Skip to main content
Bioscience of Microbiota, Food and Health logoLink to Bioscience of Microbiota, Food and Health
. 2026 Jan 14;45(2):149–157. doi: 10.12938/bmfh.2025-055

Source-dependent antimicrobial activity of plant-derived lactic acid bacteria against periodontal pathogens

Yuji TSUJIKAWA 1,*, Junya YAMAMOTO 1, Mami NAITO 1, Iwao SAKANE 1
PMCID: PMC13083155  PMID: 42006126

Abstract

Periodontal disease is a prevalent inflammatory condition linked to tooth loss and systemic disorders. Plant-derived lactic acid bacteria (LAB) have emerged as promising probiotics for oral health. In this study, 80 LAB strains were isolated from tea leaves, young barley leaves, carrots, and fermented vegetables, and their antimicrobial effects against key periodontal pathogens were evaluated. Various assays, including biofilm inhibition, growth inhibition, disk diffusion, and RT-qPCR, were employed to assess activity. LAB strains from tea leaves and young barley leaves exhibited significantly stronger anti-biofilm activity and growth inhibition against Porphyromonas gingivalis than those from carrots and fermented vegetables. These strains also demonstrated notable antimicrobial activity against P. gingivalis and Fusobacterium nucleatum and significantly downregulated key virulence-related genes, including fimA, kgp, and rgpA in P. gingivalis. The results suggest that the antimicrobial efficacy of LAB is dependent on their plant source. Tea and barley-derived LAB strains may serve as potent candidates for probiotic development aimed at preventing periodontal disease. Further investigation is warranted.

Keywords: probiotics, lactic acid bacteria, periodontal pathogens, Porphyromonas gingivalis, antimicrobial activity

INTRODUCTION

Periodontal disease is a leading cause of tooth loss in adults and has a high global prevalence [1, 2]. It is also associated with systemic diseases, such as diabetes and cardiovascular disease, preterm birth, and pneumonia, highlighting the importance of its prevention and treatment in public health [3]. The primary causative bacteria include Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola (collectively referred to as the red complex), Aggregatibacter actinomycetemcomitans, and Prevotella intermedia [4]. These bacteria inhabit biofilms within periodontal pockets and contribute to the destruction of periodontal tissues by activating host immune responses [5]. Socransky et al. [4] classified five major bacterial complexes (red, orange, green, yellow, and purple) present in the subgingival niche. A. actinomycetemcomitans is a key pathogen in progressive periodontitis [6, 7], while red complex bacteria such as P. gingivalis, T. forsythia, and T. denticola are strongly associated with the severity of chronic periodontitis [8, 9]. Fusobacterium nucleatum, a member of the orange complex [4], interacts with numerous oral bacteria and significantly increases tissue damage during active periodontal disease [10].

In recent years, probiotic approaches involving lactic acid bacteria (LAB) and bifidobacteria have gained increasing attention [11, 12]. These microorganisms may suppress periodontal pathogens by competing for nutrients and adhesion sites, producing antimicrobial substances, and regulating immune responses [13]. Some LAB strains exhibit antimicrobial activity against periodontal pathogens through the production of organic acids, primarily lactic acid, hydrogen peroxide, and bacteriocins [14,15,16,17,18].

Traditionally, LAB were isolated from dairy products; however, diverse strains have also been identified in plant-based foods such as vegetables, fruits, grains, and fermented products. These plant-derived LAB may possess distinct metabolic traits due to their adaptation to ecological niches different from those of dairy-derived strains [19, 20]. Fermented foods such as pickles, kimchi, and miso are rich in acid- and salt-tolerant LAB that exhibit unique metabolic profiles [21, 22]. However, studies that systematically compare the antimicrobial properties of plant-derived LAB from different food sources remain limited [23].

In this study, we aimed to compare the antimicrobial activity of LAB strains isolated from various plant-based foods against periodontal pathogens, with a focus on P. gingivalis, A. actinomycetemcomitans, and P. intermedia. Additionally, we sought to elucidate differences in the strength and mechanisms of action of these strains. By clarifying the relationship between food sources and antimicrobial efficacy, this research may support the development of effective oral probiotics and promote dietary strategies for maintaining oral health. Furthermore, elucidating the antimicrobial mechanisms of selected LAB strains could contribute to new approaches for managing oral infections.

MATERIALS AND METHODS

Isolation of LAB strains

Novel LAB strains were isolated from fresh tea leaves, carrots, young barley leaves, and fermented vegetables (including daikon kimchi, celery, and melon). One gram of each sample was added to 10 mL of phosphate-buffered saline (PBS) and ground using a mortar and pestle at 22–25°C. A volume of 50 µL of the solution was spread on De Man, Rogosa, and Sharpe (MRS) agar (Oxoid, Basingstoke, UK) supplemented with 1% sodium carbonate (Wako Pure Chemical Corporation, Osaka, Japan) and incubated at 37°C for 48 hr under anaerobic conditions (85% N2, 10% H2, and 5% CO2) using an AnaeroPack-Anaero system (Mitsubishi Gas Chemical Co., Inc., Tokyo, Japan). After incubation, individual colonies were subcultured onto fresh MRS agar. All colonies were selected irrespective of their shape and size. The bacterial strains were preserved long-term by freezing at −80°C in MRS broth containing 30% glycerol until further use in the experiments.

DNA extraction and identification of LAB strains

Genomic DNA was extracted using a previously reported method [24]. First, 300 mg of glass beads (diameter 0.1 mm) were added to a self-standing screw-cap microtube, followed by 200 µL of culture medium. Subsequently, 250 µL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), 500 µL of TE-saturated phenol, and 50 µL of 10% sodium dodecyl sulfate were added and mixed thoroughly. The mixture was vortexed for 30 sec using a FastPrep-24 homogenizer (MP Biomedicals SARL, Illkirch, France), followed by centrifugation at 17,120 × g for 5 min. The resulting supernatant was extracted with 400 µL of a phenol/chloroform/isoamyl alcohol (25:24:1) mixture and centrifuged again at 17,120 × g for 5 min. Subsequently, 250 µL of the supernatant was transferred to a new microtube, followed by the addition of 275 µL of isopropanol and 25 µL of 3 mol/L sodium acetate. The mixture was incubated at −20°C for 10–15 min. DNA precipitates were collected by centrifugation at 17,120 × g for 5 min, washed with 70% ethanol, and air-dried for 10–30 min. The purified DNA was dissolved in TE buffer and stored at −20°C until use.

For strain identification, the complete 16S rRNA gene sequence was amplified using universal primers 27F (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1492R (5′-TACGGYTACCTTGTTACGACTT-3′). The amplified genes were sequenced and compared with reference sequences in the EzBioCloud and GenBank/EMBL/DDBJ (http://www.ncbi.nlm.nih.gov/blast) databases.

Bacterial strains and growth conditions

Newly isolated LAB strains were grown on MRS agar plates. P. gingivalis JCM 12257T, F. nucleatum JCM 6328T, and A. actinomycetemcomitans JCM 8579 were cultured on brain heart infusion blood agar supplemented with hemin (10 µg/mL; Sigma, St. Louis, MO, USA) and menadione (5 µg/mL; Sigma), referred to as BHI-HM. All strains were cultured under anaerobic conditions (85% N2, 10% H2, and 5% CO2) at 37°C. Bacterial cultures in the logarithmic growth phase were used for all experiments.

Test sample preparation

Newly isolated LAB strains were cultured in MRS broth for 48 hr at 37°C under anaerobic conditions. Cell-free culture supernatants were collected by centrifugation at 4°C for 30 min at 1,500 × g. The supernatants were diluted 10-fold with sterile water, neutralized to pH 7.0 using 1 M NaOH to eliminate the effects of acidity, and finally filtered through 0.22 µm pore-size membranes (Millipore) to remove residual bacteria and debris. The filtered supernatants were used in the subsequent assays.

Biofilm formation assay

The inhibitory effect of LAB-derived cell-free culture supernatants on P. gingivalis biofilm formation was evaluated using crystal violet staining. A total of 180 µL of BHI-HM medium was added to each well of a 96-well plate (Costar, Corning, Glendale, AZ, USA), followed by the addition of 10 µL of P. gingivalis culture and 10 µL of the test sample. The plates were incubated under anaerobic conditions at 37°C for 48 hr. Following incubation, the liquid in each well was carefully removed by pipetting, leaving a layer of P. gingivalis biofilm attached to the well bottom. Each well was washed with PBS (pH of 7.4, Boster Biological Technology Ltd., Wuhan, P. R. China) and gently air-dried for 20 min. After fixation with 3.7% paraformaldehyde for 15 min, crystal violet solution was added to each well for 20 min. Subsequently, the biofilms were washed with PBS and then decolorized using 95% (v/v) ethanol. Finally, the ethanol from each well was transferred to a sterile 96-well plate, and the biofilm biomass was quantified using a microplate reader (Molecular Devices, San Jose, CA, USA) at OD600 nm.

Growth inhibition assay

The inhibitory effect of LAB-derived cell-free culture supernatants on P. gingivalis growth was evaluated through a growth inhibition assay. A total of 50 µL of P. gingivalis culture grown in BHI-HM medium was mixed with 50 µL of the test sample and inoculated into 10 mL of fresh BHI-HM medium. The mixture was then incubated under anaerobic conditions at 37°C for 72 hr. Microbial growth was measured at OD660 after 72 hr using a microplate reader.

Disk diffusion assay

The antimicrobial activity of LAB-derived cell-free culture supernatants against three periodontal pathogens was evaluated using the disk diffusion method. After uniformly inoculating P. gingivalis JCM 12257T, F. nucleatum JCM 6328T, and A. actinomycetemcomitans JCM 8579 onto the surface of MRS agar (1.5% agar concentration), the disk diffusion assay was performed using MRS agar, despite the suitability of the target pathogens for BHI-HM agar. This choice was made because BHI-HM agar was found to be excessively soft in preliminary tests, leading to unstable diffusion of inhibitory substances and unreliable measurement of inhibition zones. MRS agar provided a stable matrix, allowing for consistent and reproducible evaluation of LAB-derived antimicrobial compounds. Sterilized filter paper disks (approximately 6 mm in diameter, As One, Osaka, Japan) were impregnated with 50 µL of test sample and placed on the inoculated agar plates. Following incubation at 37°C for 48 hr under anaerobic conditions, antimicrobial activity was assessed by observing the presence or absence of inhibition zones around the disks.

Real-time quantitative polymerase chain reaction (RT-qPCR) analysis

The inhibitory effect of LAB-derived cell-free culture supernatants on P. gingivalis biofilm formation was investigated through gene expression analysis. For this, 1 mL of P. gingivalis culture in the logarithmic growth phase was dispensed into polystyrene-coated 12-well plates (Corning, NY, USA), followed by the addition of 50 µL of either MRS medium (control) or the test sample. The plates were incubated under anaerobic conditions at 37°C for 24 hr. Following incubation, total RNA was extracted using TRIzol reagent, and complementary DNA (cDNA) was synthesized with the PrimeScript RT reagent kit (TaKaRa Bio, Shiga, Japan). mRNA expression levels of genes associated with biofilm formation were quantified through RT-qPCR. The primer sequences used are listed in Table 1 [25, 26]. PCR amplification was performed under the following cycling conditions: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 10 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec. Gene expression levels were normalized to 16S rRNA, which served as the internal control.

Table 1. Primers used in this study for gene expression analysis.

Target gene Primer direction Primer sequence (5′-3′) Reference
16S rRNA Forward TGTAGATGACTGATGGTGAAA [25]
Reverse ACTGTTAGCAACTACCGATGT
fimA Forward TTGTTGGGACTTGCTGCTCTTG [26]
Reverse TTCGGCTGATTTGATGGCTTCC
mfa1 Forward ATCTTCAGCACTCTCCACAAG [26]
Reverse TTGTTGGGACTTGCTGCTCTTG
hagA Forward ACAGCATCAGCCGATATTCC [25]
Reverse CGAATTCATTGCCACCTTCT
hagB Forward TGTCGCACGGCAAATATCGCTAAAC [25]
Reverse CTGGCTGTCCTCGTCGAAAGCATAC
kgp Forward AGCTGACAAAGGTGGAGACCAAAGG [25]
Reverse TGTGGCATG AGTTTTTCGGAACCGT
rgpA Forward GCCGAGATTGTT CTTGAAGC [25]
Reverse AGGAGCAGCAATTGCAAAG
rgpB Forward CGCTGATGAAACGAACTTGA [25]
Reverse CTTCGAATACCATGCGGT
ftsH Forward CGTCGCAGCATCGCCATCC [26]
Reverse CAGAGCCTCCGTTGTCGTGATC
luxS Forward GAGAGGTGGTTACGACTTTC [26]
Reverse GTAATCGCCTCGCATCAG

Statistical analyses

All experiments were performed at least three times, with three replicates per trial. In the biofilm inhibition assay, growth inhibition assay, and RT-qPCR analysis of virulence gene expression, one-way ANOVA followed by Dunnett’s test was conducted using the control group as a reference. Results were considered statistically significant at p<0.05.

RESULTS

Isolation and identification of LAB

In this study, 80 LAB strains were successfully isolated from four distinct sources (Table 2). Of them, 26 strains were isolated from tea leaves and identified as four distinct species: Lactiplantibacillus plantarum, Streptococcus salivarius, Lactococcus lactis, and Enterococcus faecalis. Carrot samples yielded 11 strains, all of which were identified as E. faecalis. From young barley leaves, 20 strains were isolated, all of which were classified as L. lactis. Additionally, 23 strains were isolated from fermented vegetables and taxonomically classified as either Lacticaseibacillus paracasei or L. plantarum.

Table 2. List of lactic acid bacteria (LAB) strains used in this study and their isolation sources.

Strain ID Isolation source Species
LOC1 Tea leaves Lactiplantibacillus plantarum
LOC2 Tea leaves Streptococcus salivarius
LOC3 Tea leaves Lactococcus lactis
LOC4 Tea leaves Streptococcus salivarius
LOC5 Tea leaves Lactococcus lactis
LOC6 Tea leaves Streptococcus salivarius
LOC7 Tea leaves Enterococcus faecalis
LOC8 Tea leaves Lactococcus lactis
LOC9 Tea leaves Lactococcus lactis
LOC10 Tea leaves Lactococcus lactis
LOC11 Tea leaves Streptococcus salivarius
LOC12 Tea leaves Streptococcus salivarius
LOC13 Tea leaves Lactococcus lactis
LOC14 Tea leaves Lactococcus lactis
LOC15 Tea leaves Streptococcus salivarius
LOC16 Tea leaves Streptococcus salivarius
LOC17 Tea leaves Lactococcus lactis
LOC18 Tea leaves Lactococcus lactis
LOC19 Tea leaves Lactococcus lactis
LOC20 Tea leaves Enterococcus faecalis
LOC23 Tea leaves Lactiplantibacillus plantarum
LOC24 Tea leaves Lactiplantibacillus plantarum
LOC25 Tea leaves Lactiplantibacillus plantarum
LOC26 Tea leaves Lactiplantibacillus plantarum
LOC27 Tea leaves Lactiplantibacillus plantarum
LOC28 Tea leaves Lactiplantibacillus plantarum
T1 Carrots Enterococcus faecalis
T2 Carrots Enterococcus faecalis
T3 Carrots Enterococcus faecalis
T4 Carrots Enterococcus faecalis
T5 Carrots Enterococcus faecalis
T6 Carrots Enterococcus faecalis
M2 Carrots Enterococcus faecalis
M3 Carrots Enterococcus faecalis
M4 Carrots Enterococcus faecalis
M5 Carrots Enterococcus faecalis
M6 Carrots Enterococcus faecalis
OA Young barley leaves Lactococcus lactis
OC Young barley leaves Lactococcus lactis
OD Young barley leaves Lactococcus lactis
OF Young barley leaves Lactococcus lactis
OG Young barley leaves Lactococcus lactis
OH Young barley leaves Lactococcus lactis
OI Young barley leaves Lactococcus lactis
OJ Young barley leaves Lactococcus lactis
OW1 Young barley leaves Lactococcus lactis
OW2 Young barley leaves Lactococcus lactis
OW3 Young barley leaves Lactococcus lactis
OW4 Young barley leaves Lactococcus lactis
OW5 Young barley leaves Lactococcus lactis
OW6 Young barley leaves Lactococcus lactis
OW7 Young barley leaves Lactococcus lactis
OW8 Young barley leaves Lactococcus lactis
OW9 Young barley leaves Lactococcus lactis
OW10 Young barley leaves Lactococcus lactis
OW11 Young barley leaves Lactococcus lactis
OW12 Young barley leaves Lactococcus lactis
RO2 Fermented vegetables (daikon kimchi) Lacticaseibacillus paracasei
RO3 Fermented vegetables (daikon kimchi) Lacticaseibacillus paracasei
RO4 Fermented vegetables (daikon kimchi) Lacticaseibacillus paracasei
RO5 Fermented vegetables (daikon kimchi) Lacticaseibacillus plantarum
RO6 Fermented vegetables (daikon kimchi) Lacticaseibacillus plantarum
RO7 Fermented vegetables (daikon kimchi) Lacticaseibacillus plantarum
RO8 Fermented vegetables (daikon kimchi) Lacticaseibacillus plantarum
RO9 Fermented vegetables (daikon kimchi) Lacticaseibacillus paracasei
RO10 Fermented vegetables (celery) Lacticaseibacillus paracasei
RO11 Fermented vegetables (celery) Lacticaseibacillus paracasei
RO12 Fermented vegetables (celery) Lacticaseibacillus paracasei
RO13 Fermented vegetables (celery) Lacticaseibacillus plantarum
RO14 Fermented vegetables (celery) Lacticaseibacillus plantarum
RO15 Fermented vegetables (celery) Lacticaseibacillus plantarum
RO16 Fermented vegetables (celery) Lacticaseibacillus plantarum
RO17 Fermented vegetables (melon) Lacticaseibacillus paracasei
RO18 Fermented vegetables (melon) Lacticaseibacillus paracasei
RO19 Fermented vegetables (melon) Lacticaseibacillus paracasei
RO20 Fermented vegetables (melon) Lacticaseibacillus plantarum
RO21 Fermented vegetables (melon) Lacticaseibacillus plantarum
RO22 Fermented vegetables (melon) Lacticaseibacillus plantarum
RO23 Fermented vegetables (melon) Lacticaseibacillus plantarum
RO24 Fermented vegetables (melon) Lacticaseibacillus plantarum

Source-dependent effects on the inhibition of biofilm formation by P. gingivalis

The inhibitory effects of LAB-derived cell-free culture supernatants on the initial adhesion phase of P. gingivalis biofilm formation were evaluated (Fig. 1). Following treatment of P. gingivalis with LAB-derived cell-free culture supernatants and subsequent 48 hr incubation, significant source-dependent variations in inhibitory efficacy were observed. Among tea leaf-derived isolates, 25 of 26 strains (96.2%) demonstrated significant inhibitory activity. Similarly, all 20 strains (100%) from young barley leaves exhibited significant inhibitory effects. In contrast, only 5 of 11 strains (45.5%) from carrots and 16 of 23 strains (69.6%) from fermented vegetables displayed significant inhibitory activity. Statistical analysis confirmed that LAB strains from tea leaves and young barley leaves exhibited significantly greater inhibitory activity than those from carrots and fermented vegetables (p<0.05). Furthermore, quantitative assessment of biofilm inhibition revealed that strains from tea and young barley leaves exhibited greater inhibitory potency than those from carrots and fermented vegetables. Based on these findings, representative LAB strains from each source were selected for further analysis of their antimicrobial properties against periodontal pathogens.

Fig. 1.

Fig. 1.

Inhibitory effect of lactic acid bacteria (LAB)-derived cell-free culture supernatants on P. gingivalis biofilm formation, evaluated using crystal violet staining. Biofilm biomass was quantified by absorbance measurement at OD600. Asterisks indicate statistical significance: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Source-dependent effects on growth inhibition of P. gingivalis

The inhibitory effects of LAB-derived cell-free culture supernatants on P. gingivalis growth were evaluated using a growth inhibition assay (Fig. 2). Representative LAB strains were selected from each source for testing: for tea leaves and young barley leaves, strains showing significant inhibitory activity were chosen, whereas for carrots and fermented vegetables, strains without significant inhibitory activity were selected. The results revealed distinct efficacy patterns based on the LAB isolation source. Cell-free culture supernatants from all the tested LAB strains isolated from tea leaves and young barley leaves significantly inhibited the growth of P. gingivalis (p<0.01). In contrast, none of the LAB-derived supernatants from the tested strains isolated from carrots and fermented vegetables exhibited significant growth-inhibitory effects against P. gingivalis.

Fig. 2.

Fig. 2.

Inhibitory effect of lactic acid bacteria (LAB)-derived cell-free culture supernatants on P. gingivalis growth, evaluated through a growth inhibition assay. Asterisks indicate statistical significance: ***p<0.001 and ****p<0.0001.

Source-dependent effects on antimicrobial activity against periodontal pathogens

The antimicrobial activities of LAB-derived cell-free culture supernatants against three major periodontal pathogens (P. gingivalis, F. nucleatum, and A. actinomycetemcomitans) were investigated using the disk diffusion method (Fig. 3). Against P. gingivalis, pronounced antimicrobial activity was observed following treatment with strain LOC28 (isolated from tea leaves) and strains OA, OC, and OW1 (isolated from young barley leaves) as evidenced by measurable inhibition zones. However, strain LOC1 (tea leaves) and strain OW2 (young barley leaves) exhibited no detectable antimicrobial activity despite originating from sources associated with high inhibitory potential. Additionally, none of the cell-free culture supernatants from LAB strains isolated from carrots or fermented vegetables demonstrated antimicrobial effects against P. gingivalis.

Fig. 3.

Fig. 3.

Antimicrobial activity of lactic acid bacteria (LAB)-derived cell-free culture supernatants against P. gingivalis, F. nucleatum, and A. actinomycetemcomitans, evaluated using disk diffusion assays.

A similar pattern was observed for F. nucleatum, with all LAB strains from tea leaves and strains OA, OC, and OW1 from young barley leaves exhibiting antimicrobial activity. Strain OW2 (young barley leaves) showed no inhibitory activity. Similarly, LAB-derived cell-free culture supernatants from carrots and fermented vegetables exhibited no antimicrobial effects. Notably, none of the tested LAB strains, regardless of their source, exhibited antimicrobial activity against A. actinomycetemcomitans.

Source-dependent effects on the expression of virulence genes in P. gingivalis

The modulatory effects of LAB-derived supernatants on the expression of key virulence genes in P. gingivalis were evaluated through RT-qPCR, with the results visualized in a heatmap (Fig. 4). The heatmap illustrates the expression patterns of multiple virulence-associated genes, including adhesion factors (mfa1, fimA, hagA, hagB), proteolytic enzymes (fsH, kgp, rgpA, rgpB), and the quorum-sensing gene (luxS), in response to treatment with LAB-derived supernatants. Notably, supernatants from LAB strains isolated from tea leaves and young barley leaves markedly downregulated the expression of genes encoding adhesion factors and proteolytic enzymes, as indicated by reduced signal intensity in the heatmap. In contrast, LAB strains from carrots and fermented vegetables exhibited only minor or inconsistent modulatory effects. For luxS, the heatmap showed no consistent pattern based on strain origin, indicating variable responses among different LAB isolates.

Fig. 4.

Fig. 4.

Heatmap showing expression of virulence-related genes in P. gingivalis treated with lactic acid bacteria (LAB)-derived cell-free culture supernatants. Gene expression levels are shown as fold changes relative to 16S rRNA expression. Asterisks indicate statistical significance: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

DISCUSSION

Recent studies suggest that plant-derived LAB exhibit antimicrobial activity against oral periodontal pathogens. For example, soy milk fermented with L. plantarum TWK10 demonstrated antimicrobial and anti-biofilm effects against P. gingivalis and A. actinomycetemcomitans [27]. Medicinal plants fermented with L. plantarum MSC-C2 and Pediococcus pentosaceus K40 produced 3-phenyllactic acid (PLA), which suppressed biofilm formation and virulence in A. actinomycetemcomitans [28]. Postbiotics from L. plantarum EIR/IF-1 inhibited the proliferation of Prevotella denticola, F. nucleatum, and Streptococcus sanguinis, as well as biofilm formation [29]. Metabolites from L. plantarum PD18 also exhibited antimicrobial effects against periodontal pathogens and virulence markers [30, 31]. Heat-treated L. plantarum CECT 9161 inhibited oral biofilm formation and modulated the oral microbiome [32]. Reviews have highlighted the antimicrobial potential of plant-derived probiotic bacteria and their fermentates [14, 33]. These findings indicate that plant-derived LAB exhibit diverse antimicrobial mechanisms; however, the influence of their isolation source remains unclear. In this study, we found that LAB strains from tea leaves and young barley leaves inhibited P. gingivalis biofilm formation and growth more effectively than those from carrots and fermented vegetables. Notably, the highly active tea leaf isolates comprised a diverse range of four species (L. plantarum, S. salivarius, L. lactis, and E. faecalis), whereas all carrot isolates were E. faecalis, and all young barley leaf isolates were L. lactis. The distinct species composition and higher diversity observed in the high-activity sources (tea leaves) compared with the lower-activity sources (carrots and fermented vegetables) suggests that the source environment imposes a significant selective pressure, thereby contributing to the superior antimicrobial functionality. Although both LOC28 and RO24 were L. plantarum strains, only the tea leaf-derived LOC28 exhibited significant activity, suggesting that the isolation source may play a more critical role than species identity. This finding strongly supports our claim that the antimicrobial effect is source dependent, rather than a mere manifestation of strain specificity. It suggests that the specific environment of the tea leaf, for example, endowed strain LOC28 with metabolic or genetic traits that favor the production of more potent antimicrobial metabolites (e.g., specific bacteriocins or organic acids) compared with a strain of the same species isolated from a different source (fermented vegetables). Therefore, we conclude that the observed activity should be interpreted as source-dependent functional characteristics acquired by the strain within its isolation environment. Tea leaves contain catechins with antimicrobial and anti-inflammatory properties [34], whereas barley leaves contain chlorophyll, flavonoids, and vitamins with antioxidant properties [35, 36]. These bioactive compounds may influence LAB metabolism and metabolite production. Additionally, the higher antioxidant content of tea and barley leaves [37, 38] may protect LAB from oxidative stress and enhance their functionality [39]. Such environmental factors likely contribute to functional differences among LAB based on their isolation source.

Even among strains from the same source, differences in antimicrobial activity were observed. LOC28 from tea leaves exhibited inhibitory activity, whereas LOC1 did not. Similarly, among isolates from young barley leaves, OA, OC, and OW1 were active, whereas OW2 showed no inhibitory activity. These findings suggest that the inhibitory activity depends not only on the isolation source but also on strain-specific genetic backgrounds and metabolic traits. Although LAB produce various antimicrobial substances, bacteriocins, organic acids, hydrogen peroxide, and fatty acids, their production varies by strain [40]. Genetic diversity contributes to this variation [41]. Omics approaches have shown that strain-level differences in bacteriocin gene presence correlate with antimicrobial efficacy [42, 43]. Even under identical environmental conditions, variations in microenvironments and microbial interactions can activate distinct pathways and gene expression profiles [44]. For example, catechin content varies by tea leaf part [45], potentially contributing to intra-source functional diversity. Recent advances in screening technologies have enabled the comprehensive characterization of bacteriocin diversity [42, 46].

Several mechanisms may underlie the inhibitory effects of LAB-derived supernatants on P. gingivalis. The observed inhibitory effects are unlikely to result from pH depression, as all culture supernatants were neutralized to pH 7.0 prior to the assay. Furthermore, because all isolated strains demonstrated uniform final growth yields in MRS broth, the variation in antimicrobial efficacy cannot be primarily attributed to differences in biomass or general total metabolite concentration. These findings strongly suggest that the antibacterial activity against P. gingivalis stems from the production of source-specific, non-acidic metabolites (e.g., bacteriocins or other low-molecular-weight compounds) that vary significantly across isolation sources. Specifically, the rich concentration of bioactive phytochemicals in the source material, such as catechins in tea leaves and high levels of antioxidants in young barley leaves, may be regulating the LAB’s metabolic pathways. This regulation could induce or enhance the production of specific bacteriocins or yet-to-be-identified low-molecular-weight antimicrobial compounds. Thus, we hypothesize that these unique source-derived factors are the key drivers endowing the LAB with “source-dependent” functional traits. Antimicrobial peptides such as bacteriocins may disrupt bacterial cell membranes [47, 48]. LAB metabolites may also suppress biofilm formation and the expression of virulence genes. Biosurfactants and lytic enzymes can disrupt or degrade established biofilms [49, 50]. Certain compounds may competitively inhibit adhesion factors on bacterial surfaces. Similar mechanisms reported for S. mutans [51] may also be relevant to P. gingivalis. Mixtures of lactobacilli have been shown to inhibit P. gingivalis-induced pathology, while nisin-producing probiotics reduce oral biofilms [52, 53].

The antimicrobial activity of LAB-derived supernatants against three oral pathogens was evaluated using the disk diffusion method. Certain LAB strains inhibited P. gingivalis and F. nucleatum but had no effect on A. actinomycetemcomitans, indicating species-specific susceptibility. Furthermore, it is important to consider the strain-specific characteristics of the tested periodontal pathogens themselves. The observed inhibitory effects are not solely determined by LAB properties but are also determined by the susceptibility of the indicator strain. Differences in oxygen tolerance, membrane structure, and efflux mechanisms likely contribute to the resistance of A. actinomycetemcomitans [54, 55]. For instance, the specific strains used in this study, such as P. gingivalis and F. nucleatum, may possess unique membrane compositions or regulatory pathways that render them particularly susceptible to the organic acids or bacteriocins produced by our plant-derived LAB strains. This is consistent with the fact that both P. gingivalis and F. nucleatum are obligate anaerobes with similar traits and ecological interactions [56]. Future studies should include a broader panel of P. gingivalis and other periodontal pathogen strains to confirm the breadth of the observed antimicrobial spectrum. Comparative studies have shown that LAB exhibit varied effects across different pathogens [23]. Clinical trials involving probiotics for periodontitis have reported mixed results, likely due to strain-specific responses [57].

Cell-free culture supernatants from LAB strains isolated from tea leaves and young barley leaves significantly suppressed the expression of P. gingivalis virulence genes (mfa1, fimA, fsH, kgp, rgpA, rgpB). fimA encodes fimbriae essential for adhesion and invasion [58], while kgp, rgpA, and rgpB encode gingipains involved in immune evasion and tissue destruction [59]. This suppression suggests that LAB-derived factors may regulate virulence gene expression. Similar mechanisms have been reported for bacteriocins and SCFAs [40, 60]. However, no consistent trend was observed in luxS expression, indicating complex and strain-dependent regulatory effects [61].

This study has several limitations. Identification of antimicrobial compounds in LAB supernatants and elucidation of their mechanisms require chromatography, mass spectrometry, and gene expression analysis. Additionally, in vivo validation using biofilm and animal models is essential. Furthermore, whole-genome sequencing and transcriptomic profiling can help elucidate strain-specific traits. Altogether, investigating how plant components influence LAB metabolism may support the development of enhanced strains for application in food or pharmaceutical products.

In conclusion, this study demonstrated that the isolation source significantly influences LAB functionality and antimicrobial efficacy, strongly supporting a source-dependent activity mechanism. Strains derived from tea leaves and young barley leaves exhibited robust antimicrobial effects against P. gingivalis. These findings provide valuable insights for developing novel periodontal disease prevention strategies using plant-derived LAB and strongly support the selection of functional strains based on source characteristics for broader applications in food and healthcare, highlighting the importance of source-dependent activity over mere strain specificity.

AUTHOR CONTRIBUTIONS

Conception and design of the experiments: Y. Tsujikawa, J. Yamamoto, and M. Naito. Manuscript writing: Y. Tsujikawa. Review and editing: Y. Tsujikawa, J. Yamamoto, and M. Naito. Overall supervision: I. Sakane. All authors have read and agreed to the published version of the manuscript.

FUNDING

The authors declare that no funding was received for the research presented in this article.

CONFLICT OF INTEREST

The authors declare no competing interests.

REFERENCES

  • 1.Nascimento GG, Alves-Costa S, Romandini M. 2024. Burden of severe periodontitis and edentulism in 2021, with projections up to 2050: The Global Burden of Disease 2021 study. J Periodontal Res 59: 823–867. [DOI] [PubMed] [Google Scholar]
  • 2.Wiernik E, Renuy A, Kab S, Steg PG, Goldberg M, Zins M, Caligiuri G, Bouchard P, Carra MC, Limosin F. 2024. Prevalence of self-reported severe periodontitis: data from the population-based CONSTANCES cohort. J Clin Periodontol 51: 884–894. [DOI] [PubMed] [Google Scholar]
  • 3.Hajishengallis G. 2015. Periodontitis: from microbial immune subversion to systemic inflammation. Nat Rev Immunol 15: 30–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL., Jr 1998. Microbial complexes in subgingival plaque. J Clin Periodontol 25: 134–144. [DOI] [PubMed] [Google Scholar]
  • 5.Darveau RP. 2010. Periodontitis: a polymicrobial disruption of host homeostasis. Nat Rev Microbiol 8: 481–490. [DOI] [PubMed] [Google Scholar]
  • 6.Mandell RL. 1984. A longitudinal microbiological investigation of Actinobacillus actinomycetemcomitans and Eikenella corrodens in juvenile periodontitis. Infect Immun 45: 778–780. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Meyer DH, Fives-Taylor PM. 1997. The role of Actinobacillus actinomycetemcomitans in the pathogenesis of periodontal disease. Trends Microbiol 5: 224–228. [DOI] [PubMed] [Google Scholar]
  • 8.Murakami S, Mealey BL, Mariotti A, Chapple ILC. 2018. Dental plaque-induced gingival conditions. J Clin Periodontol 45 Suppl 20: S17–S27. [DOI] [PubMed] [Google Scholar]
  • 9.Kasuga Y, Ishihara K, Okuda K. 2000. Significance of detection of Porphyromonas gingivalis, Bacteroides forsythus and Treponema denticola in periodontal pockets. Bull Tokyo Dent Coll 41: 109–117. [DOI] [PubMed] [Google Scholar]
  • 10.van Winkelhoff AJ, Loos BG, van der Reijden WA, van der Velden U. 2002. Porphyromonas gingivalis, Bacteroides forsythus and other putative periodontal pathogens in subjects with and without periodontal destruction. J Clin Periodontol 29: 1023–1028. [DOI] [PubMed] [Google Scholar]
  • 11.Petrariu OA, Barbu IC, Niculescu AG, Constantin M, Grigore GA, Cristian RE, Mihaescu G, Vrancianu CO, Iacob AT, Bîrcă AC, et al. 2024. Role of probiotics in managing various human diseases, from oral pathology to cancer and gastrointestinal diseases. Front Microbiol 14: 1296447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Inchingolo F, Inchingolo AM, Malcangi G, De Leonardis N, Sardano R, Pezzolla C, de Ruvo E, Di Venere D, Palermo A, Inchingolo AD, et al. 2023. The benefits of probiotics on oral health: systematic review of the literature. Pharmaceuticals (Basel) 16: 1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Haukioja A. 2010. Probiotics and oral health. Eur J Dent 4: 348–355. [PMC free article] [PubMed] [Google Scholar]
  • 14.Figueroa RH, Hernández A, López-Malo A, Mani-López E. 2024. Antimicrobial activity and applications of fermentates from lactic acid bacteria—a review. Sustainable Food Technology 2: 292–306. [Google Scholar]
  • 15.Lai WK, Lu YC, Hsieh CR, Wei CK, Tsai YH, Chang FR, Chan Y, Yeh YT, Chuang YS, Lee MC, et al. 2021. Developing lactic acid bacteria as an oral healthy food. Life (Basel) 11: 268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Teughels W, Loozen G, Quirynen M. 2011. Do probiotics offer opportunities to manipulate the periodontal oral microbiota? J Clin Periodontol 38 Suppl 11: 159–177. [DOI] [PubMed] [Google Scholar]
  • 17.Vicario M, Santos A, Violant D, Nart J, Giner L, Sanz M, Herrera D. 2013. Clinical changes in periodontal subjects with the probiotic Lactobacillus reuteri Prodentis: a preliminary randomized clinical trial. Acta Odontol Scand 71: 813–819. [DOI] [PubMed] [Google Scholar]
  • 18.Kõll-Klais P, Mändar R, Leibur E, Marcotte H, Hammarström L, Mikelsaar M. 2005. Oral lactobacilli in chronic periodontitis and periodontal health: species composition and antimicrobial activity. Oral Microbiol Immunol 20: 354–361. [DOI] [PubMed] [Google Scholar]
  • 19.Navarré A, Nazareth T, Luz C, Meca G, Escrivá L. 2024. Characterization of lactic acid bacteria isolated from human breast milk and their bioactive metabolites with potential application as a probiotic food supplement. Food Funct 15: 8087–8103. [DOI] [PubMed] [Google Scholar]
  • 20.Khushboo AK, Karnwal A, Malik T. 2023. Characterization and selection of probiotic lactic acid bacteria from different dietary sources for development of functional foods. Front Microbiol 14: 1170725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Abdel Tawab FI, Abd Elkadr MH, Sultan AM, Hamed EO, El-Zayat AS, Ahmed MN. 2023. Probiotic potentials of lactic acid bacteria isolated from Egyptian fermented food. Sci Rep 13: 16601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tamang JP, Watanabe K, Holzapfel WH. 2016. Review: Diversity of microorganisms in global fermented foods and beverages. Front Microbiol 7: 377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Van Holm W, Carvalho R, Delanghe L, Eilers T, Zayed N, Mermans F, Bernaerts K, Boon N, Claes I, Lebeer S, et al. 2023. Antimicrobial potential of known and novel probiotics on in vitro periodontitis biofilms. NPJ Biofilms Microbiomes 9: 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Marmur J. 1963. A procedure for the isolation of deoxyribonucleic acid from microorganisms. J Mol Biol 100: 726–738. [Google Scholar]
  • 25.Yang KM, Kim JS, Kim HS, Kim YY, Oh JK, Jung HW, Park DS, Bae KH. 2021. Lactobacillus reuteri AN417 cell-free culture supernatant as a novel antibacterial agent targeting oral pathogenic bacteria. Sci Rep 11: 1631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ishikawa KH, Mita D, Kawamoto D, Nicoli JR, Albuquerque-Souza E, Lorenzetti Simionato MR, Mayer MPA. 2020. Probiotics alter biofilm formation and the transcription of Porphyromonas gingivalis virulence-associated genes. J Oral Microbiol 12: 1805553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Liu TH, Hsu YH, Hsiao RY, Cheng MC, Leu YL, Tsai TY. 2025. Improved mechanism of the bioactive compounds isolated from Lactobacillus plantarum TWK10-fermented soymilk in periodontal disease. Food Funct 16: 1517–1533. [DOI] [PubMed] [Google Scholar]
  • 28.Shakya S, Danshiitsoodol N, Noda M, Inoue Y, Sugiyama M. 2022. 3-Phenyllactic acid generated in medicinal plant extracts fermented with plant-derived lactic acid bacteria inhibits the biofilm synthesis of Aggregatibacter actinomycetemcomitans. Front Microbiol 13: 991144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Karaca B, Gursoy M, Kiran F, Loimaranta V, Söderling E, Gursoy U. 2023. Postbiotics of the Lactiplantibacillus plantarum EIR/IF-1 strain show antimicrobial activity against oral microorganisms with pH adaptation capability. Microbiol Res 14: 1442–1456. [Google Scholar]
  • 30.Butrungrod W, Chaiyasut C, Makhamrueang N, Peerajan S, Chaiyana W, Sirilun S. 2023. Postbiotic metabolite of Lactiplantibacillus plantarum PD18 against periodontal pathogens and their virulence markers in biofilm formation. Pharmaceutics 15: 1419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Butrungrod W, Chaiyasut C, Makhamrueang N, Peerajan S, Chaiyana W, Sirilun S. 2024. Postbiotic metabolite derived from Lactiplantibacillus plantarum PD18 maintains the integrity of cell barriers and affects biomarkers associated with periodontal disease. Antibiotics (Basel) 13: 1054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Florit-Ruiz A, Rago L, Rojas A, Guzelkhanova B, Pont-Beltran A, Lamelas A, Solaz-Fuster MC, Martinez-Blanch JF, López ME, García-Lainez G, et al. 2025. Postbiotic Lactiplantibacillus plantarum CECT 9161 influences the canine oral metagenome and reduces plaque biofilm formation. Animals (Basel) 15: 1615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sharma A, Lee HJ. 2025. Antimicrobial activity of probiotic bacteria isolated from plants: a review. Foods 14: 495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Reygaert WC. 2018. Green tea catechins: their use in treating and preventing infectious diseases. BioMed Res Int 2018: 9105261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yamaura K, Tanaka R, Bi Y, Fukata H, Oishi N, Sato H, Mori C, Ueno K. 2015. Protective effect of young green barley leaf (Hordeum vulgare L.) on restraint stress-induced decrease in hippocampal brain-derived neurotrophic factor in mice. Pharmacogn Mag 11 Suppl 1: S86–S92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ikeguchi M, Tsubata M, Takano A, Kamiya T, Takagaki K, Ito H, Sugawa-Katayama Y, Tsuji H. 2014. Effects of young barley leaf powder on gastrointestinal functions in rats and its efficacy-related physicochemical properties. Evid Based Complement Alternat Med 2014: 974840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Khan N, Mukhtar H. 2018. Tea polyphenols in promotion of human health. Nutrients 11: 39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hagiwara A, Yoshino H, Ichihara T, Kawabe M, Tamano S, Aoki H, Koda T, Nakamura M, Imaida K, Ito N, et al. 2002. Prevention by natural food anthocyanins, purple sweet potato color and red cabbage color, of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)-associated colorectal carcinogenesis in rats initiated with 1,2-dimethylhydrazine. J Toxicol Sci 27: 57–68. [DOI] [PubMed] [Google Scholar]
  • 39.Lin MY, Chang FJ. 2000. Antioxidative effect of intestinal bacteria Bifidobacterium longum ATCC 15708 and Lactobacillus acidophilus ATCC 4356. Dig Dis Sci 45: 1617–1622. [DOI] [PubMed] [Google Scholar]
  • 40.O’Connor PM, Kuniyoshi TM, Oliveira RP, Hill C, Ross RP, Cotter PD. 2020. Antimicrobials for food and feed; a bacteriocin perspective. Curr Opin Biotechnol 61: 160–167. [DOI] [PubMed] [Google Scholar]
  • 41.Azam M, Srivastava R, Ahmed T. 2024. Isolation and characterization of bacteriocin producing Levilactobacillus brevis strain ABRIINW-K from buffalo dung. J Pure Appl Microbiol 18: 2137–2146. [Google Scholar]
  • 42.Steier V, Prigolovkin L, Reiter A, Neddermann T, Wiechert W, Reich SJ, Riedel CU, Oldiges M. 2024. Automated workflow for characterization of bacteriocin production in natural producers Lactococcus lactis and Latilactobacillus sakei. Microb Cell Fact 23: 74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Reuben RC, Torres C. 2024. Bacteriocins: potentials and prospects in health and agrifood systems. Arch Microbiol 206: 233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Lebeer S, Vanderleyden J, De Keersmaecker SCJ. 2008. Genes and molecules of lactobacilli supporting probiotic action. Microbiol Mol Biol Rev 72: 728–764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yashin AY, Nemzer BV, Combet E, Yashin YI, Chernousova NI, Trakhtenberg IM. 2015. Determination of the chemical composition of tea by chromatographic methods: a review. J Food Res 4: 56–87. [Google Scholar]
  • 46.Saragoça A, Canha H, Varanda CMR, Materatski P, Cordeiro AI, Gama J. 2024. Lactic acid bacteria: a sustainable solution against phytopathogenic agents. Environ Microbiol Rep 16: e70021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Perez RH, Zendo T, Sonomoto K. 2014. Novel bacteriocins from lactic acid bacteria (LAB): various structures and applications. Microb Cell Fact 13 Suppl 1: S3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ismael M, Huang M, Zhong Q. 2024. The bacteriocins produced by lactic acid bacteria and the promising applications in promoting gastrointestinal health. Foods 13: 3887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Woo J, Ahn J. 2013. Probiotic-mediated competition, exclusion and displacement in biofilm formation by food-borne pathogens. Lett Appl Microbiol 56: 307–313. [DOI] [PubMed] [Google Scholar]
  • 50.Lamont RJ, Kuboniwa M. 2024. The polymicrobial pathogenicity of Porphyromonas gingivalis. Front Oral Health 5: 1404917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Islam B, Khan SN, Haque I, Alam M, Mushfiq M, Khan AU. 2008. Novel anti-adherence activity of mulberry leaves: inhibition of Streptococcus mutans biofilm by 1-deoxynojirimycin isolated from Morus alba. J Antimicrob Chemother 62: 751–757. [DOI] [PubMed] [Google Scholar]
  • 52.Kazemi N, Khorasgani MR, Noorbakhshnia M, Razavi SM, Narimani T, Naghsh N. 2024. Protective effects of a lactobacilli mixture against Alzheimer’s disease-like pathology triggered by Porphyromonas gingivalis. Sci Rep 14: 27283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Radaic A, Ye C, Parks B, Gao L, Kuraji R, Malone E, Kamarajan P, Zhan L, Kapila YL. 2020. Modulation of pathogenic oral biofilms towards health with nisin probiotic. J Oral Microbiol 12: 1809302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Henderson B, Ward JM, Ready D. 2010. Aggregatibacter (Actinobacillus) actinomycetemcomitans: a triple A* periodontopathogen? Periodontol 2000 54: 78–105. [DOI] [PubMed] [Google Scholar]
  • 55.Díaz-Zúñiga J, Yáñez JP, Alvarez C, Melgar-Rodríguez S, Hernández M, Sanz M, Vernal R. 2014. Serotype-dependent response of human dendritic cells stimulated with Aggregatibacter actinomycetemcomitans. J Clin Periodontol 41: 242–251. [DOI] [PubMed] [Google Scholar]
  • 56.Kolenbrander PE, Palmer RJ, Jr, Periasamy S, Jakubovics NS. 2010. Oral multispecies biofilm development and the key role of cell-cell distance. Nat Rev Microbiol 8: 471–480. [DOI] [PubMed] [Google Scholar]
  • 57.Baddouri L, Hannig M. 2024. Probiotics as an adjunctive therapy in periodontitis treatment-reality or illusion-a clinical perspective. NPJ Biofilms Microbiomes 10: 148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Lamont RJ, Jenkinson HF. 1998. Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol Mol Biol Rev 62: 1244–1263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Potempa J, Sroka A, Imamura T, Travis J. 2003. Gingipains, the major cysteine proteinases and virulence factors of Porphyromonas gingivalis: structure, function and assembly of multidomain protein complexes. Curr Protein Pept Sci 4: 397–407. [DOI] [PubMed] [Google Scholar]
  • 60.Corr SC, Li Y, Riedel CU, O’Toole PW, Hill C, Gahan CG. 2007. Bacteriocin production as a mechanism for the antiinfective activity of Lactobacillus salivarius UCC118. Proc Natl Acad Sci USA 104: 7617–7621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.McNab R, Ford SK, El-Sabaeny A, Barbieri B, Cook GS, Lamont RJ. 2003. LuxS-based signaling in Streptococcus gordonii: autoinducer 2 controls carbohydrate metabolism and biofilm formation with Porphyromonas gingivalis. J Bacteriol 185: 274–284. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Bioscience of Microbiota, Food and Health are provided here courtesy of IPEC, Inc.

RESOURCES