Quercetin-4’-O-β-D-glucopyranoside inhibits ferroptosis though SIRT5-mediated desuccinylation of TFR1 in diabetic nephropathy

Abstract

Diabetic nephropathy (DN) is a severe complication of diabetes, marked by podocyte injury and renal dysfunction. Quercetin-4’-O-β-D-glucopyranoside (QODG), a flavonoid glycoside, has demonstrated renal protective effects. Succinylation, a post-translational modification, plays a critical role in cellular metabolism and disease progression. This study aimed to explore whether QODG alleviates DN by modulating SIRT5-mediated desuccinylation. Mouse podocyte clone-5 (MPC5) cells were exposed to high glucose (HG) with or without QODG treatment. Cell viability was measured using the cell counting kit-8 assay. Ferroptosis was assessed via commercial kits detecting lipid peroxidation and iron accumulation. Protein expression of ferroptosis- and succinylation-related markers was evaluated by Western blot. Immunoprecipitation combined with Western blot was used to detect succinylation levels of ferroptosis-related proteins. The interaction between SIRT5 and transferrin receptor 1 (TFR1) was examined by co-immunoprecipitation and proximity ligation assay assays. Additionally, an in vivo DN model was established in mice using high-fat diet and streptozotocin administration. High glucose induced ferroptosis in MPC5 cells, as indicated by increased lipid peroxidation, iron accumulation, and dysregulation of ferroptosis-related proteins. These effects were mitigated by QODG treatment. Mechanistically, QODG upregulated SIRT5 expression, which promoted desuccinylation of TFR1 at lysine 626 site, reducing its protein stability and inhibiting ferroptosis. Moreover, knockdown of SIRT5 aggravated ferroptosis and enhanced TFR1 succinylation, whereas overexpression of TFR1 counteracted the antiferroptotic effects of SIRT5. In DN mice, QODG ameliorated renal injury, oxidative stress, and ferroptosis. QODG inhibited ferroptosis by promoting SIRT5-mediated desuccinylation of TFR1, thereby attenuating DN. These findings highlight the potential of QODG as a therapeutic agent for DN.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-41148-4.

Introduction

Diabetic nephropathy (DN), a severe microvascular complication of both type 1 and type 2 diabetes mellitus, is characterized by progressive albuminuria, declining glomerular filtration rate, and eventual end-stage renal disease¹. As the leading cause of chronic kidney disease worldwide, DN affects approximately 20–40% of diabetic patients, contributing significantly to morbidity and mortality². Key risk factors include prolonged hyperglycemia, hypertension, dyslipidemia, genetic predisposition, and lifestyle factors such as obesity and smoking^1,3. The pathogenesis of DN involves intricate interactions between metabolic disturbances, hemodynamic changes, oxidative stress, chronic inflammation, and fibrotic pathways, ultimately leading to glomerulosclerosis and tubulointerstitial damage¹. Notably, podocyte injury and loss play a central role in the development of albuminuria and glomerular dysfunction, serving as a hallmark of early DN progression⁴. Despite advances in understanding DN pathophysiology, significant challenges remain, including heterogeneous patient responses, limited early diagnostic biomarkers, and the lack of definitive renoprotective treatments, highlighting critical gaps in clinical management. Current therapeutic strategies primarily focus on glycemic control, blood pressure management, and lifestyle modifications^1,5. However, these approaches only delay disease progression rather than halt or reverse it, underscoring the urgent need for novel therapies targeting underlying molecular mechanisms.

Ferroptosis, an identified form of regulated cell death characterized by iron-dependent lipid peroxidation and glutathione peroxidase 4 (GPX4) inactivation, has emerged as a critical player in the pathogenesis of metabolic disorders, particularly diabetes and its complications⁶. Distinct from apoptosis, necrosis, and autophagy, ferroptosis is driven by the accumulation of reactive oxygen species (ROS) and lipid peroxides due to impaired antioxidant defenses, making it highly relevant to diabetes-associated oxidative stress^7,8. Growing evidence suggests that ferroptosis contributes to pancreatic β-cell dysfunction, insulin resistance, and the progression of diabetic complications, including nephropathy, retinopathy, and neuropathy^9–11.

Flavonoid glycosides, a major subclass of flavonoids, are polyphenolic compounds consisting of a flavonoid aglycone conjugated with one or more sugar moieties, which enhance their solubility and bioavailability¹². These naturally occurring phytochemicals are widely distributed in fruits, vegetables, and medicinal plants, exhibiting diverse pharmacological properties, including antioxidant, anti-inflammatory, and antidiabetic^13,14. Growing evidence has demonstrated their therapeutic potential against diseases, including diabetes, cardiovascular disorders, neurodegenerative diseases, and cancer^13,15,16. Among these bioactive compounds, specific flavonoid glycosides such as quercetin-3-O-glucoside and scutellarin have shown promising efficacy in managing diabetes and its complications^17,18. Quercetin-4’-O-β-D-glucopyranoside (QODG), a naturally occurring quercetin-derived flavonoid glycoside, has attracted increasing research interest due to its broad pharmacological effects, including antioxidant, anti-inflammatory, and metabolic regulatory properties⁴. Notably, our previous study reveals that QODG exerts protective effects on podocytes in DN⁴. However, the precise molecular mechanisms underlying QODG’s renoprotective role in DN remain insufficiently understood, warranting further investigation to elucidate its therapeutic potential.

Protein post-translational modifications (PTMs) play pivotal roles in regulating cellular signaling, metabolism, and homeostasis. Among these modifications, lysine succinylation has emerged as a dynamic and functionally significant PTM, characterized by the addition of a succinyl group to lysine residues, thereby modulating protein structure, activity, and interactions¹⁹. Recent studies have revealed that succinylation is extensively involved in critical biological processes, including energy metabolism, mitochondrial function, and stress responses, with its dysregulation implicated in various diseases such as cancer, neurodegenerative disorders, and cardiovascular diseases^19–21. The regulation of succinylation is orchestrated by succinyltransferases, which add the modification, and desuccinylases, which remove it. Key enzymes involved in this process include sirtuin (SIRT) 5, a prominent NAD⁺-dependent desuccinylase of the sirtuin family, as well as other succinylation-modulating enzymes such as lysine acetyltransferase 2 A (KAT2A) and carnitine palmitoyltransferase 1 A (CPT1A)²². Notably, the role of SIRT5 in DN has been reported in previous studies^4,23.

Our previous study demonstrated that QODG upregulates SIRT5, thereby inhibiting the succinylation of never in mitosis a-related kinase 7 (NEK7), and subsequently attenuating pyroptosis and oxidative stress injury in podocytes⁴. Building on these findings, the present study aimed to further investigate whether QODG can mitigate ferroptosis in DN by modulating succinylation modification.

Methods and materials

Cell culture and treatment

Mouse podocyte clone-5 (MPC5) cells obtained from STEM RECELL Biotech Co., LTD (#STM-CL-6617; Shanghai, China) were cultured in Dulbecco’s Modified Eagle Medium (DMEM; #PM150210B; Pricella Biotech Co., LTD, Wuhan, China) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin and were induced with recombinant interferon-γ at 33 °C for proliferation. After 10 days, cells were cultured in a condition free of interferon-γ at 37 °C until the cells were fully differentiated into mature podocytes. After differentiation, cells were cultured in a constant temperature incubator with 5% CO₂ at 37 °C.

MPC5 cells at the logarithmic growth stage were harvested and treated with 5 mM (control) or 25 mM [high glucose (HG)] glucose. Besides, MPC5 cells were treated with different doses (0, 50, 100, and 150 µM) of QODG (#HY-N9872; Fig. 1A; MedChem Express, Monmouth Junction, NJ, USA) for 24 h. In addition, MPC5 cells were treated with different activators or inhibitors of ferroptosis, including Erastin (#HY-15763; purity: 99.62%; MedChem Express; 1 µM), liproxstatin-1 (Lip-1; #HY-12726; purity: 99.70%; MedChem Express; 1 µM), Ferrostatin-1 (Fer-1; #HY-100579; purity: 99.71%; MedChem Express; 5 µM), and RAS-Selective Lethal 3 (RSL3; #HY-100218 A; purity: 99.90%; MedChem Express; 1 µM).

Fig. 1.

QODG increased the cell viability of HG-induced MPC5 cells. (A), The chemical structure of QODG; (B), The cell viability of MPC5 cells treated with high glucose and different concentrations (50, 100, and 150 µM) of QODG was detected by CCK-8 assay (N = 3). ^**p < 0.01.

Cell transfection

MPC5 cells were transfected with SIRT5-targeting short hairpin (sh) RNA (shSIRT5), shRNA negative control (shNC), pcDNA3.1 empty vector, or transferrin receptor 1 (TFR1) overexpression plasmid (pcDNA3.1-TFR1) using Lipofectamine 3000 (#L3000001; Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. The shSIRT5 sequence targeting mouse SIRT5 mRNA was as follows: 5′-CCAGTTGTGTTGTAGACGAAA-3′ (TRC clone ID: TRCN0000092834). Briefly, MPC5 cells were seeded in 6-well plates (5 × 10⁵ cells/well) and cultured until 70–80% confluency. For each well, 2.5 µg of plasmid or 50 nM shRNA was mixed with 5 µL Lipofectamine 3000 in Opti-MEM medium (#31985062; Gibco, Grand Island, NY, USA). After 15 min of incubation at room temperature, the mixture was added to cells. The medium was replaced with fresh complete medium after 6 h. The mRNA levels of SIRT5 and TFR1 were assessed by reverse transcription quantitative polymerase chain reaction (RT-qPCR) after 48 h.

Cell counting kit-8 (CCK-8)

MPC5 cells were seeded in 96-well plates (5 × 10³ cells/well) and cultured under experimental conditions. After incubation, 10 µL of CCK-8 (#96992; Sigma-Aldrich, St. Louis, MO, USA) reagent was added to each well and incubated for 2 h at 37 °C. Absorbance was measured at 450 nm using a microplate reader (Thermo Fisher). Untreated cells served as the control (100% viability), and blank wells (medium + CCK-8 without cells) were used for background subtraction. Data were normalized to the control group and expressed as percentage viability. Each condition was tested in triplicate across three independent experiments.

Flow cytometry

To assess lipid peroxidation in MPC5 cells, the fluorescent probe C11 BODIPY 581/591 (#D3861; Thermo Fisher) was used. Cells were seeded in a 24-well plate and cultured until 70–80% confluency. After treatment, cells were washed with PBS and incubated with 5 µM C11 BODIPY 581/591 in serum-free medium for 30 min at 37 °C in the dark. Following incubation, cells were washed twice with PBS and trypsinized. Fluorescence intensity was measured by flow cytometry (Ex/Em: 488 nm/590 nm for oxidized signal, 581 nm/591 nm for reduced signal).

Western blot

MPC5 cells were lysed in radioimmunoprecipitation assay buffer (RIPA; #R0278; Sigma-Aldrich) containing protease and phosphatase inhibitors (#P1046; Beyotime Biotech Co., Ltd. Shanghai, China) on ice for 30 min. Lysates were centrifuged at 12,000 × g for 15 min at 4 °C, and protein concentrations were determined using a BCA assay (#P0010S; Beyotime). Equal amounts of protein (30 µg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; 12% gels) and transferred to polyvinylidene fluoride (PVDF) membranes (#FFP80; Beyotime). After blocking with 5% non-fat milk for 1 h at room temperature, membranes were incubated overnight at 4 °C with primary antibodies targeting GPX4 (#ab125066; 1/5000; Abcam, Cambridge, MA, USA), solute carrier family 7 member 11 (SLC7A11; #ab307601; 1/1000; Abcam), TFR1 (#ab214039; 1/1000; Abcam), lysine acetyltransferase (KAT) 2 A (#ab321885; 1/1000; Abcam), KAT3B (#ab259330; 1/1000; Abcam), CPT1A (#ab234111; 1/1000; Abcam), SIRT5 (#ab259967; 1/1000; Abcam), SIRT7 (#ab259968; 1/1000; Abcam), succinylation (#PTM-401; 1/1000; PTM Biotech Co., Ltd. Hangzhou, China), β-actin (#ab8227; 1/5000; Abcam). Following three washes with Tris buffered saline Tween (TBST), membranes were incubated with HRP-conjugated goat anti-rabbit secondary antibody (#ab6721; 1/10,000; Abcam) for 1 h at room temperature. Protein bands were visualized using enhanced chemiluminescence (ECL) substrate (#32106; Thermo Fisher) and quantified by ImageJ software. β-actin served as the internal reference for normalization. All experiments were performed in triplicate.

Equal amounts of protein (30 µg) from the same lysate preparation were loaded onto separate 12% SDS-PAGE gels. Following electrophoresis and transfer to PVDF membranes, each membrane was probed with a specific primary antibody. This strategy was applied consistently across all experiments to maintain sample equivalence and avoid artifacts from membrane stripping.

RT-qPCR

Total RNA was extracted from MPC5 cells using TRIzol reagent (#15596026CN; Thermo Fisher) following the manufacturer’s protocol. RNA concentration and purity were assessed by NanoDrop spectrophotometry (A260/A280 ratio > 1.8; Thermo Fisher). First-strand cDNA was synthesized from 1 µg total RNA using the PrimeScript RT reagent kit (#RR037Q; Takara; Tokyo, Japan). Quantitative PCR was performed using Taq Pro Universal SYBR qPCR Master Mix kit (#Q712; Vazyme Biotech Co., Ltd. Nanjing, China) on a QuantStudio 5 system (Thermo Fisher) with the following cycling conditions: 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Gene-specific primers are listed in Table 1, with β-actin as the endogenous control. Relative mRNA expression was calculated using the 2^−ΔΔCt method. All reactions were performed in technical triplicates with three biological replicates.

Table 1.

Primer sequences used in RT-qPCR.

Gene	Forward (5’−3’)	Reverse (5’−3’)
SIRT5	CCAGTTGTGTTGTAGACGAAAGC	ACACCTGTGATGGGTTTCGAG
TFR1	TCATGAGGGAAATCAATGATC	GCCCCAGAAGATATGTCGGAA
β-actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT

Succinylation level detection

To assess site-specific protein succinylation, MPC5 cell lysates were subjected to immunoprecipitation (IP) using antibodies against TFR1 (#ab214039; 1/30; Abcam), GPX4 (#67763-1-Ig; 1/200; Proteintech Biotech Co., Ltd. Wuhan, China), or SLC7A11 (#ab307601; 1/1000; Abcam), respectively. Briefly, 500 µg of whole cell lysate (WCL) was incubated with 2 µg of the indicated primary antibody overnight at 4 °C, followed by addition of 30 µL Protein A/G agarose beads (#P2010; Beyotime) for 2 h at 4 °C. Beads were washed four times with lysis buffer, and immunoprecipitated proteins were eluted and analyzed by Western blot using an anti-succinyl-lysine antibody (#PTM-401; 1/1000; PTM). Parallel aliquots of the same WCL samples (30 µg) were loaded as input controls and probed for total TFR1, GPX4, SLC7A11, and β-actin.

Site prediction and mutation

GPSuc website (http://kurata14.bio.kyutech.ac.jp/GPSuc/index.php) was used for prediction of succinylation sites of TFR1. Arginine (R) mutations were introduced at lysine (K)242 (K242R), K384 (K384R), and K626 (K626R) sites of TFR1. Then, the TFR1-WT, TFR1-K242R, TFR1-K384R, and TFR1-K626R plasmids were transfected into MPC5 cells for 24 h. TFR1-WT, TFR1-K242R, TFR1-K384R, and TFR1-K626R were designed by Genscript Biotechnology Co., LTD (Nanjing, China).

Co-immunoprecipitation (Co-IP)

To validate the protein-protein interaction between SIRT5 and TFR1, Co-IP assay was performed in MPC5 cells. First, the cDNA sequences of TFR1 (carrying a K626R point mutation) and SIRT5 were respectively cloned into mammalian expression vectors with an N-terminal HA tag or Flag tag, generating HA-tagged TFR1-K626R and Flag-tagged SIRT5 plasmids. Then, MPC5 cells were co-transfected with these two plasmids using Lipofectamine 3000 reagent. At 48 h post-transfection, cells were lysed. The resulting supernatants were incubated with HA antibody-conjugated beads (#ab236632; 1/30; Abcam) at 4 °C overnight. After thorough washing to remove non-specific bindings, the immunoprecipitated protein complexes were eluted. Subsequently, the eluates were separated by SDS-PAGE and transferred onto a PVDF membrane. The membrane was probed with anti-Flag (#ab205606; 1/1000; Abcam) and anti-HA (#ab236632; 1/1000; Abcam) antibodies to detect the target proteins, so as to confirm the interaction between SIRT5 and TFR1.

Proximity ligation assay (PLA) assay

To verify the interaction between SIRT5 and TFR1 in MPC5 cells, the PLA assay was performed as follows: MPC5 cells were fixed with 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.1% Triton X-100 for 10 min, and blocked with 5% BSA for 30 min at 37 °C Cells were then incubated overnight at 4 °C with primary antibodies (rabbit anti-SIRT5, 1/1000; mouse anti-TFR1, 1/1000). After phosphate-buffered saline with Tween-20 (PBST) washes, PLA probes (anti-mouse PLUS, #DUO92001; anti-rabbit MINUS, #DUO92005; Merck Millipore, Billerica, MA, USA) were applied at 37 °C for 1 h. Subsequently, unbound probes were removed by washing, and PLA oligonucleotides were hybridized and circularized via ligation reaction at 37 °C for 30 min using ligase. Rolling circle amplification was then performed at 37 °C for 100 min with polymerase to amplify the circularized DNA templates. Finally, the amplified signals were visualized as green fluorescent puncta, and the cells were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; #D9542; Sigma) for 5 min at room temperature to label nuclei. Images were captured using a confocal laser scanning microscope (Leica, Wetzlar, Germany) with appropriate filters (488 nm excitation for green fluorescence and 405 nm excitation for DAPI), and merged images were generated to show their spatial relationship.

Protein stability assessment

Protein stability assessment was performed to verify the protein stability of USP41 after SIRT5 inhibition in MPC5 cells. MPC5 cells were treated with cycloheximide (CHX; 100 µg/mL; Abcam), a protein translation inhibitor. Then, the protein level of TFR1 at different time points (0, 6, 12, 18, and 24 h) was detected.

Animal study

A total of 24 male C57BL/6 mice (8 weeks old, 20 ± 2 g) were obtained from Vital River Laboratory (Beijing, China) and housed under controlled conditions (24 ± 1 °C, 12-h light/dark cycle) with ad libitum access to water and standard chow. After one week of acclimatization, the mice were randomly divided into three groups (n = 6/group): (1) control group (CON; normal diet), (2) DN group (DN model), and (3) DN+QODG group (DN model treated with QODG). To induce diabetes, mice in the DN and DN+QODG groups were fed a high-fat diet (HFD; 60% kcal fat, 20% carbohydrate, 20% protein) for 4 weeks, followed by intraperitoneal injection of streptozotocin (STZ; #S0130; Sigma-Aldrich; 50 mg/kg/day in 10 mM citrate buffer; pH 4.5) for 5 consecutive days. Control mice received citrate buffer injections. Mice with fasting blood glucose (FBG) ≥ 16.7 mmol/L were classified as diabetic. This measurement was taken via tail vein blood using an Accu-Chek glucometer after 72 h. Additionally, mice with 24 h urine microalbumin (UMA) levels ≥ 30 mg, determined after 2 weeks, were considered to have DN. All the mice included in this study met the above requirements. The DN+QODG group mice were administered QODG (10 mg/kg/day, dissolved in 5% DMSO) via oral gavage for 6 weeks, while control and DN groups received vehicle (5% DMSO in saline). After treatment, mice were fasted overnight, anesthetized with CO₂, and euthanized by cervical dislocation. Blood was collected via cardiac puncture, and serum was isolated after centrifugation (1500 × g, 15 min, 4 °C). Kidneys were excised, and either fixed in 4% paraformaldehyde for hematoxylin & eosin (H&E) staining or snap-frozen in liquid nitrogen for Western blot analysis.

Biochemical measurements

The concentrations of creatinine (Scr; #C011-2-1; Jiancheng Biotech Co., Ltd. Nanjing, China), blood urea nitrogen (BUN; #C013-1-1; Jiancheng), urinary albumin excretion rate (UAER: urinary albumin concentration/24-hour urine volume), reactive oxygen species (ROS; #STA-347; Cell Biolabs, USA), malondialdehyde (MDA; #A003-4: for cells; #A003-1: for serum; Jiancheng), superoxide dismutase (SOD; #A001-3; Jiancheng), iron (#E1042: for cells, APPLYGEN Technology Co., Ltd. Beijing, China; #ab83366: for serum, Abcam), catalase (CAT; #A007-1-1; Jiancheng), and glutathione (GSH; #A006-1-1; Jiancheng) in mice serum or MPC5 cells were analyzed using commercial assay kits.

Succinyl-coA level measurement

The concentrations of succinyl-coA level in MPC5 cells was measured using a commercial enzyme-linked immunosorbent assay (ELISA) kit (#CB11500-Mu; COIBO Biotech Co., Ltd. Shanghai, China). All operations were carried out in accordance with the manufacturer’s instructions.

H&E staining

The left kidneys isolated from mice were fixed using 4% paraformaldehyde solution for 24 h, and embedded in paraffin. Then, the embedded tissues were sliced into 4 μm sections followed by staining with H&E. Finally, the sections were observed by a biopathology microscope (Olympus, Tokyo, Japan).

Immunohistochemistry (IHC)

IHC was conducted on paraffin-embedded mouse kidney Sect. (4 μm) to assess the expression of GPX4, SLC7A11, and TFR1. After deparaffinization, rehydration, and antigen retrieval in citrate buffer, endogenous peroxidase was quenched with 3% H₂O₂. Sections were blocked and incubated overnight at 4 °C with antibodies against GPX4 (#ab125066; 1/200; Abcam), SLC7A11 (#ab307601; 1/1000; Abcam), or TFR1 (#ab214039; 1/500; Abcam). HRP-conjugated secondary antibody (#ab6721; 1/1000; Abcam) and 3,3’-Diaminobenzidine (DAB; #P0202; Beyotime) were used for detection, followed by hematoxylin counterstaining. Stained sections were imaged using a light microscope (Olympus).

Statistical analysis

The SPSS 21.0 software was used to analyze data. Data are expressed as mean ± standard deviation (SD). Student’s t-test was used for comparison between the two groups. One-way analysis of variance (ANOVA) was used for comparison among groups with Tukey’s post hoc analysis. Statistical analyses were performed using GraphPad Prism software (v8.0.1, GraphPad Software Inc., San Diego, CA, USA). p < 0.05 indicates that the difference is statistically significant.

Results

QODG increased the cell viability of HG-induced MPC5 cells

QODG is a flavonoid glycoside derived from quercetin. A previous study finds that QODG inhibits podocyte injury by SIRT5-mediated desuccinylation of NEK7⁴. In this study, we treated MPC5 cells with HG and different concentrations (50, 100, and 150 µM) of QODG. CCK-8 results showed that compared with the control group, the cell viability of HG-induced MPC5 cells treated with 50, 100 and 150 µM QODG showed a dose-dependent increase (Fig. 1B). QODG at 150 µM had the greatest effect on cell viability and was used for subsequent experiments.

QODG inhibited HG-induced ferroptosis in MPC5 cells

Ferroptosis plays a pivotal role in driving DN progression. Although Wu et al.⁴ demonstrate that QODG contributes to DN by modulating pyroptosis, its potential regulatory effect on ferroptosis in DN remains unexplored. In this study, we treated MPC5 cells with different ferroptosis activators (Erastin and RSL3) and inhibitors (Lip-1 and Fer-1). CCK-8 results indicated that after treatment with Lip-1 and Fer-1, the cell viability of HG-induced MPC5 cells was increased. Besides, the cell viability was reduced after RSL3 treatment in HG-induced MPC5 cells (Fig. 2A). These results suggested that ferroptosis inhibition could protect against podocyte injury. In addition, compared with the control group, HG treatment increased the lipid peroxidation, MDA, and iron levels and decreased the SOD and CAT contents in MPC5 cells. Moreover, relative to the HG group, QODG treatment downregulated the levels of lipid peroxidation, MDA, and iron and upregulated that of SOD and CAT in MPC5 cells (Figs. 2B-F). Furthermore, Western blot results demonstrated that HG treatment decreased the protein levels of GPX4 and SLC7A11 and increased that of TFR1, and the results were reversed after QODG treatment in MPC5 cells (Fig. 2G). Above findings indicated that QODG exerts protective effects in DN by attenuating HG-induced ferroptosis in podocytes.

Fig. 2.

QODG inhibited HG-induced ferroptosis in MPC5 cells. (A), CCK-8 was performed to analyze the cell ability of each group (N = 3); (B), Flow cytometry was performed to analyze the relative fluorescence intensity of lipid peroxidation in each group (N = 3); Cellular (C), SOD, (D), CAT, (E), MDA, and (F), iron contents in each group were determined by commercial kits (N = 3); (G), Western blot was performed to assess the protein levels of GPX4, SLC7A11, and TFR1 in each group (N = 3). ^**p < 0.01.

QODG increased SIRT5 protein level in MPC5 cells

To explore whether QODG regulates ferroptosis in DN via succinylation modification, we first assessed the global succinylation level by Western blot. The results revealed a significant increase in toral succinylation level under HG condition, which was effectively reversed after QODG treatment (Fig. 3A). To determine whether the altered succinylation was attributable to changes in the availability of the succinyl-CoA substrate, we measured intracellular succinyl-CoA level via ELISA assay. Notably, neither HG nor QODG treatment induced significant changes in succinyl-CoA concentration (Fig. 3B), suggesting that the succinylation changes were independent of substrate availability. These findings led us to hypothesize that the change might be mediated by enzymes regulating succinylation. Then, the protein levels of key succinyltransferases and desuccinylases, including KAT2A, KAT3B, CPT1A, SIRT5, and SIRT7, were measured via Western blot. HG exposure led to decreased levels of KAT2A and SIRT5, while QODG treatment specifically restored SIRT5 expression without affecting KAT2A. Moreover, the expression of KAT3B, CPT1A, and SIRT7 remained unaltered under both HG and QODG conditions (Figs. 3C–H). Collectively, these findings suggested that QODG might modulate succinylation through the regulation of SIRT5-mediated desuccinylation in MPC5 cells.

Fig. 3.

QODG increased SIRT5 protein level in MPC5 cells. (A), Western blot was performed to analyze the total succinylation level in each group (N = 3); (B), ELISA was used to detect the succinyl-coA level in each group (N = 3); (C), Western blot was used to detect the protein level of KAT2A, KAT3B, CPT1A, SIRT5, and SIRT7 in MPC5 cells (N = 3); Quantification of protein levels of (D), KAT2A, (E), KAT3B, (F), CPT1A, (G), SIRT5, and (H), SIRT7 (N = 3). ^**p < 0.01.

Silence of SIRT5 promoted ferroptosis in HG-induced MPC5 cells

To further explore the role of SIRT5 in DN, shNC and shSIRT5 vectors were transfected into MPC5 cells. Results showed that the mRNA expression of SIRT5 was decreased after SIRT5 silence in MPC5 cells (Fig. 4A). Besides, CCK-8 results indicated that compared with the HG+QODG+shNC group, SIRT5 inhibition decreased the cell viability (Fig. 4B). Additionally, the lipid peroxidation, MDA, and iron levels in the HG+QODG+shSIRT5 were increased relative to the HG+QODG+shNC group, while the SOD and CAT contents were decreased (Figs. 4C-G). Furthermore, Western blot results revealed that after SIRT5 knockdown, the protein levels of SIRT5, GPX4, and SLC7A11 were reduced while that of TFR1 was increased in MPC5 cells (Fig. 4H). These results implied that silence of SIRT5 promoted ferroptosis in HG-induced MPC5 cells.

Fig. 4.

Silence of SIRT5 promoted ferroptosis in HG-induced MPC5 cells. (A), The mRNA levels of SIRT5 after transfection of shSIR5 vector into MPC5 cells were analyzed by RT-qPCR (N = 3); (B), CCK-8 was performed to analyze the cell ability of each group (N = 3); (C), Flow cytometry was performed to analyze the relative fluorescence intensity of lipid peroxidation in each group (N = 3); Cellular (D), SOD, (E), CAT, (F), MDA, and (G), iron contents in each group were determined by commercial kits (N = 3); (H), Western blot was performed to assess the protein levels of SIRT5, GPX4, SLC7A11, and TFR1 in each group (N = 3). ^**p < 0.01.

Silence of SIRT5 enhanced the protein stability of TFR1 in MPC5 cells

After SIRT5 silence, the protein levels of SIRT5, GPX4 and SLC7A11 in MPC5 cells were downregulated while that of TFR1 was upregulated (Fig. 5A). Besides, silencing of SIRT5 only increased the protein level of TFR1-suc (TFR1-suc), without affecting that of GPX4-suc and SLC7A11-suc in MPC5 cells (Fig. 5B). Then, GPSuc website were used for prediction of succinylation sites of TFR1. Three potential sites lysine (K)242, K384, and K626 were predicted. Western blot results revealed that TFR1 and TFR1-suc protein levels were decreased after K626 site mutation, rather than K242 and K384 sites in MPC5 cells (Fig. 5C). Further Co-IP and PLA assays confirmed a direct physical interaction between SIRT5 and the TFR1-K626R mutant (Figs. 5D-E). Furthermore, silence of SIRT5 decreased the protein level of SIRT5 and enhanced the protein stability of TFR1 in MPC5 cells (Fig. 5F).

Fig. 5.

Silence of SIRT5 enhanced the protein stability of TFR1 in MPC5 cells. (A), Western blot was performed to assess the protein levels of SIRT5, GPX4, SLC7A11, and TFR1 after SIRT5 inhibition in MPC5 cells (N = 3); (B), IP and Western blot were performed to detect the protein levels of SIRT5, GPX4, SLC7A11, and TFR1 succinylation in MPC5 cells (N = 3); (C), The protein levels of TFR1 and TFR1-suc in MPC5 cells after mutations at K242, K384 and K626 sites of TFR1 were analyzed by Western blot (N = 3); (D), Co-IP and (E), PLA assay were used to analyze the interaction between SIRT5 and TFR1 in MPC5 cells (N = 3); (F), The MPC5 cells in each group were treated with CHX, then the protein level of SIRT5 and TFR1 in each group was assayed by Western blot at different time points (0, 6, 12, 18, and 24 h) (N = 3). ^**p < 0.01.

Overexpression of TFR1 reversed the inhibited ferroptosis induced by SIRT5 overexpression in MPC5 cells

To elucidate the functional interplay between SIRT5 and TFR1 in ferroptosis regulation, we transfected MPC5 cells with SIRT5-overexpressing vectors into MPC5 cells, which successfully increased its mRNA level (Fig. 6A). In addition, after transfecting TFR1-overexpressing vectors into MPC5 cells, the mRNA and protein levels of TFR1 were increased (Fig. 6B). Notably, SIRT5 overexpression group enhanced cell viability and elevated SOD and CAT activities while reducing lipid peroxidation, MDA content, and iron accumulation compared to the HG+Vector group in MPC5 cells. Conversely, when TFR1 was overexpressed in SIRT5-overexpressing MPC5 cells, these protective effects were reversed, manifesting as diminished cell viability, reduced SOD and CAT activities, and increased lipid peroxidation, MDA, and iron levels (Figs. 6C-H). Western blot analysis further revealed that SIRT5 overexpression upregulated SIRT5, GPX4, and SLC7A11 protein levels while downregulating that of TFR1 in MPC5 cells; these effects were counteracted by TFR1 overexpression (Fig. 6I).

Fig. 6.

Overexpression of TFR1 reversed the inhibited ferroptosis induced by SIRT5 overexpression in MPC5 cells. (A), RT-qPCR was performed to assess the mRNA level of SIRT5 after SIRT5 overexpression in MPC5 cells (N = 3); (B), The mRNA and protein levels of TFR1 after transfection of TFR1 overexpression vectors into MPC5 cells were analyzed by RT-qPCR and Western blot (N = 3); (C), CCK-8 was performed to analyze the cell ability of each group (N = 3); (D), Flow cytometry was performed to analyze the relative fluorescence intensity of lipid peroxidation in each group (N = 3); Cellular (E), SOD, (F), CAT, (G), MDA, and (H), iron contents in each group were determined by commercial kits (N = 3); (I), Western blot was performed to assess the protein levels of SIRT5, GPX4, SLC7A11, and TFR1 in each group (N = 3). ^**p < 0.01.

QODG reversed the renal injury induced by DN

To further investigate the therapeutic potential of QODG in DN, we established a diabetic mouse model and evaluated its effects on renal pathology and metabolic parameters. Histopathological analysis revealed that DN mice exhibited significant mesangial matrix deposition, mesangial expansion, and increased fractional mesangial area compared to the CON group, all of which were markedly ameliorated by QODG treatment (Fig. 7A). Biochemical assessments demonstrated that DN mice showed elevated Scr, BUN, and UAER levels compared to the CON group, with QODG administration effectively reversing these abnormalities (Figs. 7B-D). Furthermore, oxidative stress markers were significantly altered in DN mice, showing increased serum ROS, MDA, and iron levels along with decreased CAT, SOD, and GSH contents, while QODG treatment notably attenuated these oxidative imbalances (Figs. 7E-J). Western blot analysis of kidney tissues revealed that the DN-induced downregulation of ferroptosis-related proteins GPX4 and SLC7A11 was restored following QODG intervention (Fig. 7K), suggesting its protective role against ferroptosis in DN. IHC results suggested that DN group showed decreased GPX4 and SLC7A11 expression and increased that of TFR1 in kidney tissues compared with the CON group, and the results were reversed after QODG treatment (Fig. 7L).

Fig. 7.

QODG reversed the renal injury induced by DN. (A), Representative images of H&E staining of the each group kidney sections (scale bar: 20 μm) (N = 6); (B), Scr, (C), BUN, and (D), UAER values of the each group mice were shown (N = 6); Commercial kits were used to assess the serum (E), ROS, (F), MDA, (G), CAT, (H), SOD, (I), iron, and (J), GSH contents in each group (N = 6); (K), Western blot was performed to assess the protein levels of GPX4, SLC7A11, and TFR1 in the kidney tissues of each group mice (N = 6); (L), IHC was performed to assess the expression levels of GPX4, SLC7A11, and TFR1 in the kidney tissues of each group mice (scale bar: 20 μm) (N = 6). ^**p < 0.01.

Discussion

Natural compounds derived from traditional Chinese medicine (TCM) have gained increasing attention for their therapeutic potential in treating various diseases, including metabolic, inflammatory, and degenerative disorders²⁴. These bioactive molecules offer distinct advantages, such as multi-target effects, low toxicity, and synergistic interactions, making them promising candidates for drug development²⁴. In this study, we discovered that QODG, a naturally occurring quercetin-derived flavonoid glycoside, inhibited ferroptosis in HG-induced MPC5 cells and HFD/STZ-induced DN mice. Similarly, our previous study reveals that QODG inhibits HG-induced oxidative stress in podocytes and suppresses another form of cell death, pyroptosis. Furthermore, other similar flavonoid compounds have also been discovered to exert beneficial effects on DN⁴. Besides, Zhang et al.²⁵ report that quercetin regulates the ferroptosis process of human tubular epithelial cells (HK-2) cells by activating nuclear factor erythroid 2-related factor 2 (Nrf2) in DN. In addition, Ding et al.²⁶ indicate that, a natural dihydroflavonoid compound, dihydroquercetin, alleviates the urinary excretion of microalbumin in HFD/STZ-induced DN rats, improves the hyperglycemic state and lipid metabolism disorder, and inhibits the generation of ROS in rat kidney mesangial cells. Moreover, Liu et al.²⁷ also demonstrate that quercetin inhibits the renal injury in DN mice induced by HFD/STZ in vivo and the apoptosis of HK-2 cells in vitro.

Succinylation has been implicated in the pathogenesis of various renal diseases. A previous study reveals that under diabetic conditions, renal succinate accumulation has been recognized as a key metabolic disorder that not only impairs mitochondrial β-oxidation but also exacerbates oxidative stress²⁸. In addition, Baek et al.²³ reveal that SIRT5 may influence nutrient partitioning and utilization in DN, underscoring its potential role in metabolic reprogramming associated with the disease. Moreover, previous studies have confirmed that SIRT5 expression is decreased in various kidney diseases, such as cisplatin induced acute kidney injury, clear cell renal cell carcinoma, and sepsis-induced acute kidney injury^29–31. In this study, we discovered that SIRT5 was decreased in HG-treated MPC5 cells, and the results were reversed after QODG treatment. Besides, silence of SIRT5 promoted ferroptosis in HG-induced MPC5 cells. Similar to our results, a previous study reveals that QODG inhibits podocyte injury by SIRT5-mediated desuccinylation of NEK7⁴. Research on the role of flavonoids in the regulation of succinylation modification is limited. Wang et al.³² discover that Astragaloside IV, a natural antioxidant, alleviates the tubular injury, oxidative stress and mitochondrial dysfunction in db/db mice and HG-induced HK-2 cells by regulating CPT1A-mediated desuccinylation in DN. In addition, Chang et al.³³ indicate that quercetin protectes against HG-induced cardiomyocyte injury via SIRT5-mediated desuccinylation.

TFR1 serves as a key mediator of cellular iron uptake by facilitating the import of iron-bound transferrin into cells via endocytosis³⁴. Although TFR1 is not a direct executor of ferroptosis, it significantly contributes to ferroptosis sensitivity by regulating intracellular iron availability—a central element in ferroptosis-driven lipid peroxidation. In contrast, GPX4 acts as a pivotal anti-ferroptotic defender by reducing lipid hydroperoxides to non-toxic alcohols, thereby preventing oxidative membrane damage³⁵. Conversely, ACSL4 promotes ferroptosis by esterifying polyunsaturated fatty acids into phospholipids, which are more susceptible to peroxidation³⁶. In this study, we found that silencing SIRT5 enhanced the protein stability of TFR1 in MPC5 cells. Moreover, overexpression of TFR1 reversed the suppression of ferroptosis induced by SIRT5 overexpression. To date, no direct regulation of TFR1 via succinylation modification has been reported. However, a recent study revealed that the methyltransferase-like 3 (METTL3)/YTH N6-methyladenosine RNA binding protein (YTHDF3) N6-methyladenosine (m⁶A) axis promotes ferroptosis in diabetic kidney disease by stabilizing TFR1³⁷, highlighting the importance of post-transcriptional mechanisms in TFR1 regulation. Furthermore, previous studies also indicate that GPX4 and ACSL4 can serve as targets to inhibit ferroptosis in DN. For instance, platycodin D, isolated from the dry root of Platycodon grandiflorum, attenuates HG-induced ferroptosis in HK-2 cells by upregulating GPX4 expression³⁸. Additionally, Wang et al.³⁹ report that fisetin ameliorates fibrotic kidney disease in mice by inhibiting ACSL4-mediated tubular ferroptosis, further underscoring the therapeutic potential of targeting ferroptosis regulators in kidney diseases.

In conclusion, this study demonstrated that QODG alleviated DN progression by inhibiting ferroptosis through SIRT5-mediated TFR1 desuccinylation, highlighting the therapeutic potential of natural compounds in DN. However, several limitations should be acknowledged. First, clinical translation of these findings necessitates additional pharmacokinetic and safety studies. Besides, the sample size used in the animal experiments was relatively small, which may limit the generalizability of the findings. Additionally, while our Co-IP assay demonstrated a physical interaction between SIRT5 and TFR1, the use of a more spatially sensitive technique, such as Proximity Ligation Assay (PLA), would provide stronger in situ evidence for their direct interaction. These limitations will be further researched in our future studies.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

All authors participated in the design, interpretation of the studies and analysis of the data and review of the manuscript. M W drafted the work and revised it critically for important intellectual content; W Y and X Y was responsible for the acquisition, analysis and interpretation of data for the work. All authors read and approved the final manuscript.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

This study was approved by the Ethics Committee of Children’s Hospital, Zhejiang University School of Medicine. All animal experiments should comply with the ARRIVE guidelines. All methods were carried out in accordance with relevant guidelines and regulations.