Abstract
Astragalus membranaceus, a leguminous herb native to East Asia, is renowned for its rich content of bioactive compounds, particularly triterpenoid saponins and flavonoids, within its roots. Nuclear factor Y (NF-Y) is a key transcription factor family in eukaryotes, known to regulate abiotic stress responses in plants by binding to the CCAAT-box motif in promoter regions. Despite its significance, the NF-Y gene family has not been systematically identified in A. membranaceus prior to this study. Here, we identified 34 AmNF-YC genes from the A. membranaceus genome and characterized their gene lengths, domain architectures, and amino acid sizes. Phylogenetic analysis classified the AmNF-YC members into three distinct subfamilies (I, II, and III). Notably, proteins within the same clade exhibited conserved motif structures, suggesting that evolutionary relatedness may reflect functional similarities. Gene Ontology (GO) enrichment assigned the AmNF-YC genes to 23 functional categories, indicating substantial functional diversification despite the presence of conserved protein motifs. Furthermore, based on cis-acting element analysis, we investigated the responses of AmNF-YC genes to methyl jasmonate (MeJA) treatment. Six AmNF-YC promoters contained MeJA-responsive elements, and NF-YC genes regulated by MeJA exhibited significantly upregulated expression following MeJA treatment. This study provides the first comprehensive identification and characterization of the NF-YC gene family in A. membranaceus, establishing a foundation for future research on their roles in biological processes and stress signaling pathways.
Supplementary information
The online version contains supplementary material available at 10.1186/s12863-026-01412-y.
Keywords: Astragalus membranaceus, NF-Y transcription factor, NF-YC gene family, Gene expression pattern, MeJA treatment
Introduction
The Nuclear Factor Y (NF-Y) transcription factor family, a heterotrimeric complex composed of NF-YA, NF-YB, and NF-YC subunits, is evolutionarily conserved across eukaryotes and plays critical roles in regulating diverse biological processes, including growth, development, and stress responses [1, 2]. The NF-YC subunit is essential for stabilizing the interaction between NF-YA and NF-YB, thereby facilitating DNA binding to CCAAT box motifs in promoter regions [3]. In plants, NF-YC genes are implicated in the regulation of flowering time, drought tolerance, and symbiotic interactions, with emerging roles in secondary metabolism. Despite their significance, the NF-YC gene family remains underexplored in non-model medicinal plants, particularly those valued for their bioactive compounds [3, 4].
Astragalus membranaceus (Huangqi) is a leguminous herb in the genus Astragalus that belongs to the family Fabaceae and is native to East Asia. It is known for its roots rich in triterpenoid saponins (e.g., astragalosides) and flavonoids, which exhibit immunomodulatory, antioxidant, and anticancer properties [5]. Recent studies have indicated that A. membranaceus exhibits antibacterial, anti-inflammatory, and osteogenic effects, potentially aiding in the treatment of bone infections, particularly in the management of osteomyelitis [6]. The biosynthesis of these metabolites is tightly regulated by environmental cues and phytohormones, including jasmonate (JAs). Methyl jasmonate (MeJA), a JA derivative, acts as a signaling molecule that activates defense responses and enhances secondary metabolite production [7]. However, the transcriptional machinery underlying JA-mediated regulation in A. membranaceus, particularly the involvement of NF-YC genes, remains unknown.
Recent genome sequencing efforts in A. membranaceus have enabled the genome-wide characterization of this gene family. Although NF-YCs have been studied in model plants (e.g., Arabidopsis and rice) [8, 9] and crops (e.g., soybean) [10], their evolutionary dynamics and functional diversification in medicinal legumes are poorly understood. This study addresses this gap by systematically identifying and analyzing the AmNF-YC gene family.
In this study, we identified and characterized all AmNF-YC genes in the A. membranaceus genome. Evolutionary analysis was performed to infer phylogenetic relationships, gene duplication events, and synteny with related species. Structural and promoter analyses were performed to uncover conserved motifs and cis-regulatory elements linked to stress and hormone responses. Expression profiling across tissues and under MeJA treatment was performed to identify candidate genes involved in JA signaling and secondary metabolism. By integrating genomic, phylogenetic, and transcriptomic approaches, this study provides foundational insights into the roles of AmNF-YC genes in stress adaptation and bioactive compound biosynthesis, offering potential targets for metabolic engineering in A. membranaceus.
Materials and methods
Identification of the NF-YC genes from A. membranaceus
In this study, plant tissue samples of A. membranaceus, including leaves, roots, and stems, were cultivated in our laboratory, ensuring that no endangered species were involved. We conducted a Hidden Markov Model (HMM) comparison of the predicted NF-YC protein sequences with the plant transcription factor (TF) database. HMMER version 3.0 was used to screen and identify the NF-YC gene family within the A. membranaceus genome database (Table S1).
Phylogenetic analysis of AmNF-YC genes
The NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/orffinder/, accessed on 31 October 2024) was employed to identify members of the AmNF-YC gene family, focusing on open reading frames (ORF) and conserved structural domains. Subsequently, MEME (http://meme.nbcr.net/meme/, accessed on 4 November 2024) was utilized for conserved motif analysis. The protein sequences of AmNF-YC were selected and analyzed using the maximum likelihood (ML) method by the MEGA X [11] software (http://mega.co.nz/, accessed on 9 November 2024) to construct a phylogenetic tree, with 2000 bootstrap replicates established. The TIM2+F+I+G4 model was selected using ModelFinder, as implemented in MEGA X. Finally, iTOL online software [12] was used to visualize the modifications of the evolutionary tree.
Prediction of cis-acting regulatory elements (CAREs) of AmNF-YC genes
To elucidate the regulatory characteristics of the AmNF-YC gene promoters, the upstream sequences of the start codon of the AmNF-YC genes were used as promoter sequences. PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 15 November 2024) was employed to predict the cis-acting elements and conduct statistical analysis.
GO functional annotation analysis of AmNF-YC genes
Functional annotation analysis was conducted using the Blant2GO version 6.0.3. The Gene Ontology (GO) enrichment circle map was generated using the OmicShare Tools (https://www.genedenovo.com/, accessed on 20 November 2024).
Gene expression patterns analysis of AmNF-YC genes
To further investigate the expression patterns of AmNF-YC genes in A. membranaceus, the expression levels of AmNF-YC genes in leaves, stems, and roots were obtained using Perl software. TBtools II version 2.01 [13] was used to construct a heatmap to analyze the expression of AmNF-YC genes in various A. membranaceus tissues, including roots, stems, and leaves. FPKM (Fragments Per Kilobase of transcript per million mapped reads) values of AmNF-YC genes were extracted from the transcriptome data using in-house Perl scripts (Table S2). Spearman’s correlation coefficients were calculated using SPSS version 23.0.
Candidate AmNF-YC genes expression analysis under MeJA treatments
The presence of MeJA-responsive cis-elements in their promoters was the primary criterion used for the initial screening of candidate AmNF-YC genes. The healing tissue material of A. membranaceus (2.0 g) was inoculated into a 250 mL flask containing 100 mL of B5 liquid medium and agitated at 22 °C and 110 rpm. On the 28th day, methyl jasmonate (MeJA) was introduced to the cultured healing tissue of A. membranaceus. The MeJA concentrations applied were 100 µM and 200 µM (Sigma Company, USA), with each MeJA treatment group and the control group (0 µM) consisting of three replicates. Each experimental group, including the control group, was evaluated in triplicate. Total RNA was extracted from frozen plant tissues using the RNAiso Plus reagent (Takara Bio), first-strand cDNA was synthesized from PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio), and the quantitative real-time PCR was performed using the TB Green Premix Ex Taq II (Takara Bio). Expression analysis of the candidate AmNF-YC genes in response to MeJA treatment was conducted using qRT-PCR with primers listed in Table 1. The reference used the EF1α gene in this study. The gene expression results obtained from qRT-PCR were analyzed using the 2-ΔΔCT method [14] from three biological replicates and compared between treatment groups using a one-way ANOVA test. Excel version 2023 was used to generate bar charts.
Table 1.
The qRT-PCR primers used in this study
| Gene ID | Primer F | Primer R |
|---|---|---|
| AmNF-YC02 | GAGCACCGCCAATAGGTACAC | TCCGGCAGCGGCGGCGTC |
| AmNF-YC03 | TGGAACTACCAACGTCAAGAA | CTCGGCTGAAATCATGCGAAC |
| AmNF-YC10 | ACGGTCTCTGGCTTATTGATTCT | TGCCTTCAAATTGGTTGCCAATAA |
| AmNF-YC15 | CGGCCACCAGTTCCCGGTC | CCAAATAACTAACAAACAGAACC |
| AmNF-YC22 | GGCGATTTCGCTGGAGATTTGG | CCTCGTCTTCTTGTTGTCACGTG |
| AmNF-YC29 | CGGCACCTCACCGTCAGC | GGCGAGATACTCGAGGACGGC |
| EF1α (internal reference) | TCAACGACCACTTTGTCAAGCTC | GGTGGTGCAGGAAGACGACAGT |
Results
Screening of the NF-YC genes from A. membranaceus
In constructing a library for BLAST comparison screening, the Pfam database was integrated with the online HMMER software, SMART, and additional databases to screen and compare the transcriptome data of A. membranaceus. This process retained genes with complete NF-YC domains, ultimately identifying 34 AmNF-YC genes, designated as AmNF-YC01 to AmNF-YC34 (Table S1).
Phylogenetic analysis of AmNF-YC genes
A maximum likelihood (ML) phylogenetic tree was constructed using the NF-YC protein sequences from A. membranaceus. The AmNF-YC gene family clustered into three distinct clades (Groups I – III), with Group III containing the majority of members (15 genes) (Fig. 1).
Fig. 1.
The phylogenetic tree of the NF-YC gene family. The phylogenetic tree was constructed with MEGA X using the maximum likelihood (ML) method. The different colors representing different subfamilies
GO functional annotation and enrichment analysis of AmNF-YC genes
All 34 AmNF-YC genes were categorized into three GO functional annotation categories (Fig. 2A, B). Seventeen terms in biological processes (BP) were used, including cellular process (GO:0009987), metabolic process (GO:0008152), regulation of biological processes (GO:0050789), biological regulation (GO:0065007), response to stimulus (GO:0050896) and so on. Four terms in molecular function (MF) were used, including binding (GO:0005488), catalytic activity (GO:0003824), transcription regulator activity (GO:0140110), and molecular transducer activity (GO:0060089). Two terms in cellular components (CC) included cellular anatomical entity (GO:0110165) and protein-containing complex (GO:0032991). In the GO enrichment analysis (Fig. 2C) in CC terms, including nucleosome (GO:0000786), DNA packaging complex (GO:0044815), protein-DNA complex (GO:0032993), chromatin (GO:0000785), and nuclear chromosome (GO:0000228), were significantly highlighted. MF terms, including DNA binding (GO:0003677) and protein heterodimerization activity (GO:0046982), were also significantly highlighted. This indicates that AmNF-YC gene family members are functionally significant in terms of biological function, binding function, and transcription factor activity, and have the characteristics and functions of transcription factors. GO functional annotation and enrichment indicated that the AmNF-YC gene family members have binding specificity for transcription factors and can be involved in the response to stress and secondary metabolic regulation, which can provide rich gene resources for an in-depth study of functional genes in A. membranaceus.
Fig. 2.
GO functional annotation and enrichment analysis of AmNF-YC genes. (A) GO functional annotation category bar graphs. (B) GO functional annotation category diagram at different levels. (C) GO enrichment analysis circle diagram
Cis-acting regulatory elements analysis of AmNF-YC genes
Cis-element prediction of AmNF-YC genes was performed in A. membranaceus (Fig. 3). Eighteen cis-element classes were identified and divided into four categories: light response, stress response, plant hormone response, and plant growth regulation. All 34 AmNF-YC genes contained action elements (CAAT-boxes) in the promoter and enhancer regions. All AmNF-YC genes contained light response elements, except AmNF-YC08, AmNF-YC21, and AmNF-YC25. Six AmNF-YC genes contained methyl jasmonate regulatory elements, among which AmNF-YC29 had 14 regulatory elements related to methyl jasmonate that are predicted that AmNF-YC29 gene plays a key role in the MeJA signal transduction pathway, except for AmNF-YC01, AmNF-YC13, and AmNF-YC14. Eleven AmNF-YC gene regions contain ABA regulatory elements, among which AmNF-YC08 contains five ABREs, the highest among the members. Therefore, we speculated that this gene plays a key role in ABA signal transduction. Most genes also contain cis-acting elements, such as low temperatures and droughts. It is speculated that these genes also respond to stressors. Most AmNF-YC genes contain cis-acting elements involved in plant hormone signaling, stress responses, and plant growth processes. The results show that AmNF-YC is involved in the growth and development of A. membranaceus, playing a key role in hormone stress regulation and participating in coping with adversity and secondary metabolism regulation.
Fig. 3.
The information of cis-acting element analysis on promotors in AmNF-YC gene family members
Gene expression patterns analysis of AmNF-YC genes
The expression levels of the 34 AmNF-YC genes in the roots, stems, and leaves (Fig. 4, Table S2), in which the expression levels of AmNF-YC genes differed among the different tissues. We observed the rise and fall of AmNF-YC genes. Compared to the expression levels of AmNF-YC genes in the leaves and roots, most genes were upregulated. Compared with the expression levels of AmNF-YC genes in leaves and stems, most of them increased, and only a few decreased, whereas compared with the expression levels of AmNF-YC genes in roots and stems, most decreased. This result showed that the expression of AmNF-YC genes was higher in the roots than in the stems and leaves of the plants.
Fig. 4.
Genes expression pattern of AmNF-YC genes in A. membranaceus. Heatmap of AmNF-YC genes expression in different tissues of leaf, root and stem
An interaction network analysis was performed to understand the relationship between the AmNF-YC genes (Fig. 5, p ≤ 0.01). The AmNF-YC genes of each family are closely related and participate in the transmission of biological signals, energy, material metabolism, and other processes in the cell. Intraspecific correlation analysis showed that most genes were mutually promoting, and a few were inhibitory. Different genes showed different differences. The distribution varied among different tissues, which also proves that the functions of different tissues are consistent in A. membranaceus.
Fig. 5.
Network analysis of the AmNF-YC gene family members in A. membranaceus. (A) The expression network comprises 34 AmNF-YC gene members. (B) Different nodes represent AmNF-YC genes selected from four classes: green nodes class I, purple nodes class II, brown nodes class III, and silver nodes class IV
Candidate AmNF-YC genes expression analysis under MeJA treatments
To further investigate the expression of AmNF-YC candidate genes under MeJA treatment, we analyzed their gene expression using qRT-PCR. Among the 34 AmNF-YC genes, six contained methyl jasmonate regulatory elements that responded to MeJA treatment, of which six (AmNF-YC 02, AmNF-YC03, AmNF-YC10, AmNF-YC15, AmNF-YC22, and AmNF-YC29) was significantly upregulated after MeJA treatment (Fig. 6). These qRT-PCR results are consistent with the results obtained from our analyses, which will provide candidate genes and a theoretical basis for further studies on the function of NF-YC genes under the regulation of MeJA.
Fig. 6.
The expressions analysis of candidate AmNF-YC genes under MeJA treatments by the qRT-PCR. Expression profiles of AmNF-YC in different MeJA concentration. The Y-axis indicates AmNF-YC genes relative expression levels, the X-axis indicates different AmNF-YC gene, no treatments group as the control. “*” indicate significant difference at p ≤ 0.05, “**” indicate significant difference at p ≤ 0.01
Discussion
The identification and characterization of the AmNF-YC gene family in A. membranaceus provides critical insights into the evolutionary dynamics, regulatory mechanisms, and functional roles of these transcription factors in stress adaptation and secondary metabolism. The 34 AmNF-YC genes identified in this study enhance our understanding of the NF-Y family in medicinal legumes, particularly in a species valued for its bioactive compounds.
Evolutionary and structural insights
The phylogenetic clustering of AmNF-YC genes into three clades (Groups I–III), with Group III containing the majority of members (15 genes), suggests functional diversification within this family. This grouping partially aligns with the NF-YC subfamilies in other plants, such as Arabidopsis and soybean [8, 10], where NF-YC genes are similarly divided into clades associated with stress responses, development, and hormone signaling. However, the unique expansion of Group III in A. membranaceus may reflect legume-specific adaptations potentially linked to secondary metabolite biosynthesis or symbiotic interactions [15]. Structural conservation in exon-intron organization (4–6 exons) across most AmNF-YC genes underscores the evolutionary stability of the NF-YC domain architecture. In contrast, the divergence observed in Group III genes, such as AmNF-YC29 with 14 MeJA-responsive elements, hints at neofunctionalization driven by tandem or segmental duplications, a common mechanism in gene family expansion.
Functional annotation and regulatory potential
GO enrichment analysis highlighted the role of the AmNF-YC gene family in DNA-binding transcription factor activity (GO:0000981, GO:0003700) and stress response regulation (GO:0050896). The prominence of these terms aligns with the known functions of AmNF-YC genes in modulating abiotic stress tolerance and jasmonate signaling in plants [16]. For instance, the significant enrichment of transcription factor activity supports the hypothesis that AmNF-YC genes act as master regulators that coordinate stress-responsive gene networks. The identification of cis-acting elements, including MeJA-responsive TGACG-motifs and ABA-responsive ABREs, further corroborates their involvement in hormone-mediated stress adaptation. Notably, AmNF-YC29, which harbors 14 MeJA-related elements, emerged as a key candidate for JA signaling, potentially regulating the biosynthesis of astragalosides, triterpenoids induced by jasmonate. Similarly, AmNF-YC08, with five ABREs, may play a pivotal role in ABA-dependent drought responses, a trait critical for A. membranaceus growth in arid environments.
Tissue-specific expression and co-regulation
The root-predominant expression of six AmNF-YC genes (AmNF-YC05, 12, 18, 23, 27, and 31) were spatially correlated with the accumulation of astragalosides in the roots of A. membranaceus. This tissue specificity suggests that these genes may regulate terpenoid backbone biosynthesis or cytochrome P450-mediated modifications, which are key steps in astragal side production. Co-expression network analysis, revealing positive correlations among 22 AmNF-YC genes, implied synergistic interactions in transcriptional regulation. For example, AmNF-YC22 and AmNF-YC29, both of which are highly expressed in roots and enriched with MeJA-responsive elements, may co-regulate JA-induced defense pathways.
MeJA-induced expression and JA signaling
The upregulation of six AmNF-YC genes (AmNF-YC02, 03, 10, 15, 22, and 29) under MeJA treatment underscores their responsiveness to JA signaling, a pathway central to plant defense and secondary metabolism. The induction of AmNF-YC29, which contains the highest number of MeJA-related cis-elements, suggests its role as a transcriptional amplifier in the JA signaling cascades. This is consistent with studies in Nicotiana tabacum [17, 18] and Glycine max [10, 19], where NF-YC genes interact with JAZ repressors and MYC2 to activate JA-responsive genes [20–22]. In Brassica campestris, BcNF-YA8 is positively regulated by ABA signals, with the highest upregulation amplitude, and its expression promotes plant flowering [23]. In Oryza sativa, OsNF-YAs physically interact with JA signaling transcription factors OsMYC2/3 and interfere with JA signaling by dissociating the OsMYC2/3-OsMED25 complex, which inhibits the transcriptional activation of OsMYC2/3. NF-YA transcription factors suppress JA-mediated antiviral defense [24]. However, AmNF-YC29 gene expression was upregulated under MeJA treatment, which may act as a facilitator under specific stress conditions and participate in the regulation of growth, development, and secondary metabolism (triterpenoid saponins and flavonoids) in A. membranaceus.
We identified MeJA-responsive AmNF-YC genes (e.g., AmNF-YC02, 03, 10, 15, 22, and 29) as prime candidate genetic targets for metabolic engineering. Overexpression of these transcription factors in A. membranaceus cultured healing, hairy root cultures, or other plant systems could be a strategic approach to boost the production of valuable astragalosides and flavonoids. We propose that these AmNF-YC genes and their promoter variants could serve as molecular markers for breeding programs. Selecting for superior alleles of these AmNF-YC genes could help develop new A. membranaceus cultivars with inherently higher levels of bioactive compounds, thereby improving the quality and efficacy of herbal products. We also elaborate on the hypothesis that AmNF-YC genes act as a hub integrating JA signaling with other stress pathways (e.g., drought and salinity). This understanding could lead to practical agricultural strategies, such as applying elicitors like MeJA under specific conditions, to enhance stress resilience and simultaneously increase the concentration of valuable secondary metabolites in cultivated A. membranaceus.
Conclusion
This study systematically characterized the AmNF-YC gene family in A. membranaceus, identifying 34 members with diverse roles in transcriptional regulation, stress responses, and secondary metabolism. These findings provide a foundation for leveraging AmNF-YC genes in biotechnological applications to enhance stress resilience and astragal side yield in A. membranaceus. Future research should prioritize functional validation, such as CRISPR editing and metabolomic profiling, to unravel the mechanistic links between AmNF-YCs and secondary metabolism in plants. This study advances our understanding of NF-YC transcription factors in medicinal plants and offers actionable targets for improving the agronomic and medicinal value of A. membranaceus.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Supplementary Material 1: Table S1. Information on the NF-YC gene family in Astragalus membranaceus
Supplementary Material 2: Table S2. Expression information on the NF-YC gene family in Astragalus membranaceus
Author contributions
Shengping Hu : Writing – original draft, Validation, Investigation, Funding acquisition, and data curation. Jun Fei : Writing – review & editing, Visualization, Validation, Investigation. Yanghui Jin : Writing – review & editing, Investigation. Jinping Hu: Writing – review & editing, Investigation. Shiyuan Shi : Writing – review & editing, Investigation. Tianyi Cao : Writing – review & editing, Supervision, Project administration, Funding acquisition.
Funding
This work was supported by the Hangzhou Biomedicine and Health Industry Development Support Science and Technology Special Program (2022WJC263).
Data availability
All Astragalus membranaceus samples and materials are stored at Hangzhou Normal University. The use of plant materials does not pose any risk to other species in nature. No specific permission was required to collect the samples described in this study. All plant materials are available through corresponding authors upon request.
Declarations
Ethical approval
Not applicable.
Informed consent
Not applicable.
Competing interest
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Myers Z, Holt B. Nuclear factor-Y: still complex after all these years? Curr Opin Plant Biol. 2018;45:96–102. [DOI] [PubMed] [Google Scholar]
- 2.Dolfini D, Imbriano C, Mantovani R. The role(s) of NF-Y in development and differentiation. Cell Death Differ. 2025;32(2):195–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Petroni K, Kumimoto RW, Gnesutta N, Calvenzani V, Fornari M, Tonelli C, et al. The promiscuous life of plant nuclear factor Y transcription factors. Plant Cell. 2012;24(12):4777–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hussain H, Fatima N, Sajid M, Mehar I, Noor M, Attia K, et al. Genome-wide analysis and identification of nuclear factor Y gene family in switchgrass (Panicum virgatum L.). BMC Genomics. 2024;25:1218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Liu P, Zhao H, Luo Y. Anti-aging implications of Astragalus membranaceus (Huangqi): a well-known Chinese tonic. Aging Dis. 2017;8(6):868–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tian H, An L, Wang P, Zhang X, Gao W, Li X. Review of Astragalus membranaceus polysaccharides: extraction process, structural features, bioactivities and applications. Chin Herb Med. 2025;17:56–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shiade S, Arameh Z, Fathi A, Rahimi R, Minkina T, Rajput V, et al. Plant metabolites and signaling pathways in response to biotic and abiotic stresses: exploring bio stimulant applications. Plant Stress. 2024;12:100454. [Google Scholar]
- 8.Siefers N, Dang K, Kumimoto R, Bynum W, Tayrose G, Holt B. Tissue-specific expression patterns of Arabidopsis NF-Y transcription factors suggest potential for extensive combinatorial complexity. Plant Physiol. 2009;149(2):625–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wen Y, Zhan L, Yu X, Jia Y. Genome-wide identification and co-expression network analysis of the OsNF-Y gene family in rice. Crop J. 2017;5:21–31. [Google Scholar]
- 10.Quach T, Nguyen H, Valliyodan B, Joshi T, Xu D, Nguyen H. Genome-wide expression analysis of soybean NF-Y genes reveals their potential function in development and drought response. Mol Genet Genom. 2015;290:1095–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kumar S, Stecher G, Suleski M, Sanderford M, Sharma S, Tamura K. Molecular evolutionary genetics analysis version 12 for adaptive and green computing. Mol Biol Evol. 2024;41:1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Letunic I, Bork P. Interactive tree of life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021;49(W1):W293–96. [DOI] [PMC free article] [PubMed]
- 13.Chen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, et al. TBtools-II: a one for all, all for one bioinformatics platform for biological big-data mining. Mol Plant. 2023;16(11):1733–42. [DOI] [PubMed] [Google Scholar]
- 14.Livak K, Schmittgen T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–08. [DOI] [PubMed] [Google Scholar]
- 15.Jiang L, Ren Y, Jiang Y, Hu S, Wu J, Wang G. Characterization of NF-Y gene family and their expression and interaction analysis in Phalaenopsis orchid. Plant Physiol Biochem. 2023;204:108143. [DOI] [PubMed] [Google Scholar]
- 16.Song T, Li J, Yuan Y, Yu J, Cao Y, Cai H, et al. Genome-wide identification and analysis of the NF-Y transcription factor family in Medicago sativa L. Agronomy. 2022;12:1237. [Google Scholar]
- 17.Tian Y, Song K, Li B, Song Y, Zhang X, Li H, et al. Genome-wide identification and expression analysis of NF-Y gene family in tobacco (Nicotiana tabacum L.). Sci Rep. 2024;14:5257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Tian Z, Xue L, Fu J, Song W, Wang B, Sun J, et al. Genome-wide identification and analysis of the NF-Y transcription factor family reveal its potential roles in tobacco (Nicotiana tabacum L.). Plant Signal Behav. 2025;20:2451700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Romier C, Cocchiarella F, Mantovani R, Moras D. The NF-YB/NF-YC structure gives insight into DNA binding and transcription regulation by CCAAT factor NF-Y. J Biol Chem. 2003;278(2):1336–45. [DOI] [PubMed] [Google Scholar]
- 20.Zhai J, Hao H, Xiao H, Cao Y, Lin X, Huang X. Identification of JAZ-interacting MYC transcription factors involved in latex drainage in Hevea brasiliensis. Sci Rep. 2018;8:909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhao X, He Y, Liu Y, Wang Z, Zhao J. JAZ proteins: key regulators of plant growth and stress response. Crop J. 2024;12:1505–16. [Google Scholar]
- 22.Sui J, Yin Q, Chen Y, Sun M, Yuan X, Ding Z, et al. ERF114/115/109 are essential for jasmonate-repressed non-canonical JAZ8 activity in JA signaling. Cell Rep. 2025;44:115222. [DOI] [PubMed] [Google Scholar]
- 23.Li Y, Tao Y, Bai A, Wang H, Yu Z, Liu T, et al. Genome-wide analysis of the NF-Y gene family in non-heading Chinese cabbage and the involvement of BcNF-YA8 in ABA-mediated flowering regulation. Hortic Plant J. 2025;11:661–79. [Google Scholar]
- 24.Tan X, Zhang H, Yang Z, Wei Z, Li Y, Chen J, et al. NF-YA transcription factors suppress jasmonic acid-mediated antiviral defense and facilitate viral infection in rice. PLoS Pathog. 2022;18(5):e1010548. [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Material 1: Table S1. Information on the NF-YC gene family in Astragalus membranaceus
Supplementary Material 2: Table S2. Expression information on the NF-YC gene family in Astragalus membranaceus
Data Availability Statement
All Astragalus membranaceus samples and materials are stored at Hangzhou Normal University. The use of plant materials does not pose any risk to other species in nature. No specific permission was required to collect the samples described in this study. All plant materials are available through corresponding authors upon request.






