001) (Figs. 5B-C). Complementary analytical approaches through qRT-PCR and immunoblotting consistently demonstrated this synergistic interaction between SPP1 and OP1 (Figs. 5D-F). These experimental outcomes confirm SPP1’s pivotal regulatory function in OA cartilage matrix homeostasis and its enhanced therapeutic potential when combined with OP1.

Fig. 5.

Fig. 5

Role of SPP1 in matrix anabolism in OA chondrocytes. A, C COL2A1 expression across different groups was detected via immunofluorescence.The scale bar = 50 μm. B, C Immunofluorescence was used to detect the expression of MMP13 in different groups. The scale bar = 50 μm. D The mRNA expression levels of COL2A1 and MMP13 in different groups were analyzed by qRT-PCR. E, F Protein expression levels of COL2A1 and MMP13 across different groups were analyzed using Western blot.

To verify the effect of SPP1 on OA progression in vivo

To explore the regulatory mechanism of the TRAF6/SPP1 axis in OA chondrocytes, we conducted surgical induction of medial meniscus instability to establish an OA rat model. Articular cavity administration of recombinant SPP1 protein was performed followed by histological evaluation of cartilage specimens. Histochemical staining with HE and SO demonstrated a notable decrease in chondrocyte population within OA specimens relative to normal controls, accompanied by extensive erosion of articular surfaces and disrupted cellular organization. Notably, therapeutic intervention with recombinant SPP1 substantially mitigated cartilage deterioration, preserving structural integrity as illustrated in Fig. 6A. Immunohistochemical evaluation revealed significant upregulation of TRAF6 and MMP13 proteins in OA specimens (p < 0.01), contrasting with diminished TIMP1 expression compared to normal controls. Administration of recombinant SPP1 effectively suppressed TRAF6 and MMP13 expression while restoring TIMP1 levels.

Fig. 6.

Fig. 6

The effect of recombinant SPP1 on OA progression was verified by in vivo experiments. A HE staining was used to detect cartilage degeneration in different groups. The scale bar = 20 μm. Alterations in the cartilage matrix were examined via Safranin O-fast green staining.The scale bar = 50 μm. B, C Immunohistochemistry was used to observe the expression of TRAF6, MMP13 and TIMP1 in articular chondrocytes under different treatments. The scale bar = 20 μm.

Immunohistochemical quantification of TIMP1 expression revealed chondrocyte-specific upregulation (p < 0.01) following SPP1 administration (Fig. 6B-C). The analytical approach involved calculating immunopositive cell ratios within cartilage sections, demonstrating near-saturation staining intensity in both NC and SPP1-treated specimens. Cellular positivity rates were determined through systematic enumeration of labeled chondrocytes relative to total cellularity within defined cartilage zones. These findings indicate SPP1-mediated enhancement of TIMP1 biosynthesis, potentially influencing extracellular matrix preservation in osteoarthritic pathology. Standardized imaging protocols ensured comparative analysis across distinct articular regions, incorporating both hyaline and mineralized cartilage strata to align with MMP13/TRAF6/TIMP1 expression patterns. Histological comparisons between groups revealed distinct stratification patterns, with NC specimens exhibiting characteristic thin hyaline layers overlying mineralized matrices - a structural relationship corroborated by differential TRAF6 and TIMP1 staining distributions.

The non-mineralized cartilage zone exhibited enhanced thickness in osteoarthritic specimens. For histological evaluations, standardized sampling areas were systematically identified across tissue sections to maintain analytical uniformity between experimental groups. Quantitative analysis revealed marked elevation of both SPP1 and HAS1 protein levels in OA specimens relative to normal controls (Fig. 7A-B). This coordinated upregulation suggests a potential collaborative interplay between these molecular markers during OA progression, with SPP1 potentially mediating dual regulatory functions in chondrocyte matrix metabolism through distinct biochemical pathways.

Fig. 7.

Fig. 7

The effect of recombinant SPP1 on OA progression was verified by in vivo experiments. A, B The expression of SPP1 and HAS1 was detected using immunofluorescence. The scale bar = 20 μm.

Discussion

OA represents the predominant form of degenerative joint disorders, primarily impacting weight-bearing joints such as knees and hips, with mechanical overloading being a principal etiological factor. Progressive cartilage degeneration characterizes OA pathogenesis14. This study provides evidence that the TRAF6/SPP1 axis performs a key function in both the synthesis and degradation of chondrocytes in OA. Specifically, we observed that TRAF6 positively regulates SPP1 expression, and SPP1 exerts a dual function in osteoarthritis through its modulation of both cartilage catabolism and anabolism. In the cartilage degradation pathway, SPP1 treatment decreased MMP13 expression, which is a major enzyme responsible for cartilage breakdown, while in the cartilage synthesis pathway, SPP1 increased COL2A1 expression, a key component of the cartilage matrix, and showed synergistic effects with OP1, known to induce cartilage matrix synthesis. Our in vivo experiments further confirmed these findings, demonstrating that intra-articular SPP1 administration reduced cartilage degradation in a DMM rat model, likely through reducing TRAF6 and MMP13 levels while increasing TIMP1 expression.

Research has identified several factors contributing to OA, including obesity, aging, and genetics15. Despite extensive studies on the pathogenesis of OA, effective treatment options remain limited. While joint replacement surgery can provide relief, it often leads to serious complications16. These clinical challenges underscore the critical need for deeper investigation into the cellular signaling pathways and molecular interactions driving OA pathophysiology.

Articular cartilage, a form of hyaline cartilage devoid of blood vessels and nerve tissues, covers the articular surfaces. Characterized by its extreme smoothness, it mainly functions to shape the joint surface and create an almost friction-free interface that facilitates joint motion17. Additionally, articular cartilage serves a critical function in weight-bearing. This tissue is composed exclusively of chondrocytes, which undertake the production of extracellular matrix (ECM) and are tasked with preserving the cartilage’s structure, function, and integrity18. Under normal physiological conditions, a balance exists between the anabolic and catabolic activities of chondrocytes, ensuring a dynamic equilibrium between ECM production and degradation19. However, this balance can be disrupted by pro-inflammatory factors, aging, trauma, and other influences. A reduction in chondrocyte anabolism and/or an elevation in catabolism triggers extracellular matrix (ECM) degradation, thereby contributing to the breakdown of articular cartilage. Furthermore, the limited regenerative capacity of chondrocytes, due to the absence of vascular tissue, exacerbates the process. These combined factors contribute to the development of OA.

Our investigation revealed marked upregulation of TRAF6 and SPP1 expression accompanied by downregulated COL2A1 levels in osteoarthritic cartilage. These molecular shifts correlate strongly with progressive extracellular matrix deterioration and characteristic chondrocyte phenotypic modifications observed during cartilage degradation processes20. TRAF6 functions as a crucial signaling mediator participating in multiple cytokine signaling cascades, whereas SPP1 - an RGD motif-containing acidic glycophosphoprotein - critically regulates cellular adhesion, migratory behavior, and phenotypic specialization across diverse cell populations21.

Earlier research has extensively examined TRAF6’s involvement in the development of osteoarthritis. Rasheed and colleagues revealed that TRAF6 facilitates MAPK and NF-κB signaling activation within chondrocytes affected by OA, promoting the expression of pro-inflammatory genetic markers7. Parallel investigations by Mo’s team demonstrated that reduced Peli1 levels could mitigate osteoarthritis progression through TRAF6-associated mechanisms, achieving dual protective effects on chondrocyte viability and macrophage polarization regulation6. Nonetheless, despite such progress, the exact mechanistic link between TRAF6 and osteopontin (SPP1) in the progression of osteoarthritis remains inadequately elucidated.

The biological significance of SPP1 in osteoarthritis pathology has been increasingly recognized. Experimental evidence from Lin’s group indicated that microRNA-186 exerts chondroprotective effects in OA by suppressing apoptotic pathways through SPP1-mediated PI3K-AKT signaling mechanisms. Complementary findings by Kang’s research team, utilizing single-cell transcriptomic analysis, uncovered SPP1’s critical role as a signaling hub mediating altered intercellular communication networks in osteoarthritic joints. Our current investigation extends these discoveries by elucidating a novel regulatory axis connecting TRAF6 signaling dynamics with SPP1 functional modulation during OA pathogenesis.

This study reveals three key discoveries regarding the TRAF6/SPP1 pathway in osteoarthritis. Initially, we identified TRAF6 as an upstream activator of SPP1 in OA-affected cartilage cells, uncovering a functional interconnection between these signaling components. Additionally, our findings illustrate SPP1’s bidirectional effects on disease progression, simultaneously modulating extracellular matrix breakdown while facilitating tissue repair mechanisms. Crucially, preclinical animal studies confirmed the viability of SPP1-focused interventions, demonstrating significant therapeutic efficacy in mitigating OA symptoms and pathology.

Moreover, our investigation revealed a functional interplay between TRAF6 and SPP1 signaling pathways. Through siRNA-mediated knockdown of TRAF6 in chondrocytes, we detected substantial downregulation of SPP1 expression levels, establishing TRAF6’s positive regulatory role in SPP1 production. This experimental evidence confirms our proposed mechanism wherein SPP1 acts as a downstream mediator of TRAF6 during both cartilage matrix degradation and anabolic processes in osteoarthritis pathogenesis. Our subsequent analyses demonstrated SPP1’s regulatory influence on critical cartilage-related markers, including suppression of COL2A1 expression and elevation of MMP13 activity in OA-affected chondrocytes. These molecular interactions align with the pathogenic mechanisms described in prior studies, reinforcing SPP1’s involvement in OA development.

Translational confirmation was achieved through preclinical validation utilizing the DMM-induced rodent model of osteoarthritis. Therapeutic administration of SPP1 through intra-articular delivery markedly reduced surgically-induced cartilage lesions, accompanied by decreased TRAF6 and MMP13 protein concentrations alongside elevated TIMP1 expression in synovial fluid analyses.

The TRAF6/SPP1 signaling pathway serves as a pivotal regulatory mechanism in cartilage catabolism during OA progression. Furthermore, experimental data indicate that SPP1 potentially stimulates anabolic processes in chondrocytes through HAS1 expression modulation, revealing novel therapeutic perspectives for OA management.

This investigation presents certain constraints requiring acknowledgment. These observations require additional verification across diverse biological models, particularly in human-derived specimens. Subsequent studies should prioritize molecular characterization of TRAF6/SPP1 interactions in OA pathophysiology and systematic assessment of SPP1-targeted therapeutic strategies. Such advancements could facilitate innovative OA intervention development, ultimately enhancing clinical outcomes while alleviating the condition’s substantial healthcare and socioeconomic impacts.

Conclusion

This investigation underscores the pivotal involvement of the TRAF6/SPP1 signaling pathway in OA pathogenesis, particularly concerning its dual regulatory effects on cartilage matrix catabolism and biosynthetic processes. Experimental evidence indicates that triggering this molecular axis correlates strongly with inflammatory processes during articular cartilage deterioration, concurrent with upregulated expression of matrix-degrading proteases and dysregulated chondrocyte metabolic homeostasis. Utilizing complementary cellular models and preclinical animal studies, we revealed TRAF6-mediated enhancement of SPP1 expression and its crucial function in orchestrating cartilage-specific transcriptional programs and extracellular matrix homeostasis. These mechanistic revelations could potentially inform novel therapeutic approaches for OA management through targeted pathway modulation.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Conceptualization: Xiaolong Lin.Data curation: Yaojun Lu.Formal analysis: Xindie Zhou.Funding acquisition: Xindie Zhou.Supervision: Xiaolong Lin.Writing – original draft: Jiliu Huang, Jiapei Yao.Writing – review & editing: Chongrui Li, JingJing Shang.

Funding

We also thank the funding support from Qinghai Province basic research project (2024-ZJ-760), Changzhou Sci&Tech Program (CZ20240029), Science and Technology Project of Changzhou Health Commission (ZD202319, ZD202339 and QN202356), China Postdoctoral Science Foundation (2024M750277), and Top Talent of Changzhou “The 14th Five-Year Plan” High-Level Health Talents Training Project (2022CZBJ059 and 2022CZBJ061).

Data availability

The data sets generated and/or analyzed in the present study can be obtained from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Jiapei Yao, Jiliu Huang and Chongrui Li.

Contributor Information

Xindie Zhou, Email: zhouxindie@njmu.edu.cn.

Yaojun Lu, Email: luyaojun2024@163.com.

References

  • 1.Yao, J. P. et al. Enhanced surface immunomodification of engineered hydrogel materials through chondrocyte modulation for the treatment of osteoarthritis. Coatings10.3390/coatings14030308 (2024). [Google Scholar]
  • 2.Xiong, C. W. et al. Britanin alleviates chondrocyte ferroptosis in osteoarthritis by regulating the Nrf2-GPX4 axis. Arab. J. Chem.10.1016/j.arabjc.2024.105918 (2024). [Google Scholar]
  • 3.Zhou, X. D. et al. Injectable engineered micro/nano-complexes trigger the reprogramming of bone immune epigenetics. Chem. Eng. J.10.1016/j.cej.2023.142158 (2023).37138814 [Google Scholar]
  • 4.Yang, H. Y. et al. A functional polymorphism at the miR-25-3p binding site in the 30-untranslated region of the S1PR1 gene decreases the risk of osteoporosis in Chinese postmenopausal women. Arab. J. Chem.10.1016/j.arabjc.2023.104888 (2023). [Google Scholar]
  • 5.Chen, W. et al. Subchondral osteoclasts and osteoarthritis: new insights and potential therapeutic avenues. Acta Biochim. Biophys. Sin (Shanghai). 56, 499–512. 10.3724/abbs.2024017 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Mo, H. et al. Decreased Peli1 expression attenuates osteoarthritis by protecting chondrocytes and inhibiting M1-polarization of macrophages. Bone Jt. Res.12, 121–132. 10.1302/2046-3758.122.BJR-2022-0214.R1 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rasheed, Z., Rasheed, N., Abdulmonem, W. A. & Khan, M. I. MicroRNA-125b-5p regulates IL-1beta induced inflammatory genes via targeting TRAF6-mediated MAPKs and NF-kappaB signaling in human osteoarthritic chondrocytes. Sci. Rep.9, 6882. 10.1038/s41598-019-42601-3 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Homan, K., Onodera, T., Matsuoka, M. & Iwasaki, N. Glycosphingolipids in osteoarthritis and cartilage-regeneration therapy: Mechanisms and therapeutic prospects based on a narrative review of the literature. Int J Mol Sci10.3390/ijms25094890 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wood, S. T. et al. Cysteine-Mediated Redox Regulation of Cell Signaling in Chondrocytes Stimulated With Fibronectin Fragments. Arthritis Rheumatol.68, 117–126. 10.1002/art.39326 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gawargi, F. I., Shahshahan, H. R. & Mishra, P. K. Tailoring transfection for cardiomyocyte cell lines: balancing efficiency and toxicity in lipid versus polymer-based transfection methods in H9c2 and HL-1 cells. Am. J. Physiol. Heart Circ. Physiol.326, H1406–H1419. 10.1152/ajpheart.00119.2024 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhang, Y. et al. Lactic acid promotes nucleus pulposus cell senescence and corresponding intervertebral disc degeneration via interacting with Akt. Cell Mol. Life Sci.81, 24. 10.1007/s00018-025-05824-4 (2025). [DOI] [PMC free article] [PubMed]
  • 12.Namhong, S. et al. Knee osteoarthritis in young growing rats is associated with widespread osteopenia and impaired bone mineralization. Sci. Rep.10, 15079. 10.1038/s41598-020-71941-8 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kanehisa, M., Furumichi, M., Sato, Y., Matsuura, Y. & Ishiguro-Watanabe, M. KEGG: Biological systems database as a model of the real world. Nucleic Acids Res.53, D672–D677. 10.1093/nar/gkae909 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Batushansky, A. et al. Fundamentals of OA. An initiative of Osteoarthritis and Cartilage. Obesity and metabolic factors in OA. Osteoarthr. Cartil.30, 501–515. 10.1016/j.joca.2021.06.013 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Young, D. A., Barter, M. J. & Soul, J. Osteoarthritis year in review: genetics, genomics, epigenetics. Osteoarthr. Cartil.30, 216–225. 10.1016/j.joca.2021.11.004 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Katz, J. N., Arant, K. R. & Loeser, R. F. Diagnosis and treatment of hip and knee osteoarthritis: A review. JAMA325, 568–578. 10.1001/jama.2020.22171 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Karamanos, N. K. et al. A guide to the composition and functions of the extracellular matrix. FEBS J.288, 6850–6912. 10.1111/febs.15776 (2021). [DOI] [PubMed] [Google Scholar]
  • 18.Zhou, C. et al. Anti-inflammatory supramolecular hydrogel loaded chicoric acid based on graphene oxide modified hyaluronic acid and polyethylene glycol for rheumatoid arthritis treatment. Int. J. Biol. Macromol.287, 138610. 10.1016/j.ijbiomac.2024.138610 (2024). [DOI] [PubMed] [Google Scholar]
  • 19.He, Y. et al. Pathogenesis of osteoarthritis: Risk factors, regulatory pathways in chondrocytes, and experimental models. Biology10.3390/biology9080194 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Peng, Z. et al. The regulation of cartilage extracellular matrix homeostasis in joint cartilage degeneration and regeneration. Biomaterials268, 120555. 10.1016/j.biomaterials.2020.120555 (2021). [DOI] [PubMed] [Google Scholar]
  • 21.Martin-Marquez, B. T. et al. Osteopontin: A bone-derived protein involved in rheumatoid arthritis and osteoarthritis immunopathology. Biomolecules13. 10.3390/biom13030502 (2023). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The data sets generated and/or analyzed in the present study can be obtained from the corresponding author upon reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES