Skip to main content
Mycoscience logoLink to Mycoscience
. 2025 Sep 20;66(5):255–263. doi: 10.47371/mycosci.2025.07.001

Transcriptome analysis of red-light effect on Aspergillus oryzae during rice koji fermentation

Satoshi Suzuki a, Takashi Inaoka a, Ken-Ichi Kusumoto b,*
PMCID: PMC13077285  PMID: 41987832

Abstract

Aspergillus oryzae can respond to light, but reports of the effects of red light on it are inconsistent. Here we sequenced RNA of rice koji during fermentation under red light and in the dark to elucidate the influence of red light on the expression of genes for koji enzymes. The set of differentially expressed genes (DEGs) largely excluded genes involved in conidiation and saccharification. Red light upregulated only one α-amylase gene, which is homologous to amyD of Aspergillus nidulans. As AmyD regulates the molecular weight of α-glucan, red light might regulate α-glucan molecular weight. Red light enhanced α-amylase activity of rice koji in fermentation by A. oryzae, had no effect on glucoamylase and protease activity.

Keywords: alpha glucan, photoreaction, phytochrome, RNA sequencing


Aspergillus oryzae, one of three koji mold species, is used in traditional fermentation in Japan. The koji, a fermentation product of koji mold, is used as an enzyme source for food processing. Light may affect its enzyme activities (Suzuki & Kusumoto, 2023). Several photoreceptor proteins are conserved in A. oryzae, including the near-ultraviolet and blue photoreceptor cryptochrome, the blue photoreceptor white-color complex, the green photoreceptor opsin, and the red photoreceptor phytochrome. Reports of the effects of light wavelengths on A. oryzae are not consistent. The effects of blue light seem to show commonality. Since short-wavelength (high-energy) light is harmful to organisms, the harmful effects of blue light are understandable. In A. oryzae, blue light has a lethal effect (Hatakeyama et al., 2007); it inhibits growth and the activity of several enzymes important in brewing (Hatakeyama et al., 2007; Wakai et al., 2010), inhibits conidiation and amylase production (Sakai, 2017), and inhibits hyphal growth and conidiation (Lin et al., 2021). On the other hand, there are conflicting reports of the effects of red light in A. oryzae: it inhibits conidiation (Hatakeyama et al., 2007), inhibits hyphal growth and the activities of several enzymes (Hatakeyama et al., 2007; Wakai et al., 2010), induces conidiation and amylase production (Sakai, 2017), and has no effect on hyphal growth or conidiation (Lin et al., 2021). By transcriptome analysis in liquid surface culture, we previously showed that white light alters the expression of genes for glycolytic, proteolytic, and lipolytic and other lipid metabolism-related enzymes (which are essential for brewing) (Suzuki & Kusumoto, 2020).

Here, we studied the effect of red-light exposure on gene expression during rice koji fermentation by A. oryzae strain RIB40 (obtained from the National Research Institute of Brewing, Japan) by RNA sequence analysis.

Potato-dextrose agar (Difco, Tokyo, Japan) was used for maintenance and conidiogenesis. To prepare the koji culture, we soaked 20 g of rice grains (Nipponbare) in water overnight. The polishing ratio of the Nipponbare was approximately 90% (Commercially available polished rice for direct human consumption). After the water had been drained for 30 min through a sieve, the grains were covered with a paper towel and steamed in an autoclave for 15 min. The steamed grains were divided into three portions and packed into three 6-cm-diameter disposable plastic Petri dishes in a single layer on the bottom. We added 5 × 105 RIB40 conidia in suspension to the grains and mixed well. The three dishes were covered with a paper towel and placed in a plastic case (W204 D68 H74 mm, Daiso, Higashihiroshima, Japan). The case was enclosed in a plastic bag and incubated at 35 °C for 48 h. During incubation, light was supplied by red LED banks (OSR7CA5111A, 650-670 nm, OptoSupply, Hong Kong) installed on the lid of the case and controlled by a stabilized power supply (Naweisz NP3005, Shenzhen Tiantuoyuan Technology Co., Ltd., China) operating at 7.4 V, 0.06 A. The supply controlled 6 LEDs per dish, 18 LEDs in total. The dishes were arranged in line on the bottom of the case. At 45 mm between the center of the 6 LEDs and the center of the surface of the rice grains in each dish, the photon flux density at the surface (measured by IKS-27/101 photon sensor, Koito, Yokohama, Japan) was 50 µmol m−2 s−1. The LEDs were lit continuously for 48 h during incubation. The LEDs were kept off for 48 h during incubation for control (dark) experiment. The fermented rice koji (1 g from each dish) was suspended in 5 mL of 10 mM sodium acetate buffer (pH 5.0) with 0.5% NaCl and left to stand at 4 °C overnight. The resulting suspensions were filtered through Miracloth (Calbiochem, San Diego, CA, USA) to leave the enzymes in solution.

The glucoamylase activity of the enzyme solutions was measured with a Glucoamylase and alpha-Glucosidase Assay Kit (Kikkoman, Noda, Japan) according to the manufacturer's instructions. One unit of enzyme activity was defined as the amount of enzyme releasing 1 µmol of p-nitrophenol per min. Specific activity was defined as the unit value standardized to the cell mass (in U mg−1).

The α-amylase activity of the enzyme solutions was measured with a α-amylase Assay Kit (Kikkoman, Noda, Japan) according to the manufacturer's instructions. Specific activity was defined as the unit value standardized to the cell mass (in U mg−1).

The neutral protease activity of the enzyme solutions was measured according to Maeda et al. (2015) with a slight modification. The substrate stock solution was prepared by dissolving 1.25% (w/v) azocasein in 100 mM Tris・HCl buffer (pH 7.5) containing 1 mM CaCl2. Samples of enzyme solution (40 µL) were mixed with 160 µL of substrate stock solution and incubated at 37 °C for 20 h. The reaction was terminated by addition of 200 µL of 10% (w/v) trichloroacetic acid, and the sample was centrifuged at 21,600 × g at 4 °C for 10 min. The supernatant (350 µL) was collected and an equal volume of 0.75 M NaOH was added. The absorbance was measured at 440 nm on a U-1900 spectrophotometer (Hitachi High-Tech, Tokyo, Japan). One unit of enzyme activity was defined as an increase of one absorption unit per min at 440 nm. Specific activity was defined as the unit value standardized to the cell mass (U mg−1). The acid protease activity of the enzyme solutions was measured with an Acid Protease Assay Kit (Peptide Institute, Inc., Ibaraki-Shi, Japan) according to the manufacturer's instructions. Specific activity was defined as the unit value standardized to the cell mass (U mg−1). The acid carboxypeptidase activity of the enzyme solutions was measured with an Acid Carboxypeptidase Activity Assay Kit (Kikkoman, Noda, Japan) according to the manufacturer's instructions. Specific activity was defined as the unit value standardized to the cell mass (U mg−1).

Fungal cell mass was determined by the Yatalase method (Fujii et al., 1992). Koji (1 g) was oven-dried at 100 °C for 1 h. The dried koji was ground in a hand mill (Sibata SCM-40A, Tokyo) and then washed three times with 50 mM phosphate buffer (pH 7.0). During washing, Koji suspension was centrifuged at 1900 g for 10 min to separate liquid and solid. Fungal cell walls were digested with 10 mg Yatalase (Takara Bio, Kusatsu, Japan) in 10 mL of 50 mM phosphate buffer (pH 7.0), and the liberated GlcNAc was determined according to Reissig et al. (1955). Fungal cell mass was calculated from the quantified GlcNAc amount according to the following definition: The amount of GlcNAc per mg of cell mass is 139 μg.

Total RNA was isolated by RNAiso Plus (Takara Bio) from the koji. First, 1.3 g of koji was ground with a mortar and pestle in liquid nitrogen. The frozen powder (approximately 0.5 mL volume) was suspended in 4 mL of RNAiso Plus. Following the addition of 800 µL of chloroform, the mixture was centrifuged at room temperature at 5000 g for 15 min, and upper aqueous layer was transferred to another tube. RNA was precipitated by the addition of 0.5 vol of isopropanol and 0.5 vol of 1.2 M NaCl, 0.8 M sodium citrate to aqueous layer. Genomic DNA was degraded by RNase-free DNase (Qiagen, Hilden, Germany). Total RNA was purified by a RNeasy Plant Kit (Qiagen) according to the manufacturer's instructions. Library preparation, sequencing (150-bp paired-end reads), and bioinformatics analysis were performed by Bioengineering Lab. Co., Ltd. (Sagamihara, Japan). Libraries were prepared using the MGIEasy RNA Directional Library Prep Set (MGI Tech) according to the manufacturer's instructions. Sequencing was performed on a DNBSEQ-T7 sequencer. Reads were quality filtered in Sickle v. 1.33 software and mapped on the A. oryzae RIB40 genome aor0-5 (https://nribf21.nrib.go.jp/CAoGDX/Download/) in Hisat 2 v. 2.2.1 software. Reads mapped on exons were counted in FeatureCounts v. 2.0.3 software and normalized to reads per kilobase of exon per million mapped reads, and differentially expressed genes (DEGs) were identified by iDEGES/edgeR software (Sun et al., 2013). The false discovery rate was <0.05. The iDEGES/edgeR returns Estimated DEG value. An Estimated DEG value of 1 indicates a DEG, while a value of 0 represents a non-DEG. Quality control was confirmed by RaNA-seq (Prieto & Barrios, 2020). Gene ontology analysis and KEGG pathway analysis were retrieved from FungiDB (Alvarez-Jarreta et al., 2024). Reference genome sequences and gtf files were obtained from CAoGDX https://nribf21.nrib.go.jp/CAoGDX/). The data have been deposited with links to BioProject accession number PRJDB 19669 in the DDBJ BioProject database. For real-time PCR, the first strand cDNAs were synthesized by PrimeScriptTM RT Master Mix Perfect Real Time (Takara Bio) according to the manufacturer's instructions. Real-time PCR was carried out by Mx3000P with Brilliant III Ultra-Fast SYBR Green QPCR Master Mixes (Agilent Technologies Japan, Ltd., Tokyo, Japan). Relative quantification was performed by Pfaffl method (Pfaffl, 2001). The primers used in real-time PCR were listed in Table 1. All experiments were performed in triplicate. Statistical significance was tested with Student's t-test in MS Excel software.

Table 1. Primers used in this study.

Primer Sequence (5'-3') reference
Histone-F GACAACATCCAGGGTATCACTAAGC Kobayashi et al., 2007
Histone-R CGGGTCTCCTCGTAGATCATGGCAG Kobayashi et al., 2007
glaB-F GTGCAGCACAAAGCCTTGGT Kobayashi et al., 2007
glaB-R TGAAGATGGCAGAGGATTTGAG Kobayashi et al., 2007
amyB-F(QRT) CTGATCTCGATACCACCAAG Nemoto et al., 2012
amyB-R(QRT) GTCGTTGGTGTAAGAAGCGA Nemoto et al., 2012
SAT437(amyD-F) TCGGTCTTCACTCCTTTCAACG this study
SAT438(amyD-R) TGAACAAATCGGGCAACGCTAC this study
SAT441(amyR-F) ATTGGGGATCGCGGATGATTTG this study
SAT442(amyR-R) AGAACCACCCAACACAACACAC this study
SAT443(prtR-F) TGCAACAGTTGAGGATGGCAAG this study
SAT444(prtR-R) TTGGCTTGGAGTCGCAATGTG this study

To elucidate the effect of red light on comprehensive gene expression of RIB40, total RNAs extracted from rice koji incubated under red light and dark condition were sequenced. The sampling time was set at 48 hours to match the typical rice koji making duration at the “dekoji” stage. Under the culture conditions of this study, conidiation had already begun at 48 hours of incubation similarly in both culture (Fig. 1), and partial RNA degradation was observed in some RNA samples. However, the RNA quality remained sufficient for sequencing analysis. Statistical depth was supported by the acquisition of high-quality paired-end reads exceeding 15 million per sample. Mapping with Hisat 2 achieved a mapping rate of at least 82%. The expression values were comparable among samples (Fig. 2A). Although variability derived from the heterogeneity of rice koji cultivation was observed within the sequencing data of the three biological replicates for each culture condition, principal component analysis of sequence reads from each sample showed that samples cultured under dark condition and those cultured under red light formed clearly separated groups (data not shown). iDEGES/edgeR identified 1634 DEGs (false discovery rate <0.05; Fig. 2B), 616 upregulated (Table 2, top 10) and 1018 downregulated (Table 3, top 10) under red light. Enrichment analysis of GO terms showed that genes related to “cellular amino acid metabolic process” and “oxidoreductase activity” were enriched among DEGs upregulated under red light, and genes related to “extracellular space” and “extracellular region” were enriched among DEGs downregulated under red light. KEGG pathway analysis showed no significant enrichment among DEGs upregulated under red light but enrichment of “glycosaminoglycan degradation” and “pentose and glucuronate interconversions” among DEGs downregulated under red light.

Table 2. Top 10 DEGs upregulated under red light.

Gene ID Description
AO090113000106 Has domain(s) with predicted oxidoreductase activity and role in metabolic process
AO090005000583 Ortholog of A. nidulans FGSC A4 : AN1549, A. fumigatus Af293 : Afu8g05600, A. niger CBS 513.88 : An16g07080, Aspergillus wentii : Aspwe1_0187131 and Aspergillus sydowii : Aspsy1_0086712
AO090001000055 Ortholog of Aspergillus flavus NRRL 3357 : AFL2T_02252, Aspergillus terreus NIH2624 : ATET_07085 and Aspergillus carbonarius ITEM 5010 : Acar5010_405538
AO090023000118 protein of unknown function
AO090026000113 Ortholog of Aspergillus flavus NRRL 3357 : AFL2T_07129
AO090138000142 Has domain(s) with predicted oxidoreductase activity and role in oxidation-reduction process
AO090138000002 protein of unknown function
AO090001000014 Putative O-methyltransferase
AO090166000070 Cytochrome P450 monooxygenase
AO090102000426 Ortholog of A. nidulans FGSC A4 : AN3550, A. oryzae RIB40 : AO090138000144, Aspergillus wentii : Aspwe1_0173124, Aspergillus fumigatus A1163 : AFUB_044240 and Aspergillus zonatus : Aspzo1_0105859

Table 3. Top 10 DEGs downregulated under red light.

Gene ID Description
AO090010000171 Has domain(s) with predicted catalytic activity, holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity and role in fatty acid biosynthetic process, macromolecule biosynthetic process, metabolic process
AO090010000161 Has domain(s) with predicted 2-methylcitrate dehydratase activity and role in propionate catabolic process
AO090103000141 Has domain(s) with predicted hydrolase activity, hydrolyzing O-glycosyl compounds activity and role in carbohydrate metabolic process
AO090010000170 Has domain(s) with predicted transferase activity, transferring acyl groups, acyl groups converted into alkyl on transfer activity and role in cellular carbohydrate metabolic process
AO090011000113 Ortholog(s) have cutinase activity and role in cellular carbohydrate catabolic process
AO090010000162 No description found
AO090001000534 protein of unknown function
AO090206r00002 rRNA
AO090701000887 Ortholog(s) have endo-1,4-beta-xylanase activity and role in xylan catabolic process
AO090020000679 Has domain(s) with predicted ATP binding, ATPase activity, ATPase activity, coupled to transmembrane movement of substances, nucleoside-triphosphatase activity, nucleotide binding activity and role in transmembrane transport

Fig. 1 Appearance of the rice koji culture. D: under dark condition. R: under red light condition.

Fig. 1 Appearance of the rice koji culture. D: under dark condition. R: under red light condition.

Fig. 2 Quality control of RNA sequence analysis. A: Expression values for each sample were comparable. B: M-A plot. M-A means “m. value” and “a. value”. The x-axis represents the average expression (a. value), the y-axis represents the ratio of change in expression between groups (m. value). Each gene is plotted as a single point. Pink dots represent differentially expressed genes. G1 means read value of each gene expressed in the dark. G2 means read value of each gene expressed under red light.

Fig. 2 Quality control of RNA sequence analysis. A: Expression values for each sample were comparable. B: M-A plot. M-A means “m. value” and “a. value”. The x-axis represents the average expression (a. value), the y-axis represents the ratio of change in expression between groups (m. value). Each gene is plotted as a single point. Pink dots represent differentially expressed genes. G1 means read value of each gene expressed in the dark. G2 means read value of each gene expressed under red light.

We analyzed the expression of several genes involved in conidiation (Table 4) and saccharification (Table 5). Red light downregulated wA (AO090102000545, RIB40_02007972), which encodes polyketide synthase for conidial green pigment synthesis (Mayorga & Timberlake, 1992), and flbA (AO090026000532, RIB40_02006208), which encodes regulator of FadA G-alpha (Yu et al., 1996). FlbA protein has an RGS (regulator of G protein signaling) domain in its C-terminal part. FlbA negatively regulates FadA G-alpha signaling and induces conidiation (Yu et al., 1996). wA is expressed in conidiophores (Mayorga & Timberlake, 1992). RIB40 generates more conidia in the dark than under white light (Suzuki & Kusumoto, 2020). The higher expression of wA and flbA in the dark than under red light (Table 4) is consistent with the greater production of conidia in the dark. However, most of the conidiation- and conidia-related genes, including central regulators of conidiation (brlA, abaA, and wetA), were not DEGs. BrlA is the most essential transcription factor for the regulation of conidiation, and its transcription is sufficient to induce conidial differentiation (Adams et al., 1988). Therefore, red light did not induce conidiation, and instead slightly reduced it via suppression of flbA. Since wA lies downstream of the control of conidial differentiation and is thought to be expressed during conidial differentiation (Mayorga & Timberlake, 1992), its expression increased likely as a result of conidial differentiation in the dark. Previous studies of RIB40 reported that red light variously inhibits conidiation (Hatakeyama et al., 2007), induces it (Sakai, 2017). Lin et al., reported that red light has no effect on conidiation of Chinese strain of A. oryzae GDMCC 3.31 (Lin et al., 2021). Our data partly support Hatakeyama et al.'s report (flbA expression data).

Table 4. Expression levels of several genes involved in conidiation.

Gene ID a.value m.value Estimated DEG Description
AO090102000545 13.46005 1.547892 1 wA Hydroquinone:oxygen oxidoreductase
AO090026000532 10.45618 1.087097 1 flbA Putative regulator of G-protein signaling protein
AO090026000810 10.3546 0.108809 0 flbB Ortholog(s) have transcription factor activity, sequence-specific DNA binding, transcription regulatory region DNA binding activity
AO090026000200 12.31777 0.429422 0 flbC Transcription regulatory region DNA binding protein
AO090020000217 9.779287 0.339075 0 fluG Ortholog(s) have role in autolysis, conidium formation, hyphal growth, positive regulation of conidium formation and positive regulation of sterigmatocystin biosynthetic process, more
AO090012000577 11.39071 -0.06973 0 fadA Ortholog(s) have GTPase activity, guanyl nucleotide binding activity
AO090005001041 11.22648 -0.24891 0 Ortholog of BrlA
AO090003001587 9.248068 0.095785 0 abaA Ortholog(s) have sequence-specific DNA binding, transcription factor activity, sequence-specific DNA binding, transcription regulatory region DNA binding activity
AO090009000260 9.361259 0.949225 0 wetA Ortholog(s) have role in asexual spore wall assembly, conidium formation, pigment biosynthetic process and positive regulation of conidium formation, more
AO090001000237 10.63091 0.369259 0 veA Ortholog of A. nidulans VeA, a global gene regulator involved in light-sensitive control of differentiation and secondary metabolism
AO090003000489 9.816684 0.0465 0 laeA Methyltransferase
AO090102000309 9.541266 0.566117 0 laeA2 Ortholog(s) have histone methyltransferase activity (H3-K9 specific) activity
AO090701000202 4.129465 -0.44261 0 laeA3 protein of unknown function
AO090011000656 9.877095 0.426458 0 con-10 Ortholog(s) have cytoplasm localization
AO090011000755 10.32334 0.439509 0 yA Putative multicopper oxidase

Table 5. Expression levels of several genes for saccharification enzymes.

Gene ID a.value m.value Estimated DEG Description
AO090003000321 15.84226 1.055455 1 glaB Alpha-1,4-glucan glucohydrolase, glucoamylase involved in polysaccharide degradation
AO090120000196 9.655399 0.730912 1 amyB Alpha-amylase
AO090010000746 11.48132 0.604281 0 glaA Glucoamylase
AO090023000944 14.30645 0.161303 0 amyC Alpha-amylase
AO090003001591 12.86655 0.145749 0 amyA Alpha-amylase involved in starch hydrolysis
AO090120000263 0.74063 0.042892 0 Alpha-amylase
AO090003001498 7.679718 -1.06261 1 amyD Alpha-amylase
AO090113000198 2.012705 1.233011 0 Ortholog(s) have glucan endo-1,3-alpha-glucosidase activity, role in cell septum edging catabolic process and extracellular region, mating projection tip localization
AO090701000558 5.666124 0.716529 0 Extracellular alpha-glucosidase
AO090103000378 6.593338 0.265989 0 Ortholog(s) have dextrin alpha-glucosidase activity, maltose alpha-glucosidase activity, starch alpha-glucosidase activity, sucrose alpha-glucosidase activity, role in maltose metabolic process and cytosol, nucleus localization
AO090005000884 9.617447 0.130864 0 Ortholog(s) have 4-alpha-glucanotransferase activity, amylo-alpha-1,6-glucosidase activity, role in glycogen catabolic process and mitochondrion localization
AO090003001209 13.81578 0.091671 0 agdA Alpha-glucosidase with a role in hydrolysis of alpha-glucose from non-reducing ends of malto-oligosaccharides
AO090026000034 4.815345 0.005267 0 Alpha-glucosidase
AO090005001526 2.879298 -0.01639 0 Ortholog(s) have glucan endo-1,3-alpha-glucosidase activity and role in fungal-type cell wall (1->3)-alpha-glucan metabolic process
AO090701000400 9.664455 -0.16662 0 Ortholog(s) have inulinase activity, sucrose alpha-glucosidase activity, role in inulin catabolic process, raffinose catabolic process, sucrose catabolic process and extracellular region, fungal-type vacuole, mitochondrion localization
AO090005001084 10.25544 -0.43216 0 Alpha-glucosidase
AO090102000559 10.57864 -0.59187 0 Extracellular alpha-glucosidase
AO090038000234 11.25736 0.270249 0 Putative maltase
AO090103000129 5.846881 0.001698 0 Maltase
AO090038000471 12.89092 -0.15198 0 Maltase

Red light downregulated the solid-state-fermentation-specific glucoamylase gene glaB (AO090003000321, RIB40_02003556) (Table 5, Fig. 3B). One of the highly expressed α-amylase gene, amyB (AO090120000196, RIB40_02009862) was estimated as DEGs by RNA seq analysis, but validation by real-time PCR revealed no significant difference in expression levels between under red light and dark condition(Table 5, Fig. 3A). Both enzymes are important for sake brewing and are induced by AmyR (Gomi, 2019). AmyR is a transcription factor which is essential for the starch/maltose-inducible expression of amylolytic genes (Gomi, 2019). amyR (AO090003001208, RIB40_02004435) were not DEGs (data not shown) and validation by real-time PCR revealed no significant difference in expression levels of amyR between under red light and dark condition in this study (Fig. 3D). At present, the effect of red light on the subcellular localization of AmyR remains unclear. The down-regulation of glaB by red light is suggested to be regulated via a pathway independent of AmyR. Our previous study showed that white light represses saccharification activity of RIB40 (Suzuki, 2021). In this study, we measured the enzyme activities of five enzymes―glucoamylase, α-amylase, acid carboxypeptidase, acid protease, which are commonly used as evaluation indices in brewing, and neutral protease, which is considered important in miso and soy sauce brewing―under dark and red light conditions (Fig. 5). Although the glaB gene, which encodes glucoamylase, was downregulated by red light, there was no significant difference in glucoamylase activity between dark and red light conditions (Fig. 5A). In contrast, despite no significant difference in the expression level of amyB, which encodes α-amylase, between the two conditions, α-amylase activity was increased under red light (Fig. 5B). Since glucoamylase isozyme gene glaA and α-amylase isozyme genes amyA and amyC were not DEGs, it is conceivable that the enzyme activities may be regulated at the protein level. Although there is currently no evidence to explain these discrepancies, it is possible that the adsorption efficiency of the enzymes to the cell surface differs between dark and red light conditions. Zhang et. al reported that cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell (Zhang et al., 2017). Red light upregulated only AO090003001498 (RIB40_02004725) (Table 5, Fig. 3C). Koizumi et al. named AO090003001498 (RIB40_02004725) as agtA (Koizumi et al., 2023). AoAgtA plays an important role in the biosynthesis of cell wall α-1,3-glucan in A. oryzae (Koizumi et al., 2023). This gene encodes an α-amylase-like polypeptide with a putative glycosylphosphatidylinositol anchor attachment signal in the C-terminus and 72% identity in amino acid sequence with amyD of Aspergillus nidulans. In A. nidulans, amyD clusters with another amylase gene, amyG, and with an α-glucan synthase gene, agsB (de Groot et al., 2009). Adjacent to AO090003001498 (RIB40_02004725) on the RIB40 genome are genes for a putative glucosyl hydrolase and a putative α-glucan synthase. The putative α-glucan synthase-coding region is on the opposite strand of genomic DNA to AO090003001498 (RIB40_02004725) and the putative glucosyl hydrolase. This arrangement of genes is consistent with that in A. nidulans (He et al., 2014) (Fig. 4). Neither the putative glucosyl hydrolase nor the putative α-glucan synthase was defined as a DEG. Although genes in a cluster are often similarly regulated, and the coding regions of the putative α-glucan synthase and AO090003001498 (RIB40_02004725) appear to share regulatory regions, only AO090003001498 (RIB40_02004725) was upregulated under red light. In A. nidulans, AgsB and AmyG promote α-glucan synthesis, but only AmyD suppresses it (He et al., 2014). AmyD controls the localization of α-glucan in the cell wall of A. nidulans by reducing its molecular mass (Miyazawa et al., 2022). Our data suggest that red light regulates the localization of α-glucan in the cell wall of A. oryzae via upregulating the expression of AO090003001498 (RIB40_02004725). But how red light induces AO090003001498 (RIB40_02004725) remains to be determined. Phytochrome-dependent light signaling in A. nidulans involves the HOG MAPK pathway (Yu et al., 2016). Cell wall stress induces expression of agsA, a 1,3-d-glucan synthase-encoding gene in A. niger (Damveld et al., 2005). Therefore, red light might regulate α-glucan synthesis in A. oryzae via phytochromes and the HOG MAPK pathway.

Fig. 3 Quantitative real-time PCR comparing relative gene expression between under dark and red light conditions. A: amyB. B: glaB. C: AO090003001498. D: amyR. E: prtR. Error bars show SD. Numeral on the square bracket show P value.

Fig. 3 Quantitative real-time PCR comparing relative gene expression between under dark and red light conditions. A: amyB. B: glaB. C: AO090003001498. D: amyR. E: prtR. Error bars show SD. Numeral on the square bracket show P value.

Fig. 4 Contig map from CAoGDX (https://nribf21.nrib.go.jp/CAoGDX/) around AO090003001498 and amyD (AN3308). The three genes are arranged similarly on the A. oryzae and A. nidulans genomes.

Fig. 4 Contig map from CAoGDX (https://nribf21.nrib.go.jp/CAoGDX/) around AO090003001498 and amyD (AN3308). The three genes are arranged similarly on the A. oryzae and A. nidulans genomes.

Fig. 5 Enzymatic activities in rice koji. A: Glucoamylase activity. B: A-amylase activity. C: Acid carboxypeptidase activity. D: Neutral protease activity. E: Acid protease activity. Error bars show SD.

Fig. 5 Enzymatic activities in rice koji. A: Glucoamylase activity. B: A-amylase activity. C: Acid carboxypeptidase activity. D: Neutral protease activity. E: Acid protease activity. Error bars show SD.

The glucoamylase activity (Fig. 5A) and α-glucosidase activity (data not shown) of the koji showed no significant difference between under red light and dark condition. . White light, which includes red light, inhibited the saccharifying activity of RIB40 (Suzuki, 2021). As little as 10 min of white light exposure is sufficient to suppress the expression of genes for glucoamylase in liquid culture of RIB40 (Suzuki & Kusumoto, 2020). The discrepancy with previous studies may be attributed to differences between liquid and solid-state culture, or possibly to the suppression of saccharifying activity by other wavelengths contained in white light.

There was no significant difference in acid carboxypeptidase, neutral protease and acid protease activity between conditions (Fig. 5C, 5D, 5E). There was no DEG among the top 10 most highly expressed proteases and peptidases except pepA (pepO, AO090120000474, RIB40_02010142) (Table 6). AO090120000474 (RIB40_02010142) was most highly expressed protease and downregulated by red light. prtR, which is involved in the regulation of most extracellular peptidase genes (Numazawa et al., 2024) was downregulated by red light (Fig. 3E). Red light may regulate the expression of prtR and subsequently control AO090120000474 (RIB40_02010142) expression via PrtR. The consistently high expression of these nine proteases among top 10 protease under both culture conditions may compensate for the decreased AO090120000474 (RIB40_02010142) activity, potentially accounting for the unchanged total acid protease activity. White light exposure of at least 8 h at any timing during 48 h incubation in the dark halved the rate of neutral protease activity in RIB40 (Suzuki, 2021). So, the inhibitory effect of white light on neutral protease activity may be due to another wavelength.

Table 6. Expression levels of top 10 highly expressed protease genes.

Gene ID a.value m.value Estimated DEG Description
AO090120000474 14.97930 2.25276 1 pepA pepO, Aspergillopepsin O, a predicted extracellular aspartic proteinase
AO090020000517 14.57319 0.04286 0 Ortholog(s) have serineype endopeptidase activity
AO090012000706 13.90661 0.80482 0 ocpA Putative serineype carboxypeptidase
AO090003000693 13.56078 -0.10070 0 pepE Pepsinogen
AO090003000876 12.97179 -0.58453 0 Has domain(s) with predicted serineype peptidase activity and role in proteolysis
AO090020000015 12.85871 -0.53683 0 Cysteinyl dipeptidase
AO090020000351 12.45992 0.15174 0 ocpO Carboxypeptidase O Serineype Cpase
AO090103000332 12.32587 -0.22355 0 Ortholog(s) have serineype carboxypeptidase activity, role in phytochelatin biosynthetic process and endoplasmic reticulum, extracellular region, fungalype vacuole localization
AO090005000457 12.29669 -0.15711 0 Metalloendopeptidase
AO090102000639 12.23018 -0.11975 0 Lysine aminopeptidase, cleaves Nerminal lysine off short peptide substrates

In conclusion, red light downregulated glaB and prtR expression of rice koji in fermentation by A. oryzae, and had no effect on acid and neutral protease activity. Red light was found to enhance α-amylase activity, supporting the findings of Sakai (Sakai, 2017). It may also influence α-glucan synthesis or localization. This information may be helpful to manufacturers of fungal enzymes and to traditional fermentation industries in improving production.

Disclosure

The authors declare no conflicts of interest.

Online resource

Comprehensive Aspergillus oryzae genome database, The National Research Institute of Brewing, https://nribf21.nrib.go.jp/CAoGDX/

Acknowledgements

This research was supported by grants from the Central Miso Research Institute (Chuou Miso Kenkyujo). K.-I. K. was supported by the Institute for Fermentation, Osaka, Japan (grant number K-2021-008). We thank Yuriko Yamamoto for her help in all experiments.

References

  1. Adams, T. H., Boylan, M. T. & Timberlake, W. E. (1988). brlA is necessary and sufficient to direct conidiophore development in Aspergillus nidulans. Cell, 54, 353-362. [DOI] [PubMed] [Google Scholar]
  2. Alvarez-Jarreta, J., Amos, B., Aurrecoechea, C., Bah, S., Barba, M., Barreto, A., Basenko, E. Y., Belnap, R., Blevins, A., Böhme, U., Brestelli, J., Brown, S., Callan, D., Campbell, L. I., Christophides, G. K., Crouch, K., Davison, H. R., DeBarry, J. D., Demko, R. … Zheng, J. (2024). VEuPathDB: the eukaryotic pathogen, vector and host bioinformatics resource center in 2023. Nucleic Acids Research, 52, D808-D816. https://doi.org/10.1093/nar/gkad1003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Damveld, R. A., van Kuyk, P. A., Arentshorst, M., Klis, M. F., van den Hondel, C. A. M. J. J. & Ram, A. F. J. (2005). Expression of agsA, one of five 1,3-α-d-glucan synthase-encoding genes in Aspergillus niger, is induced in response to cell wall stress. Fungal Genetics and Biology, 42, 165-177. https://doi.org/10.1016/j.fgb.2004.11.006. [DOI] [PubMed] [Google Scholar]
  4. Fujii, F., Ozeki, K., Kanda, A., Hamachi, M., & Nunokawa, Y. (1992). A simple method for the determination of grown mycelial content in ricekoji using commercial cell wall lytic enzyme, Yatalase [in Japanese]. Journal of the Brewing Society of Japan, 87, 757-759. [Google Scholar]
  5. Gomi, K. (2019). Regulatory mechanisms for amylolytic gene expression in the koji mold Aspergillus oryzae. Bioscience, Biotechnology, and Biochemistry, 83, 1385-1401. [DOI] [PubMed] [Google Scholar]
  6. de Groot, P. W. J., Brandt, B. W., Horiuchi, H., Ram, A. F. J., de Koster, C. G. & Klis, F. M. (2009). Comprehensive genomic analysis of cell wall genes in Aspergillus nidulans. Fungal Genetics and Biology, 46, S72-S81. [DOI] [PubMed] [Google Scholar]
  7. Hatakeyama, R., Nakahama, T., Higuchi, Y., & Kitamoto, K. (2007). Light represses conidiation in koji mold Aspergillus oryzae. Bioscience, Biotechnology, and Biochemistry, 71, 1844-1849. [DOI] [PubMed] [Google Scholar]
  8. He, X., Li, S. & Kaminskyj, S. G. W. (2014). Characterization of Aspergillus nidulans α-glucan synthesis: roles for two synthases and two amylases. Molecular Microbiology, 91, 579-595. [DOI] [PubMed] [Google Scholar]
  9. Kobayashi, A., Sano, M., Oda, K., Hisada, H., Hata, Y. & Ohashi, S., (2007). The glucoamylase-encoding gene (glaB) is expressed in solid-state culture with a low water content. Bioscience, Biotechnology, and Biochemistry, 71, 1797-1799. https://doi.org/10.1271/bbb.70132 [DOI] [PubMed] [Google Scholar]
  10. Koizumi, A., Miyazawa, K., Ogata, M., Takahashi, T., Yano, S., Yoshimi, A., Sano, M., Hidaka, M., Nihira, T., Nakai, N., Kimura, S., Iwata, T. & Abe, K. (2023). Cleavage of α-1,4-glycosidic linkages by the glycosylphosphatidylinositol anchored α-amylase AgtA decreases the molecular weight of cell wall α-1,3-glucan in Aspergillus oryzae. Frontiers in Fungal Biology, 3, 1061841. https://10.3389/ffunb.2022.1061841 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Lin, S., Qin, H., Zhang, X., Li, W. & Liu, M. (2021). Inhibition of Aspergillus oryzae mycelium growth and conidium production by irradiation with light at different wavelengths and intensities. Microbiology Spectrum, 9, e00213-21. https://doi.org/10.1128/Spectrum.00213-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Maeda, H., Nakagawa, K., Murayama, K., Goto, M., Watanabe, K., Takeuchi, M.& Yamagata, Y. (2015). Cloning a neutral protease of Clostridium histolyticum, determining its substrate specificity, and designing a specific substrate. Applied Microbiology and Biotechnology, 99, 10489-10499. [DOI] [PubMed] [Google Scholar]
  13. Mayorga, M. E. & Timberlake, W. E. (1992). The developmentally regulated Aspergillus nidulans wA gene encodes a polypeptide homologous to polyketide and fatty acid synthases. Molecular and General Genetics, 235, 205-212. [DOI] [PubMed] [Google Scholar]
  14. Miyazawa, K., Yamashita, T., Takeuchi, A., Kamachi, Y., Yoshimi, A., Tashiro, Y., Koizumi, A., Ogata, M., Yano, S., Kasahara, S., Sano, M., Yamagata, Y., Nakajima, T. & Abe, K. (2022). A glycosylphosphatidylinositol-anchored α-amylase encoded by amyD contributes to a decrease in the molecular mass of cell wall α-1,3-glucan in Aspergillus nidulans. Frontiers in Fungal Biology, 2, 821946. 10.3389/ffunb.2021.821946 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Nemoto, T., Maruyama, J.- I. & Kitamoto, K. (2012). Contribution ratios of amyA, amyB, amyC genes to high-level α-amylase expression in Aspergillus oryzae. Bioscience, Biotechnology, and Biochemistry, 76, 1477-1483. https//10.1271/bbb.120142 [DOI] [PubMed] [Google Scholar]
  16. Numazawa, R., Tanaka, Y., Nishioka, S., Tsuji, R., Maeda, H., Tanaka, M., Takeuchi, M. & Yamagata, Y. (2024). Aspergillus oryzae PrtR alters transcription of individual peptidase genes in response to the growth environment. Applied Microbiology and Biotechnology, 108, 90. https://doi.org/10.1007/s00253-023-12833-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research, 29, e45. https//10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Prieto, C. & Barrios, D. (2020). RaNA-Seq: interactive RNA-Seq analysis from FASTQ files to functional analysis. Bioinformatics, 36, 1955-1956. https://doi.org/10.1093/bioinformatics/btz854 [DOI] [PubMed] [Google Scholar]
  19. Reissig, J. L., Strominger. J. L. & Leloir, L. F. (1955). A modified colorimetric method for the estimation of N-acetylamino sugars. Journal of Biological Chemistry, 217, 959-966. https://doi.org/10.1016/S0021-9258(18)65959-9 [PubMed] [Google Scholar]
  20. Sakai, M., (2017). Changes in amylase secretion of Aspergillus oryzae in response to light conditions [in Japanese]. Kagakutoseibutsu, 55, 147-149. https://doi.org/10.1271/kagakutoseibutsu.55.147 [Google Scholar]
  21. Sun, J., Nishiyama, T., Shimizu, K. & Kadota, K. (2013). TCC: an R package for comparing tag count data with robust normalization strategies. BMC Bioinformatics, 14, 219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Suzuki, S. (2021). Effect of light on enzyme activity of fermented rice by koji mold [in Japanese]. Tojuro Iijima Foundation for Food Science and Technology Annual Report 2020, 36, 249-255. [Google Scholar]
  23. Suzuki, S. & Kusumoto, K. I. (2020). Transcriptome analysis of two strains of Aspergillus oryzae with different responses to light. Japan Agricultural Research Quarterly, 54, 13-20. [Google Scholar]
  24. Suzuki, S. & Kusumoto, K. I. (2023). Effect of light exposure on enzyme activity in wheat bran solid-state fermentation by Aspergillus oryzae. Food Science and Technology Research, 29, 475-479. [Google Scholar]
  25. Yu, J.- H., Wieser, J. & Adams T. H. (1996). The Aspergillus FIbA RGS domain protein antagonizes G protein signaling to block proliferation and allow development. EMBO Journal, 15, 5184-5190. [PMC free article] [PubMed] [Google Scholar]
  26. Yu, Z., Armant, O. & Fischer, R. (2016). Fungi use the SakA (HogA) pathway for phytochrome-dependent light signalling. Nature Microbiology, 1, 16019. https//10.1038/NMICROBIOL.2016.19 [DOI] [PubMed] [Google Scholar]
  27. Wakai, Y., Oka, N., Mizuma, T. & Kiyokawa, Y. (2010). Method for Koji fermentation and Seishu brewing [in Japanese]. JPA2010-136696
  28. Zhang, S., Sato, H., Ichinose, S., Tanaka, M., Miyazawa, K., Yoshimi, A., Abe, K., Shintani, T. & Gomi, K. (2017). Cell wall alpha-1,3-glucan prevents alpha-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae. Journal of Bioscience and Bioengineering, 124, 47-53. https://doi.org/10.1016/j.jbiosc.2017.02.013 [DOI] [PubMed] [Google Scholar]

Articles from Mycoscience are provided here courtesy of The Mycological Society of Japan

RESOURCES