E. coli-expressed chicken IL-17A enhances respiratory innate immunity by inducing proinflammatory cytokines and interferons

Abstract

Interleukin-17A (IL-17A) is a key pro-inflammatory cytokine that plays a crucial and complex role in immune regulation, infection, and inflammation under both physiological and pathological conditions, demonstrating significant potential in these fields. However, research on its interaction with the avian respiratory system and its potential application as a mucosal immune adjuvant is limited. To investigate its functional relevance, a comparison was first performed of the genetic and structural features of chicken IL-17A (chIL-17A) with those of its mammalian homologs. Recombinant chIL-17A was subsequently produced via a prokaryotic expression system and evaluated through in vitro assays using chicken embryo fibroblasts (CEFs) and peripheral blood mononuclear cells (PBMCs), as well as in vivo experiments in specific-pathogen-free (SPF) chickens. In the in vivo study, 3-week-old SPF White Leghorn chickens (mixed sex) were nebulized with a single or double dose (20 μg/kg per dose, n = 12 per group) of chIL-17A. The results demonstrated that chIL-17A treatment markedly upregulated the transcription of proinflammatory cytokines (e.g., IL-1β, IL-6, and TNF-α), type I interferons, and multiple interferon-stimulated genes in a dose-and time-dependent manner. Notably, a second administration further enhanced its stimulatory effect on these immune mediators. In vivo, nebulized chIL-17A significantly induced pulmonary proinflammatory responses, particularly on day 5 post-treatment, with IL-1β and IL-6 mRNA levels increasing by 67.35-fold (P < 0.001) and 130.19-fold (P < 0.001), respectively, in lung tissues. Modulation of IFN responses was most pronounced in the lower trachea and lung tissues, with minimal effects in the upper tracheal region. These findings unequivocally demonstrate the potent immunomodulatory capacity of chIL-17A and underscore its potential as a mucosal immune enhancer in poultry.

Introduction

The IL-17 family consists of six similar cytokine family members: IL-17A (or IL-17), IL-17B, IL-17C, IL-17D, IL-17E, and IL-17F (Kolls and Lindén, 2004). Among them, mammalian IL-17A is the most extensively characterized, plays a pivotal proinflammatory role in host defense against microbial pathogens and has been implicated in the pathogenesis of diverse inflammatory conditions, including autoimmune diseases (Matusevicius et al., 1999; Lock et al., 2002; Kagami et al., 2010), metabolic disorders (Smith et al., 2008; Matsushima et al., 2010), and cancer (Grivennikov et al., 2012; Coffelt et al., 2015; Ferreira et al., 2020). IL-17A is secreted by both innate and adaptive immune cells, including Th17 cells, ILC3s, γδ T cells, NK cells and epithelial cells, and mediates diverse outcomes by signalling through the IL-17 receptor (IL-17R) on various immune-related cells or epithelial cells (Cua and Tato, 2010; Huber et al., 2013). Th17 cells are located mainly in barrier tissues and have the characteristics of effector memory T cells (Stark et al., 2005). IL-17A expression is also observed in a majority of noncytotoxic CD8⁺ T cells (Tc17), which play roles in antiviral host defense and are implicated in the pathogenesis of autoimmune diseases (Liu et al., 2007; Nigam et al., 2011; Huber et al., 2013). These cell populations mediate the rapid release of IL-17A in response to pathogens or tissue damage (Martin et al., 2009; Sutton et al., 2009).

In murine models, intrapulmonary Klebsiella pneumoniae infection leads to increased mortality in IL-17RA knockout mice (Ye et al., 2001), suggesting that IL-17A also plays an important role in establishing mucosal barriers against extracellular bacteria or fungi (Cho et al., 2010). However, opposing effects have also been observed in mice: IL-17A overexpression regulates the Th1/Th2 response and leads to exacerbation of cowpox virus virulence (Patera et al., 2002).

Compared with the substantial research progress on IL-17A in mammals, functional studies on chicken IL-17A (chIL-17A) remain relatively limited. Existing studies have shown that chIL-17A functions as an autonomous effector to directly induce antimicrobial peptides (e.g., avBD2, iNOS) in intestinal epithelial cells through a TRAF3-dependent pathway (distinct from mammalian TRAF6), which is likely mechanistically linked to its cognate receptor (Wang et al., 2023; Boodhoo et al., 2024). Current research on chIL-17A has focused predominantly on its function in anti-infection immunity, particularly against pathogens such as coccidia and bacterial enteritis in chickens (Akhavanpoor et al., 2017; Cammayo-Fletcher et al., 2024; Tajima et al., 2025). However, its broader functions in immunostimulation and immunomodulation, which ultimately underpin its diverse effects, should not be overlooked.

In this study, we aimed to evaluate the immunomodulatory effects of recombinant chicken IL-17A (chIL-17A) on chicken cells and respiratory tissues, with a specific focus on its potential as a mucosal immune enhancer. To this end, we first analyzed the evolutionary relationships and structural conservation of chIL-17A across major species. Subsequently, chIL-17A was expressed in a prokaryotic system and purified. Its regulatory effects on proinflammatory cytokines, type I interferons, and interferon-stimulated genes were assessed in vitro using chicken embryo fibroblasts and peripheral blood mononuclear cells, and in vivo via nebulization in specific-pathogen-free chickens. This study provides a theoretical basis for the potential application of chIL-17A as an immunomodulator in poultry health management.

Materials and methods

Phylogenetic analysis

To elucidate the genetic evolutionary relationships of IL-17A genes across major livestock and poultry species, key laboratory animals, and humans, the following transcriptome data were downloaded from the GenBank database: Homo sapiens (human, NM_002190.3), Ovis aries (sheep, XM_004018887.6), Bos taurus (cattle, NM_001008412.2), Oncorhynchus mykiss (rainbow trout, NM_001124619.2), Sus scrofa (pig, NM_001005729.1), Mus musculus (mouse, NM_010552.3), Rattus norvegicus (Norway rat, NM_001106897.1), and Gallus gallus (chicken, NM_204460.2). The phylogenetic analysis was performed by constructing phylogenetic trees via the neighbor-joining method. The evolutionary distances were computed via the maximum composite likelihood method. The tree is drawn to scale, with branch lengths in the number of base substitutions per site. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown next to the branches. Evolutionary analyses were conducted in MEGA Ⅺ.

Analysis of protein structural characteristics

To gain deeper insights into the biological functions of chIL-17A (UniProt ID: A0A1D5PRD0), ExPASy ProtParam was used to determine its physicochemical parameters. SignalP 6.0 (DTU Health Tech) and TMHMM 2.0 (CBS) were utilized to predict the signal peptide cleavage sites and the transmembrane domains, respectively. PSIPRED 4.0 (UCL), Cyscon, NetPhos 3.1 and NetNGlyc 1.0 were utilized to predict the secondary structure, disulfide bonds and posttranslational modifications (phosphorylation and glycosylation), respectively. AlphaFold v2.3 (DeepMind) was used to construct the structural model.

Isolation and culture of primary cells

Primary chicken embryo fibroblasts (CEFs) were isolated from 11-day-old specific-pathogen-free (SPF) chicken embryos (obtained from Xinxing Dahuanong Poultry Egg Co., Ltd., with a certificate of quality conformity provided by the supplier) through trypsin-DNase digestion and maintained in Dulbecco's modified Eagle's medium (DMEM, Gibco, 11995065) supplemented with 10% fetal bovine serum (FBS, Gibco, 16140071) at 37°C under 5% CO₂. Peripheral blood mononuclear cells (PBMCs) were isolated from the heparinized blood of 4-week-old chickens via Ficoll-Paque plus (GE Healthcare, 17144003) density gradient centrifugation and cultured in RPMI 1640 medium (Gibco, 61870036) containing 10% FBS.

Recombinant plasmid construction

A codon-optimized gene fragment, encoding mature chIL-17A (encoding residues 26-155), with an N-terminal 6×His tag was synthesized by Tsingke Biotechnology (Beijing, China). The optimized chIL-17A fragment was subsequently cloned and inserted into the prokaryotic expression vector pET-28a (+) to generate the recombinant plasmid pET28a-chIL-17A, which was subsequently verified by restriction enzyme digestion and DNA sequencing.

Recombinant protein expression and validation

The recombinant plasmid pET28a-chIL-17A was transformed into E. coli BL21(DE3) competent cells, which were subsequently plated on LB agar supplemented with 50 μg/ml kanamycin (kan). Single colonies were inoculated into LB-Kan media and grown to mid-log phase (OD₆₀₀ = 0.6∼0.8) at 37°C with shaking at 220 rpm. Protein expression was induced with 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 16 h at 37°C. The cells were harvested via centrifugation (8,000 × g, 10 min, 4°C), resuspended in Tris-buffered saline (TBS; 20 mM Tris-HCl, 150 mM NaCl, pH 7.5), and lysed via sonication on ice (50% amplitude, 30 sec pulse/30 sec rest, 10 cycles). The soluble and insoluble fractions were separated via centrifugation (12,000 × g, 30 min, 4°C) and analyzed via 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). For Western blotting, proteins were transferred to polyvinylidene difluoride (PVDF) membranes and probed with a mouse anti-His antibody (1:5,000, Abcam, ab18184), followed by horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1:2,000, CST, 7076).

Expression condition optimization

For the IPTG concentration, mid-log phase cultures (OD₆₀₀=0.5∼0.8) were induced with 0∼2 mM IPTG (0.5 mM increments) at 37°C for 16 h. The cells were precipitated (8,000 × g, 4°C), resuspended in TBS (pH=7.5), and lysed via ice-cold sonication (50% amplitude, 30 min). The inclusion bodies were solubilized and analyzed via SDS-PAGE. In addition, under a fixed IPTG concentration, we systematically explored the optimal temperature and duration conditions for protein expression by testing various induction temperatures (16, 20 , 25 , and 37 °C) and induction times (4 , 8 , 12 , and 16 h).

Protein production and purification

Large-scale chIL-17A expression was induced with 1 mM IPTG at 37°C for 16 h. Harvested cells (8,000 × g, 10 min, 4°C) were washed with PBS and lysed via ice-cold sonication. The inclusion bodies were pelleted (12,000 × g, 20 min), and the supernatant was clarified by 0.22 µm filtration. The recombinant protein was purified via Ni-NTA affinity chromatography with a stepwise imidazole gradient (50-500 mM). The recombinant protein was purified via Ni-NTA affinity chromatography using a BIO-RAD NGC Quest™ 10 Plus protein purification system at a flow rate of 1 ml/min. The column was washed sequentially with 10 column volumes of wash buffer containing 20 mM imidazole, followed by 10 column volumes of 50 mM imidazole, to remove non-specifically bound proteins. Recombinant chIL-17A was then eluted with a stepwise imidazole gradient (100-500 mM). The purified chIL-17A was dialyzed against PBS via a 3.5 kDa molecular weight cutoff (MWCO) membrane, concentrated 20-fold via PEG-8000 precipitation, and depyrogenated via a ToxEraser endotoxin removal kit (GenScript, L00338). The protein concentration was determined via a BCA assay.

In vitro cytotoxicity assessment

CEFs in the logarithmic growth phase were seeded into 96-well plates (5 × 10³ cells/well) and cultured overnight. The cells were treated with chIL-17A (10∼100 ng/ml) for 24 h, with six technical replicates per concentration. Cell viability was quantified via absorbance at 450 nm via a CCK-8 assay (10 μl of reagent/well, 2 h of incubation). On the basis of initial viability data, the optimal concentration was selected for time-course cytotoxicity analysis at 6∼48 h intervals according to identical CCK-8 protocols.

Assessment of chIL-17A immunomodulatory activity

The immunomodulatory activity of chIL-17A was assessed in CEFs and PBMCs. CEFs (1 × 10⁶ cells/well) were treated with 50 ng/ml chIL-17A or PBS (control) for 24 h. Total RNA was extracted, reverse-transcribed, and analyzed via qPCR to quantify the IL-1β, IL-6, and TNF-α mRNA levels (primers listed in Table 1). PBMCs in RPMI 1640 complete medium were similarly treated and analyzed for antiviral gene expression (IFN-α, IFN-β, OAS3, PKR and MX1).

Table 1.

Primer sequences used in this study.

Primer name	Primer sequence (5′−3′)	Purpose
IL-17A-F	AGTGGTGGTGGTGGTGGTG CTCGAGATGCTGTCCGCGTCT	PCR
IL-17A-R	CAGTGGTGGTGGTGGTGGTG TCTAGAGTGGTGGTGGTGGTG
β-actin-F	TGGGTATGGAGTCCTGTGGTAT	qRT-PCR
β-actin-R	AGGTGGGGCAATGATCTTGATT
IL-1β-F	GGATTCTGAGCACACCACAGT	qRT-PCR
IL-1β-R	TCTGGTTGATGTCGAAGATGTC
IL-6-F	ATCCGGCAGATGGTGATAAA	qRT-PCR
IL-6-R	CCCTCACGGTCTTCTCCATA
IL-8-F	CAGCTGCTCTGYCGCAAGG	qRT-PCR
IL-8-R	GAGCAGTGGGGTCCAAGCACAC
IFN-α-F	TCCAAGACAACGATTACAGCGCCT	qRT-PCR
IFN-α-R	TGTTGCCTGTGAGGTTGTGGATGT
IFN-β-F	ACCTTCTCCTGCAACCATCTTCGT	qRT-PCR
IFN-β-R	ATGGCTGCTTGCTTCTTGTCCTTG
IFN-γ-F	ACACTGACAAGTCAAAGCCGCACA	qRT-PCR
IFN-γ-R	AGTCGTTCATCGGGAGCTTGGC
OAS3-F	CACGGCCTCTTCTACGACAT	qRT-PCR
OAS3-R	AGCTCCTTGGTCTCGTAGGT
PKR-F	GCAGCAAAAACGTGGGACAT	qRT-PCR
PKR-R	CTTCTTTTGCAGCGGCTTGT
MX1-F	ACGGTCCAACTTCAGCTCAG	qRT-PCR
MX1-R	GATTGCTGCAGCCTAATGGC

Notes: F, forward primer; R, reverse primer.

Dose-dependent analysis

Logarithmic-phase CEFs (1 × 10⁶ cells/well) that formed confluent monolayers were exposed to increasing concentrations of chIL-17A (10, 25, 50, 75, or 100 ng/ml) or the PBS control for 24 hours at 37°C/5% CO₂. RNA extraction, cDNA synthesis, and qPCR were performed as described above to amplify transcripts of IL-1β, IL-6, IL-8, IFN-α, IFN-β, OAS3, PKR, and MX1.

Time-course analysis

CEF monolayers (1 × 10⁶ cells/well) treated with 50 ng/ml chIL-17A (determined as the optimal concentration) or the PBS control were harvested at various time points (8 , 24 , 48 , and 72 h). At each interval, total RNA was isolated via the standardized TRIzol protocol, followed by reverse transcription and qPCR quantification of designated pro-inflammatory and antiviral gene transcripts.

Repeated stimulation analysis

The defined dose of chIL-17A was added to the preprepared CEF monolayer cells, followed by incubation at 37°C in a 5% CO₂ cell culture incubator for 24 h. After the initial stimulation, the same dose of chIL-17A was added again for repeated stimulation for 24 h. Total RNA was then extracted, and changes in cytokine expression were quantitatively analyzed via qPCR.

Chicken respiratory tract stimulation experiment

Three-week-old specific-pathogen-free (SPF) White Leghorn chickens of mixed sex (n = 12 per group) were administered recombinant chIL-17A via a laryngeal spray nebulizer, which produced droplets 5-10 μm in diameter. Chickens were housed in HEPA-filtered isolators with ad libitum access to feed and water, under a 12 h light/dark cycle. For the animal experiments, the subjects were divided into two treatment groups: a single-dose group and a double-dose group. The double-dose group received a second administration of 20 μg/kg chIL-17A (dissolved in sterile PBS) 24 hours after the initial treatment. The control group received PBS only. At each sampling time point (1, 3, and 5 days post-initial treatment), chickens were euthanized by intravenous injection of sodium pentobarbital (100 mg/kg body weight). Tracheal lavage and tissue collection were performed immediately thereafter. Tracheal lavage fluid was obtained by flushing the tracheal lumen with 1 ml of PBS supplemented with a protease inhibitor cocktail (Roche, Complete™, 04693159001) , followed by centrifugation at 1500 × g for 10 min; the supernatant was stored at −80°C. Tracheal tissue (divided into upper, middle, and lower segments according to anatomical region) and lung tissue were isolated, rapidly frozen in liquid nitrogen, and transferred to a − 80°C ultralow temperature freezer.

Analysis of residual chIL-17A in the respiratory tract by ELISA

The concentration of residual chIL-17A in the lavage fluid was quantified via ELISA. Briefly, 96-well plates were coated with lavage fluid samples. A dilution series of recombinant chIL-17A protein served as the positive control, while PBS-coated wells were used as negative controls. After incubation at 37°C for 2 h and washing, each well was blocked with 200 μl of 5% BSA in PBS for 1.5 h at 37°C. Following another wash, 100 μl of mouse anti-His antibody (1:1000 dilution) was added, and the mixture was incubated for 2 h at 37°C. The plates were washed again, and 100 μl of HRP-conjugated goat anti-mouse IgG (1:2000) was added and incubated for 1 h at room temperature in the dark. Color development was initiated with TMB substrate for 10 min, and the absorbance was then measured at 450 nm.

Analysis of immune gene expression in tissues

Approximately 100 mg of frozen tissue was pulverized in liquid nitrogen. Total RNA was extracted via TRIzol reagent and treated with DNase I to remove genomic DNA. First-strand cDNA was synthesized from 1 μg of RNA via a PrimeScript RT reagent kit. Quantitative PCR was performed via SYBR Green Master Mix in a 20 μl reaction volume containing 0.4 μM of each primer and 2 μl of cDNA. The amplification protocol consisted of initial denaturation at 95°C for 30 s, followed by 35 cycles of 95°C for 5 s and 60°C for 30 s. The relative expression of target genes was normalized to that of β-actin via the 2^−ΔΔCt method, with three technical replicates per sample.

Statistical analysis

Gene expression levels were normalized to those of endogenous β-actin and calculated via the 2^−ΔΔCt method. The data are expressed as the mean ± SEM from three independent biological replicates, with each sample measured in triplicate. Statistical significance was determined by Student's t-test or one-way ANOVA in GraphPad Prism 9.0.1 (GraphPad Software), with significance thresholds set at P < 0.05 (*), P < 0.01 (**), and P < 0.001 (***) versus the control.

Results

Genetic, functional and structural properties of chIL-17A

The chicken IL-17A gene is located on chromosome 3 (White Leghorn), and its transcript encodes a 169-amino acid precursor protein that contains a signal peptide but lacks a transmembrane domain. Evolutionary analysis of chIL-17A transcripts from eight distinct species revealed that those from chicken, trout and rainbow trout diverged from their mammalian counterparts, each forming a unique clade (Fig. 1A). Substantial variation was observed in the number of encoded amino acids. Nonetheless, all the variants retained a relatively conserved functional domain.

Fig. 1.

Amino acid sequence comparison and tertiary structure analysis of the chIL-17A protein. (A) Alignment and comparison of the amino acid sequences of IL-17A among diverse species. (B) Prediction of the 3D structural model and domain analysis of IL-17A of human, murine and avian origins on the basis of the AlphaFold3 deep learning model. Some key amino acid residues involved in receptor binding are highlighted.

In the mature A protein, two pairs of cysteine residues (Cys30-Cys124 and Cys89-Cys139) are predicted to form disulfide bonds, which may influence its soluble expression. Additionally, the protein undergoes glycosylation and phosphorylation during its maturation or activation. AlphaFold was used to predict the structure of chIL-17A (AF-Q5XP68-F1), as shown in Fig. 1B. Structural model analysis revealed that chIL-17A shares a generally conserved architecture with its human and murine counterparts, with the core functional domains consisting primarily of β-sheet structures in all three species. Furthermore, these chemical bonds critical for maintaining structural stability are relatively conserved. For the chIL-17A model, Arg97 (corresponding to Arg94 in hIL-17A or Arg92 in mIL-17A) forms a salt bridge with acidic receptor residues, and Phe126 (corresponding to Tyr123 and Glu118 in hIL-17A or Phe121 in mIL-17A) stabilizes the hydrophobic core and interaction interface (Hymowitz et al., 2001; Kuestner et al., 2007; Iwakura et al., 2011; Waterhouse et al., 2018).

Heterologous expression and validation of chIL-17A in the prokaryotic system

The gene sequence encoding mature chIL-17A was codon optimized and subsequently cloned and inserted into a prokaryotic expression vector (Fig. 2A). The resulting recombinant plasmid was verified via restriction enzyme digestion (Fig. 2B) and confirmed via DNA sequencing. Subsequently, E. coli BL21(DE3) harboring pET28a-IL-17A was induced with 1 mM IPTG at 37°C for 16 h. SDS-PAGE and Western blot analysis revealed a predominant band at ∼17.9 kDa in the insoluble fraction (Fig. 2C).

Fig. 2.

Expression, purification, and cytotoxicity assay of recombinant chIL-17A. (A) Schematic of the construction of the recombinant plasmid pET28a-chIL-17A. (B) Identification of the pET28a-chIL-17A plasmid via restriction digestion. M, DNA marker; lane 1, pET28a-chIL-17A plasmid; lane 2: Xho I/Xba I-digested products (vector: ∼5.0 kb; insert fragment: ∼500 bp). (C) (Upper panel) SDS-PAGE analysis of E. coli lysates expressing chIL-17A (arrow indicates the ∼17.9 kDa band). (Lower panel) Western blot probed with anti-His antibody (1:2000 dilution). (D) Workflow for expression optimization and protein purification. (E) SDS-PAGE of the purification steps. Lane M: protein marker; Lane 1: loaded lysate; Lane 2: flow-through; Lanes 3-7: eluted fractions with 50-500 mM imidazole. (F) SDS-PAGE of purified chIL-17A after dialysis and concentration (100 mM eluate). (G) CEF viability after 24 h of chIL-17A treatment (0-100 ng/ml). Data are presented as mean ± SEM (n = 6 technical replicates per concentration). (H) CEF viability after 48 h of incubation with 50 ng/ml chIL-17A. Data are presented as mean ± SEM (n = 6 technical replicates per time point).

Large-scale expression and purification of recombinant chIL-17A

Next, the optimal expression conditions, including IPTG concentration, temperature, and induction time, were systematically screened to establish a refined expression protocol (Fig. 2D). A systematic comparison of induction parameters (0∼2 mM IPTG, 16∼37°C, 4∼16 h) revealed that 1 mM IPTG at 37°C for 16 h maximized inclusion body formation (Supplementary Fig. 1). For protein purification, the inclusion bodies were solubilized in denaturing buffer (8 M urea, 20 mM imidazole) and loaded onto a Ni-NTA column. After sequential washing steps (as described in Materials and Methods), recombinant chIL-17A was eluted with 100 mM imidazole, achieving >90% purity, as quantified by densitometric analysis of Coomassie-stained gels (Fig. 2E and 2F). The eluted protein was refolded via gradient dialysis (8∼0 M urea), and the endotoxins were then removed via a ToxEraser endotoxin removal kit (GenScript, L00338).

The recombinant chIL-17A protein had no cytotoxic effects on the cells

To evaluate its biological activity, we first assessed its effects on cellular proliferation and viability in vitro. Primary CEFs were treated with increasing concentrations of chIL-17A (0, 10, 25, 50, 75, or 100 ng/ml) for 24 hours, followed by incubation with CCK-8 reagent. The results demonstrated that chIL-17A had no effect on cell proliferation or viability, and this effect was dose dependent (Fig. 2G). CEFs were incubated with 50 ng/ml chIL-17A for 6, 12, 24, or 48 hours to assess the effects of chronic exposure. No measurable effect on cell viability was observed, even after prolonged treatment (Fig. 2H). These data validate the safety of chIL-17A for in vitro immunological applications and support its utility as a biocompatible immunomodulator.

Immunostimulatory effects of chIL-17A on CEFs and PBMCs

Next, to assess the bioactivity of the prokaryotically expressed protein, CEFs and PBMCs were treated with a specified concentration of the protein for a predetermined duration, followed by qPCR analysis to evaluate the transcription levels of specific cytokines. Compared with the negative control group, chIL-17A significantly increased the expression levels of inflammatory cytokines (IL-1β, IL-6, and TNF-α) in CEFs (Fig. 3A). Additionally, treatment with chIL-17A significantly increased the transcript abundance of multiple antiviral-related genes, including IFN-α, IFN-β, OAS3, PKR, and MX1, in both CEFs and PBMCs (Fig. 3B and 3C). These results collectively demonstrate that the prokaryotically expressed chIL-17A exhibits potent immunostimulatory activity, broadly activating immune signalling pathways across diverse cell types.

Fig. 3.

The mature chIL-17A induces immunomodulatory gene expression in CEFs and PBMCs. (A) Proinflammatory cytokine expression (IL-1β, IL-6, or TNF-α) in chIL-17A-treated CEFs. (B) Antiviral gene expression (IFN-α, IFN-β, OAS3, PKR, and MX1) in CEFs. (C) Antiviral gene expression in PBMCs. (D) Proposed mechanism of chIL-17A-mediated immune activation. Gene expression was normalized to that of β-actin (2^-ΔΔCt method). All the samples were analyzed in triplicate, and all the data are expressed as the mean ± SEM. *Significant difference (P < 0.05); **highly significant difference (P < 0.01); ***extremely significant (P < 0.001); ns, no significant difference.

ChIL-17A exhibits dose- and time-dependent immunostimulatory effects

To further elucidate the influence of dosage and exposure duration on the function of chIL-17A, CEFs were treated with various concentrations of chIL-17A, followed by qPCR analysis to quantify changes in the expression of specific cytokines. The results revealed that the expression level of IL-1β exhibited a significant dose-dependent response, with a marked increase as the concentration of chIL-17A increased (Fig. 4A). At a specific concentration of 50 ng/ml, the mRNA expression levels of IL-6, IL-8, IFN-α, IFN-β, and MX1 were significantly increased (P < 0.001), reaching their respective peak expression levels (Fig. 4B–H). Notably, the biphasic response—where 50 ng/ml elicited maximal gene activation while higher concentrations (e.g., 100 ng/ml) showed attenuated effects for some genes—implies potential receptor saturation or negative feedback regulation at elevated doses.

Fig. 4.

The mature chIL-17A dose-dependently induces immune gene expression in cells. CEFs were treated with recombinant chIL-17A at 0, 10, 25, 50, 75, or 100 ng/ml for 24 h. The cells were harvested at the endpoint, and total RNA was isolated for immune gene expression analysis, including IL-1β (A), IL-6 (B), IL-8 (C), IFN-α (D), IFN-β (E), OAS3 (F), PKR (G), MX1 (H). The expression was normalized to that of β-actin (2^−ΔΔCt method). All the samples were analyzed in triplicate (n = 3 biological replicates, with three technical replicates per sample). Data are expressed as the mean ± SEM. *Significant difference (P < 0.05); **highly significant difference (P < 0.01); ***extremely significant (P < 0.001); ns, no significant difference.

Under treatment with 50 ng/ml chIL-17A, the expression levels of immune-related genes in CEFs exhibited a time-dependent dynamic pattern. The expression levels of genes such as IL-1β, IL-6, IFN-α, and PKR peaked during the early phase of treatment (0-24 hours). In contrast, the expression of IL-8, IFN-β, or OAS3 peaked during the intermediate phase (24-48 hours), followed by a gradual decrease in their mRNA levels thereafter. Notably, MX1 gene expression displayed a distinct pattern, with its level continuously increasing over the 72-hour treatment period (Fig. 5).

Fig. 5.

ChIL-17A induces time- and treatment-dependent upregulation of immune genes in CEFs. (A-H) Temporal expression profiles of immune-related genes. Primary CEFs were treated with recombinant chIL-17A (50 ng/ml) and harvested at the indicated time points (8-72 h). Gene expression of IL-1β (A), IL-6 (B), IL-8 (C), IFN-α (D) , IFN-β (E), OAS3 (F), PKR (G), and MX1 (H) were analyzed by qRT-PCR. (I-J) Effects of intensified chIL-17A stimulation. CEFs were subjected to three treatment regimens: a single chIL-17A treatment, an intensified chIL-17A treatment, and a PBS-negative control. (I) Schematic diagram depicting the experimental timeline for various treatments within each group. (J) qPCR analysis of immunoregulatory genes (IL-1β, IL-6, IL-8, IFN-α, and IFN-β) across treatment groups. The expression was normalized to that of β-actin (2^−ΔΔCt method). All the samples were analyzed in triplicate (n = 3 biological replicates, with three technical replicates per sample). Data are expressed as the mean ± SEM. *Significant difference (P < 0.05); **highly significant difference (P < 0.01); ***extremely significant (P < 0.001); ns, no significant difference.

Enhanced immunostimulation via a dual-dose regimen

In view of the above findings, we extended the treatment duration to 48 hours by administering a second dose of chIL-17A 24 hours after the initial treatment. Relative quantitative PCR results (Fig. 6) revealed that, compared with no treatment, a single 24-hour treatment with chIL-17A significantly increased the expression levels of proinflammatory cytokines (IL-1β, IL-6, and IL-8) and antiviral factors (IFN-α and IFN-β) in CEFs. Notably, when CEFs were treated with chIL-17A twice for a total of 48 hours, the mRNA expression levels of all the tested genes exhibited more pronounced upregulation (P < 0.001). These findings indicate that extending the duration of chIL-17A treatment significantly enhances its impact on gene expression in CEFs.

Fig. 6.

Nebulized chIL-17A activates robust and sustained innate immune responses in the chicken respiratory tract. (A) Schematic diagram of the experimental timeline. Chickens were nebulized with chIL-17A on day −1 and day 0. Tracheal segments (upper, middle, lower) and lung tissues were collected at 1, 3, and 5 days post-initial immunization (dpi). Tracheal lavage fluid was obtained at the indicated time points. (B) Validation of chIL-17A delivery via ELISA. The concentration of recombinant chIL-17A in tracheal lavage fluid was quantified via an anti-His tag antibody. PC (positive control): chIL-17A protein standard in PBS. The data are presented as the mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001 vs. the PC group. (C—H) qRT-PCR analysis of immune gene expression. Relative mRNA expression of IL-1β (C), IL-6 (D), IFN-α (E), IFN-β (F), OAS (G), and MX1 (H) in tracheal segments and lung tissue at 1, 3, and 5 dpi. All gene expression data were normalized to that of β-actin via the 2^−ΔΔCt method. The values represent the mean ± SEM from three independent replicates. *P < 0.05, **P < 0.01, ***P < 0.001; ns, no significant difference.

Nebulized chIL-17A activates respiratory immune response in chickens

For the early immune response phase (1 dpi), rapid upregulation of IFN family genes was observed. The expression of IFN-α increased by 228.71-fold in the middle trachea (P < 0.001), whereas that of IFN-β was increased by 11.00-fold in the lower trachea (P < 0.001) and 11.64-fold in the lungs (P < 0.001). The antiviral gene MX1 was significantly elevated in the lower trachea and lungs (21.35- and 24.80-fold, respectively; P < 0.001). OAS transcripts increased by 2.29-fold and 3.35-fold in the middle and lower trachea, respectively (P < 0.01), indicating that chIL-17A rapidly activated antiviral defense pathways.

For the Intermediate effector phase (3 dpi), the inflammatory and antiviral responses were synergistically enhanced. IL-1β transcripts increased 20.88-fold in the upper trachea (P < 0.001), and IL-6 expression increased 8.91-fold in the lower trachea (P < 0.05). Concurrently, IFN-β expression further increased 53.82-fold in the lower trachea (P < 0.001), and pulmonary MX1 expression increased 57.89-fold (P < 0.001), demonstrating spatiotemporal coupling of inflammatory and antiviral responses.

For the late sustained phase (5 dpi), the lungs emerged as the dominant site of immune activation. The expression of IL-1β and IL-6 increased dramatically to 67.35- and 130.19-fold, respectively (P < 0.001), whereas OAS and MX1 remained highly expressed (4.99- and 29.48-fold, P < 0.001). Compared with those in the controls, significant upregulation persisted in the trachea, with OAS in the lower segment (5.06-fold) and IFN-α in the middle segment (49.19-fold) remaining elevated (P < 0.001).

Discussion

IL-17A, a hallmark cytokine secreted by Th17 cells, plays a pivotal role in immune regulation. IL-17 stimulation promotes the binding of TPL2 to TAK1, triggering the phosphorylation and catalytic activation of TAK1. This process mediates the activation of multiple key signalling pathways, including the IKKi, NF-κB, JNK, and p38 pathways (Rickel et al., 2008; Song et al., 2011). IL-17A is a critical player in the immunopathogenesis of psoriasis. As a pleiotropic cytokine, IL-17A is involved in maintaining tissue integrity, cancer progression, autoimmune diseases, and viral infections, primarily by inducing a range of proinflammatory cytokines, chemokines, antimicrobial peptides (e.g., mucins, β-defensins), and matrix metalloproteinases, thereby participating in broad anti-infection and inflammatory responses (Kim et al., 2012). In particular, during microbial invasion, IL-17A rapidly promotes the recruitment and activation of neutrophils or macrophages, as well as granulopoiesis (Veldhoen, 2017).

Currently, the primary clinical application of IL-17A focuses on the development of monoclonal antibody drugs, which are effective in rapidly treating autoimmune diseases. However, the effects of exogenous IL-17A remain controversial, largely because of its complex dual role in viral infections. Studies by Liu et al. demonstrated that blocking IL-17A alleviates the clinical symptoms of common respiratory diseases caused by influenza virus (FLU), rhinovirus (RV), and respiratory syncytial virus (RSV), highlighting IL-17A as a potential key target for antiviral immunotherapy (Liu et al., 2021). Conversely, IL-17A enhances epithelial barrier function by regulating the cellular localization of tight junction proteins (e.g., occludin) and protects mice from increased intestinal permeability (Lee et al., 2015). During pathogen invasion, IL-17A also promotes the expression of barrier-related proteins in mucosal tissues (Kinugasa et al., 2000; Kao et al., 2004). Hamada's in vivo experiments further confirmed that IL-17A protects mice against lethal infections caused by H1N1 and H3N2 influenza viruses (Hamada et al., 2009). However, other studies have associated IL-17A with poor prognosis in seasonal and pandemic H1N1 influenza (Bermejo-Martin et al., 2009; Crowe et al., 2009). Thus, the precise mechanisms of IL-17A and its impact on host responses to viral infections, particularly in chickens, remain poorly understood (Loughran et al., 2018; Bao et al., 2019).

In mammals, IL-17A potentiates type I interferon (IFN) responses by coordinately activating MAPK/NF-κB pathways and inducing histone acetylation-mediated chromatin remodeling at ISG loci (OAS3, PKR, and MX1), thereby increasing the STAT1-dependent transcriptional activation of antiviral effector genes (Akimzhanov et al., 2007; Gaffen, 2009). In avian species, however, chIL-17A signaling exhibits distinct features. Unlike mammals that rely on TRAF6 for IL-17 signal transduction, chicken IL-17A functions through a TRAF3-dependent pathway to induce antimicrobial peptides in intestinal epithelial cells (Bagheri et al., 2022; Jin et al., 2024). Furthermore, the avian IL-17 receptor is hypothesized to retain a more complete death domain, permitting autonomous signaling, whereas mammalian receptors have evolved degenerated domains that necessitate synergy-dependent signaling(Cammayo-Fletcher et al., 2024). Despite these differences, chIL-17A drives NF-κB-dependent proinflammatory cytokine production (IL-1β, IL-6) while simultaneously priming IFN responsiveness through STAT3 activation in immune cells(Bagheri et al., 2022; Hassan and Sharif, 2025). The resulting inflammatory milieu establishes a permissive environment for amplified JAK-STAT signalling (Zeng et al., 2016; Bagheri et al., 2022; Jin et al., 2024).These avian-specific mechanisms highlight the evolutionary adaptation of IL-17A function in chickens and underscore its potential as a target for poultry immunomodulation.

In this study, we aimed to explore the immunomodulatory effects of exogenous recombinant chIL-17A on chicken host cells. Pretreatment of CEFs with 50 ng/ml chIL-17A upregulated the expression of pro-inflammatory cytokines and type I/II interferons. On the basis of these findings, we hypothesize that chIL-17A pretreatment activates multiple signalling cascades, thereby inducing pro-inflammatory immune responses (Shiomi et al., 2016; Lotfi et al., 2019). The significant upregulation of IFN-α and IFN-β suggested that chIL-17A may participate in interferon-related responses and regulate innate host immunity by promoting the expression of ISGs.

Critically, the prokaryotically expressed chIL-17A demonstrated immunostimulatory activity equivalent to that of eukaryotic IL-17A, despite the inherent limitations of bacterial expression systems in posttranslational processing (e.g., the absence of glycosylation and disulfide bond complexity). The observed bioactivity confirmed the proper folding of the conserved IL-17 family domain, which adopts a functional β-sheet-rich cystine knot structure essential for receptor engagement (Ely et al., 2009). The successful formation of two critical disulfide bonds (Cys30-Cys124 and Cys89-Cys139) proved indispensable for stabilizing the tertiary conformation required for epitope presentation. Furthermore, this prokaryotic expression strategy generated 1.7 mg/ml endotoxin-free chIL-17A, effectively bypassing the technical and economic constraints of eukaryotic platforms while preserving full biological functionality and providing a foundation for polyclonal or monoclonal antibody production (Nilkanta and Bagchi, 2018).

Recombinant chIL-17A exhibited strong antigenicity, bound effectively to His-tag, and significantly upregulated pro-inflammatory factors in CEFs and some ISGs in PBMCs, confirming its biological activity and immunostimulatory potential. Furthermore, extending the duration of chIL-17A treatment significantly increased the expression of key immunomodulatory genes. Our study also demonstrated that a two-dose nebulization regimen of chIL-17A potently activated innate immunity in the chicken respiratory tract, with distinct spatiotemporal dynamics. Although the aerosol droplets (5-10 μm) were deposited primarily in the middle and lower trachea, the lung tissue exhibited a more robust immune response (e.g., pulmonary MX1 peaked at 57.89-fold at 3 dpi). This may be attributed to the abundance of IL-17 receptor-expressing macrophages and dendritic cells in the lungs, the potential "tail effect" of smaller particles (<5 μm) reaching alveoli, and the superior permeability and vascularization of pulmonary tissue (Jin et al., 2024). The two-dose strategy was effective: the priming dose initiated early innate responses (rapid upregulation of IFN-α/β at 1 dpi), whereas the booster dose amplified and accelerated signalling via a memory-like mechanism (synergistic upregulation of MX1 and IL-6 at 3 dpi). Compared with classical adjuvants such as poly(I:C), which peak at 6 h and decrease by 24 h after a single injection, chIL-17A induced a more sustained (>5 days) and localized response (Song et al., 2019). This sequential expression pattern is biologically significant: early induction of antiviral proteins (e.g., MX1) mimics a natural defence state, potentially enhancing pathogen resistance, while the later surge of pulmonary IL-1β and IL-6 (suggesting NF-κB pathway involvement) provides critical signals for T-cell activation and Th17 differentiation(Zeng et al., 2016). These findings highlight the potential of chIL-17A as a mucosal vaccine adjuvant capable of skewing immunity toward the innate and non-Th1 pathways. In conclusion, two-dose nebulization of chIL-17A induces spatiotemporally regulated activation of innate immunity and synergistic adaptive responses, suggesting a novel strategy for developing avian mucosal vaccine adjuvants.

Conclusion

In summary, this study demonstrates that prokaryotically expressed recombinant chicken IL-17A (chIL-17A) is biologically active and potently stimulates innate immune responses in chicken cells and respiratory tissues. The dose- and time-dependent induction of proinflammatory cytokines, type I interferons, and interferon-stimulated genes highlights its role as a key immunomodulator. Nebulized chIL-17A activates robust and spatiotemporally regulated innate immunity in the chicken respiratory tract, with sustained effects particularly in the lower airways. These findings establish chIL-17A as a promising candidate for mucosal adjuvant development in poultry vaccination strategies.

This study has some limitations. First, the prokaryotic expression system lacks post-translational modifications (e.g., glycosylation) that may influence protein stability or receptor affinity in vivo. However, the observed bioactivity suggests that the conserved cystine-knot fold is sufficient for receptor engagement. Second, the exact cellular sources of the immune responses in vivo were not identified; future studies should use immunohistochemistry or flow cytometry to map IL-17RA-expressing cells in the respiratory tract. Third, the protective efficacy of chIL-17A against viral challenge (e.g., H9N2) remains to be tested. Future work should focus on evaluating chIL-17A as a mucosal adjuvant in combination with inactivated vaccines, and on optimizing delivery systems (e.g., nanoparticles) to prolong its retention in the respiratory tract. The implications of this study are twofold: it provides a cost-effective method for producing bioactive chIL-17A, and it opens new avenues for enhancing poultry immunity through cytokine-based immunomodulators.

Ethics statement

All experiments were conducted in accordance with the recommendations of the Animal Care and Use Committee of South China Agricultural University and Guangdong Animal Health Research Institute (YC-SPF2024031).

CRediT authorship contribution statement

Yaxin Wu: Writing – original draft, Validation, Methodology, Data curation. Zhouying Chi: Validation, Supervision, Methodology, Investigation. Tianxu Li: Validation, Methodology, Investigation. Zhicheng Liu: Supervision. Chunhong Zhang: Supervision. Haiyan Shen: Supervision. Minhua Sun: Supervision. Ming Liao: Writing – review & editing, Project administration, Funding acquisition, Conceptualization. Shouwen Du: Writing – review & editing, Writing – original draft, Project administration, Methodology, Investigation, Funding acquisition, Conceptualization.

Disclosures

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.