Abstract
BACKGROUND:
Despite the major advances in the treatment, the overall survival of osteosarcoma remains poor. MicroRNAs (miRNAs) are involved in tumorigenesis and progression though modulating their target genes. In the present study, the roles of miR-1285-3p in osteosarcoma was investigated.
METHODS:
Microarray profiling was applied to distinguish the up and down regulated microRNAs in osteosarcoma. Quantitative real-time PCR (qRT-PCR) assay was performed to detect the expression of miR-1285-3p and YAP1 expression. MTT and transwell assays were carried out to determine the cells proliferation and invasion respectively. Moreover, dual luciferase reporter assay was performed to evaluate the binding efficiency between miR-1285-3p and the 3’UTR of YAP1.
RESULTS:
MiR-1285-3p was down regulated in osteosarcoma tissues and cell lines and the reduction of miR-1285-3p expression predicted a poor overall survival of osteosarcoma patients. Ectopic expression of miR-1285-3p inhibited osteosarcoma cell proliferation, colony formation and invasion. In addition, YAP1 was further demonstrated as a direct target of miR-1285-3p. Moreover, overexpression of YAP1 reversed the inhibitory effects of miR-1285-3p on osteosarcoma cells proliferation and invasion.
CONCLUSIONS:
MiR-1285-3p which was low expressed in osteosarcoma inhibited the proliferation and invasion of osteosarcoma cells via direct targeting YAP1. These results suggested that miR-1285-3p might be a potential therapeutic targets and biomarker in osteosarcoma.
Keywords: miR-1285-3p, YAP1, osteosarcoma, proliferation, invasion, prognosis
1. Introduction
Osteosarcoma, accounting for 20–35% of malignant bone tumors, represents a primary malignant bone tumor predominantly affecting children and adolescents [1, 2]. Despite major advances in treatment over the past decades, such as wide tumor excision, adjuvant chemotherapy and radiotherapy, the survival rate of patients with osteosarcoma remains poor [3]. Although recent advances in molecular biology have provided insight into the molecular pathogenesis of osteosarcoma, the exact molecular mechanisms underlying osteosarcoma are still not clarified [4]. Therefore, it is urgent to elucidate novel molecular targets which is facilitate to develop alternative therapeutic and diagnosis strategies for improving clinical outcome of patients with osteosarcoma.
MicroRNAs (miRNAs) which belong to a group of short non-coding RNA molecules consisting of about 18–22 nucleotides play critical roles in the pathogenesis of human diseases by binding to the 3 untranslated region (UTR) of their target mRNAs [5, 6]. Meanwhile, growing evidence suggested that abnormal expressions of miRNAs contributed to tumorigenesis and could function as oncogenes or tumor suppressors according to the roles of their target genes [7, 8]. For instance, previous study demonstrated that miRNA-372 and miRNA-373 were oncogenes in testicular germ cell tumors while miR-let-7 was a tumor suppressor in lung cancer [9, 10]. However, the roles of miRNAs in osteosarcoma had only recently been investigated and remained largely unknown. Hence, a clear understanding of the detailed roles and molecular mechanisms of miRNAs in osteosarcoma might lead to the discovery of novel miRNA targets or biomarkers for osteosarcoma.
In the present study, we explored the potential functions of miR-1285-3p in osteosarcoma. We found that miR-1285-3p was down-regulated in osteosarcoma tissues which was significantly associated poor prognosis in osteosarcoma patients, and miR-1285-3p suppressed the proliferation and invasion of osteosarcoma cells in vitro. Moreover, we further demonstrated that Yes associated protein 1 (YAP1) was the direct target gene of miR-1285-3p. Therefore, our outcomes suggested that miR-1285-3p might be a promising therapeutic targets and biomarker in osteosarcoma.
2. Materials and methods
2.1. Patients and samples
Surgically resected paired osteosarcoma tumor tissues and corresponding non-cancerous bone tissue samples were collected from 120 primary osteosarcoma patients at Huai’an First People’s Hospital. All the tissues were immediately stored in liquid nitrogen until use. This study was approved by the Research Ethics Committee of Huai’an First People’s Hospital and written informed consent was obtained from all of the patients. All the patients did not receive any perioperative chemotherapy before surgery. The clinicopathological information of the patients was in Table 2. The clinical stage of these osteosarcoma patients was classified according to the sixth edition of the TNM classification of the Union for International Cancer Control (UICC).1
Table 2.
Correlation of miR-1285-3p expression with clinicopathological features of osteosarcoma
| Clinicopathological | Number | miR-1285-3p expression | ||
|---|---|---|---|---|
| features | of cases | High | Low | |
| Age | NS | |||
| 20 years | 56 | 30 | 26 | |
| 20 years | 64 | 32 | 32 | |
| Gender | NS | |||
| Male | 63 | 35 | 28 | |
| Female | 57 | 27 | 30 | |
| Tumor size | NS | |||
| 8 cm | 63 | 32 | 31 | |
| 8 cm | 47 | 20 | 27 | |
| Anatomic location | NS | |||
| Tibia/femur | 79 | 41 | 38 | |
| Elsewhere | 41 | 21 | 20 | |
| Response to chemotherapy | NS | |||
| Good | 67 | 39 | 28 | |
| Poor | 53 | 23 | 30 | |
| Clinical stage | 0.004 | |||
| IIA | 70 | 44 | 26 | |
| IIB/III | 50 | 18 | 32 | |
| Distant metastasis | 0.011 | |||
| Absent | 62 | 39 | 23 | |
| Present | 58 | 23 | 35 | |
2.2. Cell lines and cell culture
Human osteosarcoma cancer cell lines, Saos-2, U2OS, MG63 and HOS, and osteoblast hFOB1.19 were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Xuhui, Shanghai, China). All the cell lines were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Life Technologies, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 g/ml streptomycin. All cells were incubated under 5% CO in a humidified chamber at 37C.
2.3. Cells transfection
The miR-1285-3p mimics and control mimics were synthesized by GenePharma (Pudong, Shanghai, China) and were transfected into the cells with a final oligonucleotide concentration of 20 nmol/L. The overexpression of YAP1 plasmids were constructed by GeneChemCo., Ltd. (Pudong, Shanghai, China). All of the cell transfections were carried out with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Briefly, MG63 or U2OS cells were planted into 12-well plates and maintained at 37C with 5% CO until the cell confluence reached about 70%. Afterwards, 2 l miRNA mimics (final concentration: 20 nmol/L) or/and 2 g YAP1 overexpressing plasmids were added into 200 l Opti-MEM supplemented with 2 l Lipofectamine 2000 reagent. The mixture was kept at room temperature for 15–20 min and subsequently added into each well of the plates. After culturing for about five hours, the medium was changed with fresh complete medium, and the cells were used for experiments.
2.4. RNA extraction and quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from tissue samples or cell lines using TRizol reagent (Invitrogen, Carlsbad, CA, USA) and the miRNA was purified with miRNeasy mini kit (Qiagen, Hilden, Germany). For mRNA detection, 2 g total RNAs were first reversely transcribed into cDNA using PrimeScript RT Master Mix kit (TAKARA, Dalian, Liaoning, China). Thereafter, the quantitative real time PCR assays were performed in triplicate using SYBR Green Realtime PCR Master Mix (TaKaRa, Dalian, Liaoning, China) with specific set of primers on Applied Biosystems 7300 Real Time PCR system (Applied Biosystems, Foster City, CA, USA). For miRNA determination, the cDNA was synthesized from the isolated miRNAs using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). The 2 relative quantification method was used to calculate relative mRNA and miRNA expression. All mRNA quantification data were normalized to GAPDH and all miRNA quantification data were normalized with U6 expression. The qRT-qPCR assays were performed in triplicate. Primers were listed in Table 1.
Table 1.
The primers for PCR
| Name | Sequence (5’3’) | |
|---|---|---|
| YAP1 | Forward | TTGTGAATTAAAGTGGCACCAG |
| Reverse | AGGCTTTTCATAGCAGCTTTTG | |
| miR-1285-3p | Forward | TCTGGGCAACAAAGTGAG |
| Reverse | CTCAACTGGTGTCGTGGA | |
| U6 | Forward | CTCGCTTCGGCAGCACA |
| Reverse | AACGCTTCACGAATTTGCGT | |
| GAPDH | Forward | CGCGCCCCCGGTTTCTA |
| Reverse | GGCTCGGCTGGCGAC |
2.5. miRNA profiling
MiRNA profiling was performed using Exiqon mercury LNA (Exiqon, Inc., Woburn, MA, USA). Labeling and hybridization of total RNA samples were conducted according to the manufacturer’s instructions. Briefly, 100 ng total RNA was added into the labeling reaction, and subsequently hybridized to the array for 20 h at 55C. After they were washed, the array slides were further scanned by an Axon GenePix Professional 4200A microarray scanner (Molecular Devices Corporation, Sunnyvale, CA, USA). The images were visualized using Imagene v.6 (BioDiscovery, Inc., El Segundo, CA, USA) and the data were analyzed using GeneSpring V. 7.1 software (Agilent technologies, Santa Clara, CA, USA).
2.6. Cell proliferation assay
Cell proliferation was analyzed using 3-[4, 5-dim- ethylthiazol-2-yl]-2, 5 diphenyltetrazolium bromide (MTT; Sigma-aldrich, St. Louis, MO, USA) assay according to the manufacture’s protocol. Briefly, MG63 cells or U2OS cells were first transfected with corresponding miRNA mimics (NC mimics or miR-1285-3p mimics) or/and plasmids (YAP1 overexpressing plasmids). Subsequently, the treated MG63 cells or U2OS cells were collected and separately seeded into 96-well plates (at a density of 1 10 cells per well) in triplicate. At different timepoints (24 h, 48 h, 72 h and 96 h), the cells in each well were incubated with 10 l MTT solution (5 mg/mL) at 37C for another 4 h. Then, the medium was removed, and the precipitated formazan was dissolved in 100 L of dimethylsulfoxide (DMSO). Finally, the optical absorbance at a wavelength of 490 nm was determined using a microplate reader (Thermo Scientific, Hudson, NH, USA). In this study, the cell viability was expressed as absorbance (490 nm) because the cell viability was positive associated with the value of absorbance 490 nm.
2.7. Colony formation assay
Cells were plated in 6-well plates (1000 cells/well) followed by incubation at 37C overnight and the media was changed every 2 days. After two weeks incubation, the cells were washed twice with PBS and stained with crystal violet solution (1% crystal violet and 10% ethanol). The colonies were counted after the excess crystal violet (Sigma-Aldrich, Germany) was washed out with PBS. Colonies larger than 75 m in diameter or containing more than 50 cells were counted as 1 positive colony. An inverted microscope (IX71, Olympus, Tokyo, Japan) was utilized to count the cell colonies.
2.8. Transwell invasion assay
The invasion capabilities of MG63 and U2OS cells were measured by the number of cells invading Matri- gel-coated transwell chambers (Millipore, Billerica, MA, USA). Briefly, the miRNA mimics or/and plas- mids-transfected MG63 or U2OS cells (200 l; 2.5 10 cells/ml) were added into each top chamber followed by incubation for 4 h for complete attachment. The lower chambers were subsequently added with 600 l of medium containing 10% fetal bovine serum (FBS). After incubating for 16 h, a cotton swab was used to remove the non-invading cells on the upper surface. The invasive cells located on the lower surface were fixed with 4% paraformaldehyde for 15 min and then stained with 0.1% crystal violet for 5 min. Then, an inverted microscope (IX71, Olympus, Tokyo, Japan) was applied to photograph over 3 randomly chosen fields and count the cell number.
2.9. Dual luciferase assay
Dual luciferase reporter assay was performed to evaluate the binding efficiency between miR-1285-3p and the 3’UTR of YAP1. Briefly, MG63 or U2OS cells (1 10/well) were seeded in 24-well plates. After the cells reached 70% confluence, pMIR-YAP1-3’UTR wild-type plasmid (YAP1 WT 3’UTR) or mutant reporter plasmid (YAP1 MUT 3’UTR) and pRL-SV40 renilla plasmid (Promega, Fitchburg, WI, USA) were co-transfected with miR-1285-3p mimics or Control mimics (NC mimics) into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the protocols described above. The luciferase activity was subsequently measured using the dual-luciferase reporter assay kit (Promega, Fitchburg, WI, USA) according to manufacturer’s protocols.
2.10. Western blot analysis
Cells after treatment with corresponding miRNA mimics or plasmids were washed twice with phosphate-buffered saline (PBS) solution and lysed using lysis buffer (Beyotime, Pudong, Shanghai, China) for 30 min on ice. Bradford protein assay kit (Bio-Rad, USA) was used to detect the protein concentrations of the lysates. Standard methods were carried out to perform western blot assay. Briefly, proteins were separated by 10% SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Darmstadt, Hessen, Germany). Subsequently, proteins were blocked with 5% non-fat dried milk for 1 h and probed overnight at 4C with primary antibodies: Anti-YAP1 antibody (#ab52771, Abcam), Anti-GAPDH antibody (#ab181602, Abcam). On the second day, the membranes were washed with TBST for three times, and HRP-conjugated secondary antibodies were employed to incubate with the membranes for 1 h at room temperature. Finally, the proteins were visualized using the Chemiluminescent ECL reagents (Amersham Bio-sciences, Uppsala, Sweden).
2.11. Statistical analysis
Data was analyzed using SPSS 13.0 (statistical package for the Social Sciences Version 13.0, SPSS Inc., Chicago, IL, USA). All data from three independent experiments were presented as the mean SD. Statistical comparisons were evaluated by Student’s t-test between two groups. Kaplan-Meier analysis was used to evaluate the effects of miR-1285-3p expression on the overall survival of patients with osteosarcoma, and the overall survival rate was tested by log-rank test. Univariate and multivariate analysis of the prognostic factors was performed with Cox regression model. The correlation between miR-1285-3p and YAP1 expression in osteosarcoma tissue samples was assessed by Pearson’s correlation test. -values of 0.05 were considered to indicate statistically significant results.
3. Results
3.1. miR-1285-3p expression is down-regulated in osteosarcoma tissues and associated with clinical features
To clarify the miRNAs functions in osteosarcoma, microarray profiling was conducted and bioinformatics analysis suggested that miR-1285-3p was down-regulated in osteosarcoma tissues compared with the normal tissues (Fig. 1A). Consistent with the microarray data, qRT-PCR assay further demonstrated that miR-1285-3p was down-regulation in osteosarcoma tissues ( 120) and up-regulated in adjacent normal tissues (normal vs. tumor 6.23 2.83 vs. 3.42 1.78, 0.01, 120, Fig. 1B). In addition, the expression of miR-1285-3p in osteosarcoma cancer cell lines including Saos-2, U2OS, MG63 and HOS were also reduced determined by qRT-PCR assay (Saos-2 vs. hFOB1.19 0.58 0.18 vs. 1.05 0.24, 0.01; U2OS vs. hFOB1.19 0.31 0.12 vs. 1.05 0.24, 0.01; MG63 vs. hFOB1.19 0.37 0.12 vs. 1.05 0.24, 0.01; HOS vs. hFOB1.19 4.17 0.13 vs. 1.05 0.24, 0.01, Fig. 1C). Furthermore, we analyzed the relationship between miR-1285-3p expression and clinicopathological features of patients with osteosarcoma and the data suggested that miR-1285-3p expression levels were correlated with clinical stage ( 0.004) and distant metastasis ( 0.011) while there was no significant difference among other features such as age, gender and tumor size (Table 2). Besides, overall survival analyzed validated that osteosarcoma patients with low miR-1285-3p expression had poor prognosis than the high miR-1285-3p expression group ( 0.014, Fig. 1D). Univariate and multivariate analysis further suggested that clinical stage ( 0.009), distant metastasis ( 0.024) and miR-1285-3p expression levels ( 0.008) were significantly associated with overall survival (Table 3). Collectively, our data certified that miR-1285-3p was down-regulated in osteosarcoma and its lower expression predicted a poor overall survival, which indicated a therapeutic and prognostic potential of miR-1285-3p in osteosarcoma.
Figure 1.

Expression levels of miR-1285-3p in osteosarcoma tissues and cell lines. (A) Heatmap of the differential expression microRNAs between osteosarcoma tissues and normal tissues. (B) Relative expression levels of miR-1285-3p in osteosarcoma tissues and normal tissues ( 120). (C) The expression levels of miR-1285-3p was analyzed in osteoblast cells (hFOB 1.19) and osteosarcoma cell lines including Saos-2, U2OS, MG63 and HOS cells. (D) Kaplan-Meier survival curves analysis of overall survival ( 120, 0.014). The values were means SEM. * 0.05, ** 0.01.
Table 3.
Univariate and multivariate analyses for overall survival in osteosarcoma patients
| Variable | Univariate analyses | Multivariate analyses | ||||
|---|---|---|---|---|---|---|
| HR | 95% CI | value | HR | 95% CI | value | |
| Age | 0.832 | 0.667–1.457 | 0.316 | – | – | – |
| Gender | 1.321 | 0.893–1.884 | 0.419 | – | – | – |
| Tumor size | 1.447 | 0.932–2.213 | 0.155 | – | – | – |
| Anatomic location | 0.933 | 0.563–1.832 | 0.137 | – | – | – |
| Response to chemotherapy | 1.537 | 0.732–2.213 | 0.166 | – | – | – |
| Clinical stage | 3.876 | 1.432–5.778 | 0.003 | 3.173 | 1.189–4.563 | 0.009 |
| Distant metastasis | 3.236 | 1.365–4.778 | 0.009 | 2.784 | 1.188–4.173 | 0.024 |
| miR-1285-3p expression | 3.484 | 1.578–6.163 | 0.005 | 3.013 | 1.327–5.114 | 0.008 |
3.2. MiR-1285-3p inhibits the proliferation and invasion of osteosarcoma cells
We next investigated the effects of the altered expression of miR-1285-3p on the cell viability, proliferation and invasion in MG63 and U2OS osteosarcoma cancer cells. Control mimics (NC mimics) and miR-1285-3p mimics were transfected into MG63 and U2OS cells, and the expression levels of miR-1285-3p in both miR-1285-3p mimics transfected MG63 and U2OS cells were dramatically increased compared with that of the control cells (both 0.01, Fig. 2A and B). MTT assay showed that cell proliferation rates were significantly reduced in miR-1285-3p mimics transfected the MG-63 cells and U2OS cells compared with the control group (both 0.01, Fig. 2C and D). Moreover, colony formation assay revealed that the cell colony ability was significantly decreased in MG-63 and U2OS cells transfected with miR-1285-3p mimics (both 0.01, Fig. 2E–G). In addition, cell invasion assay was performed to explore the effects of miR-1285-3p on the invasive ability of osteosarcoma cancer cells in vitro. According to the results, both MG-63 cells and U2OS cells transfected miR-1285-3p mimics exhibited significant declines in invasion capacities compared with cells in control group (both 0.01, Fig. 2H–I). Taken together, our data indicated that miR-1285-5p functioned as a tumor suppressor miRNA and contributed to the inhibition of proliferation and invasion of osteosarcoma cells.
Figure 2.
Ectopic expression of miR-1285-3p inhibited osteosarcoma cell proliferation and invasion. (A and B) Relative expression levels of miR-1285-3p in MG63 and U2OS cells. (C and D) The proliferation rates of MG63 and U2OS cells detected by MTT assay. (E-G) Representative images of the colony formation assays and statistical analysis of MG63 and U2OS cell colony number ( 3). (H) Representative images of transwell invasion assay in MG63 and U2OS cells with miR-1285-3p overexpression. (I) Statistical analysis of the invasion cell number. The values were means SEM. * 0.05, ** 0.01.
3.3. YAP1 is the direct downstream target gene of miR-1285-3p
To further investigate the underlying molecular mechanism of miR-1285-3p modulated growth and metastasis suppression in osteosarcoma, we applied bioinformatics tools “miRDB” (http://www.mirdb.org/) to discover the target gene of miR-1285-3p. The prediction analysis results indicated that YAP1 may be a potential target gene of miR-1285-5p (Fig. 3A). Therefore, the 3’UTR and mutant 3’UTR of YAP1 gene were cloned and inserted into a luciferase reporter vector separately, and the luciferase activity of the reporter plasmid containing wild-type YAP1 3-UTR was significantly suppressed while there were no obvious inhibition effects on that of the mutant YAP1 3-UTR in both MG63 and U2OS cells (Fig. 3B and C). Furthermore, overexpression of miR-1285-5p though transfecting miR-1285-5p mimics reduced the mRNA levels of YAP1 in MG-63 and U2OS cells by qRT-PCR assay (both 0.01, Fig. 3D). Western blot assay also revealed that the protein levels of YAP1 in MG-63 and U2OS cells transfected with miR-1285-5p mimics decreased significantly which accorded with the mRNA detection data (Fig. 3E). Besides, Pearson’s correlation analysis revealed that there was a negative correlation between YAP1 expression and miR-1285-3p expression in osteosarcoma tissue samples (Fig. 3F). Overall, these data demonstrated that miR-1285-3p directly targeted YAP1.
Figure 3.

miR-1285-3p directly targeted YAP1. (A) miR-1285-3p binding site in YAP1 3’-UTR predicted by bioinformatics tool “miRBD”. (B and C) Dual-luciferase reporter assay showed that miR-1285-3p reduced luciferase activity of MG63 and U2OS cells transfected with YAP1 3UTR-WT plasmids. (D and E) qRT-PCR and western blot assays were performed to detect the effects of miR-1285-3p on YAP1 mRNA and protein expression. (F) Pearson’s correlation analysis of the relationship between miR-1285-3p and YAP1 expression ( 120). The values were means SEM. * 0.05, ** 0.01.
3.4. Reintroduction of YAP1 reverses the effects of miR-1285-3p in osteosarcoma cells
To further confirm that the tumor suppressive effects of miR-1285-3p was mediated through directly targeting YAP1 in osteosarcoma cells, the YAP1 overexpression plasmids were employed to transfect the MG63 and U2OS cells. According to our results, the decreased mRNA levels of YAP1 by miR-1285-3p targeting were significantly rescued via the transfection of YAP1 overexpression plasmids in both MG63 and U2OS cells (Fig. 4A). Moreover, MTT assay showed that reintroduction of YAP1 dramatically reversed the inhibitory effects of the miR-1285-3p mimics on the proliferation of MG63 and U2OS osteosarcoma cells (Fig. 4B and C). Additionally, the ectopic expression of miR-1285-3p mimics resulted in a marked decrease in cell colony formation capability while enforcing YAP1 expression significantly rescued cell colony formation capability of MG63 and U2OS cells (Fig. 4D and E). Besides, transwell assays revealed that YAP1 overexpression also abrogated miR-1285-3p mediated suppression of MG63 and U2OS cells invasion (Fig. 4F and G). In summary, the data suggested that the growth and invasion suppressive effects of miR-1285-3p were chiefly via inhibition of YAP1.
Figure 4.
Overexpression of YAP1 abrogated the tumor suppressive roles of miR-1285-3p. (A) Relative mRNA expression levels of YAP1 in both MG63 and U2OS cells in different groups. (B and C) MTT assays showed the proliferation rates of MG63 and U2OS cells transfected with NC mimics, miR-1285-3p or co-transfected with miR-1285-3p and YAP1 overexpression plasmids. (D and E) Representative images of the colony formation assays and statistical analysis of MG63 and U2OS cell colony number in different groups. (F and G) Representative images of the transwell invasion assays and statistical analysis of MG63 and U2OS cell invasion number in different groups. The values were means SEM. * 0.05, ** 0.01.
4. Discussion
Osteosarcoma is the most common human primary malignant bone tumor and it has become one of the most promising fields to investigate molecular mechanisms contributing to osteosarcoma development [11]. In recent years, there is accumulating evidence confirming that miRNAs play essential roles in carcinogenesis and miRNAs as well as their targets genes have been proved to represent potential novel therapeutic biomarkers for osteosarcoma [12, 13, 14]. In the present study, miR-1285-3p was found to inhibit the proliferation and invasion of osteosarcoma cells in vitro via direct targeting YAP1.
Previous study had showed that miR-1285-3p could directly repress the expression of JUN oncogene in hepatocellular carcinoma (HCC) which suggested a potential tumor suppressor role of miR-1285-3p acted [15]. Besides, reports had revealed that miR-1285 was significantly down-regulated in plasma of stage I lung squamous cell carcinoma (LSCC) patients and the plasma levels of miR-1285 could serve as LSCC early detection markers [16]. However, the role of miR-1285-3p in osteosarcoma has not been explored. In accordance with the above reported researches, our data in this study also demonstrated that miR-1285-3p was down-regulated in osteosarcoma and the reduction of miR-1285-3p expression predicted a poor overall survival of osteosarcoma patients which suggested a therapeutic and diagnostic potential of miR-1285-3p in osteosarcoma.
MiRNAs function as negative regulators of gene expression at the post transcriptional level by banding to the 3’UTR of the target mRNA which lead to mRNA degradation or suppression of translation [17, 18]. Therefore, identification of the miRNAs targets is pivotal for understanding their roles in tumorigenesis [19, 20]. For example, miRNA-152 attenuated tumor cells growth and induced cancer cells apoptosis though the transcriptional repression of cathepsin L (CTSL) in gastrointestinal stromal tumor and miR-29a suppressed the proliferation of hepatocellular carcinoma cells by directly specifically targeted the 3’UTR of SIRT1 mRNA [21, 22]. In this study, we also confirmed that YAP1 was the direct target gene of miR-1285-3p though performing gain and loss of functions study.
YAP1, acting as one of the most important downstream mediators of Hippo signaling pathway, is known to be involved in cancer cells proliferation and invasion [23, 24]. In the previous study, YAP1 was found overexpressed which was associated with poor prognosis in several cancer types such as gastric cancer (GC), colorectal cancer (CRC), hepatocellular carcinoma (HCC) and non-small cell lung cancer (NSCLC) and inhibition of YAP1 reduced cancer cell proliferation, colony formation and invasiveness [25, 26]. Besides, YAP1 was also discovered in several studies to promote cell proliferation and invasion in osteosarcoma [27, 28, 29]. In our results, YAP1 was demonstrated as the direct target of miR-1285-3p and the Pearson’s correlation analysis suggested that a negative correlation exhibited between the expression of YAP1 and miR-1285-3p in osteosarcoma tissue samples. Furthermore, the inhibitory effects of the miR-1285-3p mimics on the proliferation and invasion of MG63 and U2OS osteosarcoma cells were dramatically reversed by YAP1.
In summary, we certified that the expression of miR-1285-3p was down-regulated in osteosarcoma tissue samples and patients with the reduction of miR-1285-3p expression exhibited shorter overall survival. We further provided evidence that ectopic expression of miR-1285-3p inhibited osteosarcoma growth and metastasis through directly interacting with YAP1. Thus, our data indicated that miR-1285-3p served as a suppressor role in osteosarcoma tumorigenesis as well as metastasis and might be a promising therapeutic targets and biomarker in osteosarcoma.
Acknowledgments
The authors thank all the donors whose names we not included in the author list, but who participated in this program.
Footnotes
Add detail.
Conflict of interest
The authors declare that there are no conflicts of interest.
References
- [1]. Isakoff M.S., Bielack S.S., Meltzer P. and Gorlick R., Osteosarcoma: Current Treatment and a Collaborative Pathway to Success, J Clin Oncol 33 (2015), 3029–3035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [2]. Luetke A., Meyers P.A., Lewis I. and Juergens H., Osteosarcoma treatment – Where do we stand? A state of the art review, Cancer Treatment Reviews 40 (2014), 523–532. [DOI] [PubMed] [Google Scholar]
- [3]. Yang J.L. and Zhang W., New molecular insights into osteosarcoma targeted therapy, Current Opinion in Oncology 25 (2013), 398–406. [DOI] [PubMed] [Google Scholar]
- [4]. Liang W.Q., Gao B., Fu P., Xu S.G., Qian Y. and Fu Q.G., The miRNAs in the pathgenesis of osteosarcoma, Frontiers in Bioscience-Landmark 18 (2013), 788–794. [DOI] [PubMed] [Google Scholar]
- [5]. Rupaimoole R. and Slack F.J., MicroRNA therapeutics: towards a new era for the management of cancer and other diseases, Nature Reviews Drug Discovery 16 (2017), 203–221. [DOI] [PubMed] [Google Scholar]
- [6]. Lin S.B. and Gregory R.I., MicroRNA biogenesis pathways in cancer, Nature Reviews Cancer 15 (2015), 321–333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7]. Frixa T., Donzelli S. and Blandino G., Oncogenic MicroRNAs: Key Players in Malignant Transformation, Cancers 7 (2015), 2466–2485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8]. Svoronos A.A., Engelman D.M. and Slack F.J., OncomiR or Tumor Suppressor? The Duplicity of MicroRNAs in Cancer, Cancer Research 76 (2016), 3666–3670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9]. Voorhoeve P.M., le Sage C., Schrier M., Gillis A.J.M., Stoop H., Nagel R., Liu Y.P., van Duijse J., Drost J., Griekspoor A., Zlotorynski E., Yabuta N., De Vita G., Nojima H., Looijenga L.H.J. and Agami R., A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors, Cell 124 (2006), 1169–1181. [DOI] [PubMed] [Google Scholar]
- [10]. Lee Y.S. and Dutta A., The tumor suppressor microRNA let-7 represses the HMGA2 oncogene, Genes & Development 21 (2007), 1025–1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11]. Durfee R.A., Mohammed M. and Luu H.H., Review of Osteosarcoma and Current Management, Rheumatology and Therapy 3 (2016), 221–243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12]. Yao Z.S., Li C., Liang D., Jiang X.B., Tang J.J., Ye L.Q., Yuan K., Ren H., Yang Z.D., Jin D.X., Zhang S.C., Ding J.Y., Tang Y.C., Xu J.X., Chen K., Xie W.X., Guo D.Q. and Cui J.C., Diagnostic and prognostic implications of serum miR-101 in osteosarcoma, Cancer Biomarkers 22 (2018), 127–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13]. Cong C.L., Wang W.B., Tian J., Gao T.Q., Zheng W.Z. and Zhou C.L., Identification of serum miR-124 as a biomarker for diagnosis and prognosis in osteosarcoma, Cancer Biomarkers 21 (2018), 449–454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14]. Li Q.C., Song S.R., Ni G.Z., Li Y. and Wang X.H., Serum miR-542–3p as a prognostic biomarker in osteosarcoma, Cancer Biomarkers 21 (2018), 521–526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15]. Liu J.B., Yan J.C., Zhou C.C., Ma Q.H., Jin Q.Y. and Yang Z.B., miR-1285–3p acts as a potential tumor suppressor miRNA via downregulating JUN expression in hepatocellular carcinoma, Tumor Biology 36 (2015), 219–225. [DOI] [PubMed] [Google Scholar]
- [16]. Gao X.J., Wang Y., Zhao H., Wei F., Zhang X.W., Su Y.J., Wang C.L., Li H. and Ren X.B., Plasma miR-324–3p and miR-1285 as diagnostic and prognostic biomarkers for early stage lung squamous cell carcinoma, Oncotarget 7 (2016), 59664–59675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [17]. Jonas S. and Izaurralde E., NON-CODING RNA Towards a molecular understanding of microRNA-mediated gene silencing, Nature Reviews Genetics 16 (2015), 421–433. [DOI] [PubMed] [Google Scholar]
- [18]. Ha M. and Kim V.N., Regulation of microRNA biogenesis, Nature Reviews Molecular Cell Biology 15 (2014), 509–524. [DOI] [PubMed] [Google Scholar]
- [19]. Jiang C., Chen X., Alattar M., Wei J. and Liu H., MicroRNAs in tumorigenesis, metastasis, diagnosis and prognosis of gastric cancer, Cancer Gene Therapy 22 (2015), 291–301. [DOI] [PubMed] [Google Scholar]
- [20]. Melo S.A., Sugimoto H., O’Connell J.T., Kato N., Villanueva A., Vidal A., Qiu L., Vitkin E., Perelman L.T., Melo C.A., Lucci A., Ivan C., Calin G.A. and Kalluri R., Cancer Exosomes Perform Cell-Independent MicroRNA Biogenesis and Promote Tumorigenesis, Cancer Cell 26 (2014), 707–721. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21]. Lu H.J., Yan J., Jin P.Y., Zheng G.H., Qin S.M., Wu D.M., Lu J. and Zheng Y.L., MicroRNA-152 inhibits tumor cell growth while inducing apoptosis via the transcriptional repression of cathepsin L in gastrointestinal stromal tumor, Cancer Biomarkers 21 (2018), 711–722. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- [22]. Zhang Y.Y., Yang L.W., Wang S.J., Liu Z.M. and Xiu M., MiR-29a suppresses cell proliferation by targeting SIRT1 in hepatocellular carcinoma, Cancer Biomarkers 22 (2018), 151–159. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- [23]. Zhou D.W., Conrad C., Xia F., Park J.S., Payer B., Yin Y., Lauwers G.Y., Thasler W., Lee J.T., Avruch J. and Bardeesy N., Mst1 and Mst2 Maintain Hepatocyte Quiescence and Suppress Hepatocellular Carcinoma Development through Inactivation of the Yap1 Oncogene, Cancer Cell 16 (2009), 425–438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24]. Shao D.D., Xue W., Krall E.B., Bhutkar A., Piccioni F., Wang X.X., Schinzel A.C., Sood S., Rosenbluh J., Kim J.W., Zwang Y., Roberts T.M., Root D.E., Jacks T. and Hahn W.C., KRAS and YAP1 Converge to Regulate EMT and Tumor Survival, Cell 158 (2014), 171–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [25]. Lee K.W., Lee S.S., Kim S.B., Sohn B.H., Lee H.S., Jang H.J., Park Y.Y., Kopetz S., Kim S.S., Oh S.C. and Lee J.S., Significant Association of Oncogene YAP1 with Poor Prognosis and Cetuximab Resistance in Colorectal Cancer Patients, Clinical Cancer Research 21 (2015), 357–364. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [26]. Shibata M., Ham K. and Hoque M.O., A time for YAP1: Tumorigenesis, immunosuppression and targeted therapy, Int J Cancer (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27]. Luo Z., Wu G., Zhang D., Liu J. and Ran R., microRNA625 targets Yesassociated protein 1 to suppress cell proliferation and invasion of osteosarcoma, Mol Med Rep 17 (2018), 2005–2011. [DOI] [PubMed] [Google Scholar]
- [28]. Yang Z., Zhang M., Xu K., Liu L., Hou W.K., Cai Y.Z., Xu P. and Yao J.F., Knockdown of YAP1 inhibits the proliferation of osteosarcoma cells in vitro and in vivo, Oncol Rep 32 (2014), 1265–1272. [DOI] [PubMed] [Google Scholar]
- [29]. Chan L.H., Wang W., Yeung W., Deng Y., Yuan P. and Mak K.K., Hedgehog signaling induces osteosarcoma development through Yap1 and H19 overexpression, Oncogene 33 (2014), 4857–4866. [DOI] [PubMed] [Google Scholar]


