Skip to main content
Poultry Science logoLink to Poultry Science
. 2026 Mar 14;105(7):106629. doi: 10.1016/j.psj.2026.106629

Dietary allicin supplementation inhibits hepatic CYP3A37 in chickens: Evidence from in vitro and in vivo models

Yanyan Li a,1, Heling Yuan b,1, Jing Wang a, Shaojie Yin a, Xiaohan Qiu a, Haifeng Yang a,
PMCID: PMC13087769  PMID: 41931865

Abstract

Allicin, a natural compound with antibacterial and antioxidant properties, is a promising antibiotic-alternative feed additive. This study investigated its impact on cytochrome P450 3A37 (CYP3A37) in broilers. Broilers were fed a basal diet supplemented with 0, 40, or 80 mg/kg allicin for 42 days. In vivo results revealed a biphasic effect: CYP3A37 activity was induced on day 14 but significantly inhibited on days 28 and 42. This inhibition was accompanied by downregulation of CYP3A37 mRNA and protein expression. Consequently, allicin (80 mg/kg) altered the pharmacokinetics of the CYP3A37 substrate dapsone, increasing its AUC and decreasing its clearance. In vitro assays demonstrated that allicin acts as a non-competitive inhibitor of CYP3A37 with an IC50 of 57.31 μM and a Kᵢ of 85.53 μM, in a time- and concentration-dependent manner. In conclusion, long-term allicin supplementation inhibits CYP3A37, posing a potential risk for drug-drug interactions in veterinary practice.

Keywords: Allicin, CYP3A37, Inhibition, Enzyme kinetics, Interaction

Introduction

Cytochrome P450 (CYP450) enzymes are a family of mixed-function oxidoreductases primarily expressed in the liver of humans and animals. They play a critical role in the phase I biotransformation of various xenobiotic compounds. As previously reported (Huang et al., 2014; Magliocco, et al., 2019), the activity and/or expression of CYP450 enzymes can be inhibited or induced by numerous extrinsic and intrinsic factors. Such modulation can alter the plasma concentrations of their substrate drugs, potentially leading to adverse drug-drug interactions (DDIs). For instance, the compound Danshen Dripping Pill (CDDP) has been shown to diminish the metabolism of Azilsartan (AZ) in vivo by suppressing the expression of CYP1B2, CYP2C6, and CYP2C11 enzymes (Meng, et al., 2021). Therefore, evaluating the potential of new drug candidates to inhibit or induce key CYP450 enzyme is essential.

The CYP450 family includes major isoforms such as CYP1A2, CYP2B6, CYP2C9, CYP2D6 and CYP3A4. Among these, CYP3A4 is the most prominent and abundant isoform in the human liver, responsible for metabolizing approximately 50 % of clinically used drugs (Patoine, et al., 2014; Zanger and Schwab, 2013). In veterinary species such as poultry, CYP3A37 serves as the functional homolog of CYP3A4. It plays a key role in metabolizing several veterinary commonly used agents, including enrofloxacin and ionophore anticoccidials, and so on (Zhang, et al., 2022; Zhou, 2008). Clinically significant DDIs mediated by CYP3A37 inhibition have been documented, particularly for drugs with a narrow therapeutic window (Wang, et al., 2020). A notable example is the increased toxicity of maduramicin in broilers when co-administrated with tilmicosin, due to inhibition of CYP3A37-medicated metabolism (Zhang, Wang, Wang, Badawy, Liu, Xie, Wang and Tao, 2022). Given that such interactions can critically compromise treatment efficacy and safety, it is of great significance to investigate the effects of new drugs or exogenous compounds on the CYP3A37 activity in animals.

In response to the global challenge of antibiotic resistance, governments and the World Organization for Animal Health (WOAH) have encouraged the development of antibiotic alternatives for use as feed additives (Xu, et al., 2021). Allicin, the principal bioactive component of galic produced upon tissue damage from the alliin in a reaction that is catalyzed by the enzyme alliinase (Borlinghaus, et al., 2014), is known for a wide range of pharmacological activities, such as antibacterial (Huang, et al., 2022), antiviral (Mosbauer, et al., 2021), antioxidant (Chan, et al., 2013), anticancer activities (Catanzaro, et al., 2022), and prevention of cardiovascular diseases among others (Sanchez-Gloria, et al., 2022; Xu, et al., 2023). In addition, allicin supplemented in the dietary of laying breeder hens and weanling piglets had a positive effect on their immunity, and their offspring showed better immunity and growth performance in early life (Gong, et al., 2020; Huang, et al., 2011). Our previous studies have further demonstrated its efficacy in alleviating CCl4-induced acute liver injury in mice via the modulation of oxidative stress, inflammation, and apoptosis associated with progress of liver damage. Allicin attenuated liver oxidative stress and the incidence of fatty liver of broiler chickens if the dietary supplemented with allicin (data to be published). These multi-target properties suggest that allicin is a strong candidate to replace antibiotics. Several studies also support its viability as a functional feed additive (Robyn, et al., 2013; Rossi, et al., 2020; Wang, et al., 2017, 2023). Despite this promise, its potential to interact with CYP450, a critical determinant of drug metabolism and interaction, has not been evaluated. Given this context, the present study explores the impact of allicin on CYP3A37 expression and enzyme kinetics in chickens through both in vivo and in vitro models. These investigations are essential for assessing the risk of metabolic DDIs, ensuring the efficacy and safety of veterinary therapeutics, guiding the rational use of feed additives in commercial poultry production, and ultimately contributing to a systematic framework for the safety assessment of feed additives.

Materials and methods

Chemicals and reagents

Allicin and alliinase (potential allicin content: 1.603 %) were obtained from Ailexin Drug Company (Xinjiang, China). Midazolam, 1-OH midazolam, Dapsone (purity>98.0 %) were purchased from Shanghai Amp Experimental Technology Co., Ltd (Shanghai, China). Antipyrine (purity>98.0 %), which severed as the internal standard, was acquired from Beijing Solarbio Technology Co., Ltd (Beijing, China). Nicotinamide adenine dinucleotide phosphate (NADPH) was purchased from Shanghai Yuanye Biotechnology Co., Ltd (Shanghai, China). UPLC-grade acetonitrile was supplied by Nanjing Juyou Scientific Equipment Co., Ltd (Nanjing, China), and ultra-pure water was prepared using a Millipore Milli-Q purification system (Bedford, MA, USA). For molecular biology assays, the reverse transcription kit and SYBR-Green were purchased from Takara (Tokyo, Japan). The primary antibodies use was as follows: anti-GAPDH from Yeasen Biotechnology Co., Ltd (Shanghai, China, Catalog #: AM4300) and anti-CYP3A4 polyclonal antibody from Bioss (Beijing, China, Catalog #:PA5-14896). Chicken liver microsomes (CLMs) were prepared in our laboratory. All other chemicals were of analytical grade and obtained from commercial suppliers.

In vivo test

Animals and experimental design

One-day-old Arbor Acres (AA) broilers were obtained from a local commercial poultry farm (Nanjing, Jiangsu, China). Upon arrival, the birds were housed in the laboratory animal facility of Nanjing Agricultural University and acclimatized for 4 days with free access to a basal diet (without additives) and water. After the acclimatization period, the broilers were randomly allocated into three groups: Group Ⅰ (control) received the basal diet and water; Group Ⅱ and III were administered allicin at 40 mg·kg-1 b.w and 80 mg·kg-1 b.w via dietary supplementation, respectively. To ensure uniform distribution and accurate dosing of allicin in the feed, a standardized preparation protocol was employed. A high-concentration premix was first prepared by stepwise geometric dilution of precisely weighed allicin with a small portion of basal feed powder. This premix was then thoroughly blended with the remaining basal feed in a three-dimensional mixer (mixing time ≥ 20 min). For administration, animals underwent overnight feed restriction and received the allicin-containing feed at a fixed time the following morning, after which normal diet was restored upon complete consumption. All broilers were raised under recommended temperature and humidity conditions with ad libitum access to feed and water for 42 days.

On days 14-, 28-, and 42-day, liver samples were collected from a subset of broilers in each group to assess enzyme activity, mRNA expression, and protein expression. The remaining broilers on day 28 were used for pharmacokinetics studies. The experimental design is illustrated in Fig. 1. This study was approved by the Animal Ethics Committee of Nanjing Agricultural University (Approved No.: NJAU.NO20211130184), China. All procedures were conducted in strict compliance with the State Regulations for the Administration of Experimental Animals.

Fig. 1.

Fig 1 dummy alt text

Flowchart for Animal Experimental Design.

Determination of liver microsomes CYP3A37 enzyme activity

Liver microsomes were isolated from broilers (n = 6 per group) on days 14, 28, and 42 by ultracentrifugation (Yan, et al., 2021). The total protein concentrations of the liver microsomal preparations was determined using a BCA Protein Quantification Kit (Vazyme, Nanjing, China). Midazolam (10 μM) was used as the specific probe substrate of CYP3A37. The incubation mixtures, with a total volume of 250 μL, contained liver microsomes (0.8 mg/mL), 50 mM Tris-HCL buffer (pH=7.4) and the probe substrate. After a 5-minute pre-incubation at 41°C, the reaction was initiated by adding 1 mM NADPH and allowed to proceed for 30 min. The reaction was terminated by placeing the tubes on ice and added 55 μL of ice-cold acetonitrile. The mixtures were then centrifuged at 12,000 r/min for 15 min. The resulting supernatant was passed through a 0.22 μm membrane filter, and a 20 μL aliquot was injected into the HPLC system for analysis.

Chromatographic separation was performed on an Agilent C18 column (5 μm, 4.6 × 250 mm) maintained at 35°C. The mobile phase, consisting of acetonitrile and 50 mM diamine hydrogen phosphate (45:55, v/v), was delivered at a flow rate of 1.0 mL/min. The detection wavelength was set at 254 nm. A calibration curve was constructed using blank liver microsomes spiked with six different concentrations of 1-OH midazolam (the metabolite of midazolam), ranging from 2 to 20 mg/L. The curve demonstrated excellent linearity with a correlation coefficient (r) greater than 0.999. The limits of detection (LOD) and quantification (LOQ) for 1-OH midazolam were 1 mg/L and 2 mg/L, respectively. The recovery rates at three quality control levels (4, 8, and 15 mg/L) ranged from 94.91 % to 112.11 %. The CYP3A37 enzyme activity was quantified based on the production rate of 1-OH midazolam.

Analysis of CYP3A37 mRNA expression by real time RT-PCR

Hepatic mRNA expression levels of CYP3A37 were determined in broilers (n = 6 per group) on the 14th, 28th and 42nd days using real time RT-PCR, respectively. Total RNA was extracted from liver tissue samples with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The concentrations of the extracted RNA were determined using a Nanodrop spectrophotometer (Wilmington, DE, USA, and samples with an A260/A280 ratio greater than 1.8 were deemed suitable for subsequent analysis. RNA integrity was further verified by 1 % agarose gel electrophoresis and ethidium bromide staining. According to the instructions of the reverse transcription kit, qualified total RNA was reverse transcribed into complementary DNA (cDNA). The synthesized cDNA was stored at −20°C until analysis. The primer sequences for the target gene (CYP3A37) and the reference gene (β-actin) were designed using Primer Premier 5.0 software (listed in Table 1) and synthesized by Qingke Biotechnology Co., Ltd. (Nanjing, China). The quantification of chicken CYP3A37 mRNA was performed using a SYBR Green kit (Toyobo, Osaka, Japan) on a Bio-Rad real-time PCR detection system (Hercules, CA, USA). The relative mRNA expression levels were calculated using the 2^(–ΔΔCt) method.

Table 1.

Primer sequences used in real time RT-PCR.

Genes Sequence (5′−3′)
β-actin F:TTGGCGCTTGACTCAGGATT
R:TAGAACTTTGGGGGCGTTCG
CYP3A37 F:CGAATCCCAGAAATCAGA
R:AGCCAGGTAACCAAGTGT

Detection of CYP3A37 protein expression by Western blot

Hepatic protein expression levels of CYP3A37 in broilers (n = 6 per group) were analyzed on days 14, 28, and 42 by Western blot. Total protein was extracted from liver tissue samples using RIPA lysis buffer (Yeasen, Shanghai, China) according to the manufacturer's instructions. Protein concentrations were determined using a BCA Protein Quantification Kit (Vazyme, Nanjing, China). Equal amounts of protein were separated by 12 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) at 120 V for 1 h. Subsequently, the separated proteins were electrophoretically transferred onto a 0.45 μm polyvinylidene difluoride (PVDF) membrane (Bio-Rad, USA) at 200 mA for 1.5 h. The membrane was then blocked with 5 % non-fat dry milk in PBST (0.1 % Tween-20) for 2 hours at room temperature. After blocking, it was incubated overnight at 4°C with a primary CYP3A4 polyclonal antibody (Bioss, China) at a dilution of 1:1,000. Following this, the membrane was washed three times (15 minutes each) with 0.1 % PBST and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody at a dilution of 1:5,000 for 1 hour at room temperature. After a final series of washes, the target protein bands were visualized using an ECL Western Blotting Detection Reagent kit as per the manufacturer's protocol. The relative protein levels were quantified by densitometric analysis using a Digital Science Imaging System (Version 2.0.1, Eastman Kodak Co., USA) and the ImageJ software (National Institutes of Health, USA).

Pharmacokinetic analysis of dapsone in broilers

A total of twenty-four 28-day-old broilers were allocated into 3 groups (8 birds/group) to investigate the effect of allicin-induced modulation of CYP3A37 expression on the pharmacokinetics of the probe drug dapsone. Group I (control) received a single oral dose of dapsone (10 mg/kg b.w.). Groups II and III were orally administered allicin at 40 mg/kg b.w. and 80 mg/kg b.w., respectively, for 28 consecutive days, followed by a single oral dose of dapsone (10 mg/kg b.w.). Blood samples were collected from the wing vein into heparin-coated tubes from all groups before dapsone administration (0 h) and at each time point of 0.083, 0.167, 0.333, 0.667, 1, 1.5, 2, 3, 4, 6, 8, 10, 12, 24 h post-dosing of dapsone. Plasma was rapidly harvested by centrifugation at 3000 rpm for 10 min and stored at −80°C until subsequent analysis. The experimental design is outlined in Fig. 1.

Quantification of dapsone in plasma by HPLC

The extraction and HPLC procedures were described (Zhang, et al., 2011) with slight modification. In brief, all plasma samples were analyzed on Thermo Fisher U3000 HPLC system. For sample preparation, 100 μL of plasma was spiked with 20 μL of antipyrine (15 mg/L) as the internal standard (IS). The mixture was then extracted with 1 mL of a chloroform/2-propanol (9:1, v/v) solution by vortexing for 2 minutes, followed by centrifugation at 5,000 rpm for 10 min. An 850 μL aliquot of the organic supernatant was transferred and evaporated to dryness under a gentle stream of nitrogen. The residue was reconstituted in 200 μL of the HPLC mobile phase, and a 60 μL aliquot was injected into the system for analysis. Chromatographic separation was achieved on an Agilent C18 column (5 μm, 4.6 × 250 mm) maintained at 28°C. The mobile phase, consisting of acetonitrile and 20 mmol/L ammonium acetate (30:70, v/v), was delivered isocratically at a flow rate of 1.0 mL/min. Detection was performed at a wavelength of 265 nm.

A seven-point calibration curve was constructed in blank plasma over the concentration range of 0.2 to 10 mg/L and demonstrated excellent linearity (r > 0.999). The limit of detection (LOD) and limit of quantification (LOQ) for dapsone were 0.05 mg/L and 0.20 mg/L, respectively. The recovery rates of dapsone at quality control concentrations (0.5, 2.0, and 7.5 mg/L) ranged from 96.21 % to 107.62 %. Pharmacokinetic parameters were calculated for each individual animal using 3P97 software (China).

In vitro test

Determination of the half-maximal inhibitory concentration (IC50) of ketoconazole and allicin on CYP3A37 enzyme

The inhibitory effects of ketoconazole and allicin on CYP3A37 enzyme activity were assessed by determining their respective half-maximal inhibitory concentration (IC50) values using HPLC. The incubation system, with a total volume of 250 μL, contained chicken liver microsomes (0.8 mg/mL), 10 μM midazolam (a CYP3A37 probe substrate), 50 mM Tris-HCl buffer (pH 7.4), and a series of concentrations of either ketoconazole (0.25, 0.50, 1.0, 2.0, 2.5, 5.0, and 10 μM) or allicin (2.5, 10, 25, 50, 100, and 200 μM). The incubation, termination, and sample pretreatment procedures were identical to those described in 2.2.3. The enzyme activity was expressed as the relative metabolic rate of midazolam, caculated as the ratio of 1-OH midazolam production in the inhibitor-containing experimental group to that in the inhibitor-free blank control group.

Detection of the inhibition constant (Ki) of ketoconazole and allicin on CYP3A37 enzyme

The inhibition constant (Ki) of ketoconazole and alllicin against CYP3A37 was determined by HPLC. The incubation mixture (250 μL total volume) contained liver microsomes (0.80 mg/mL), 50 mM Tris-HCL buffer (pH 7.4), midazolam (at concentrations of 2.5, 5.0, 10, 25 and 50 μM) and a series concentration of either ketoconazole (0.25, 2.0 and 5.0 μM) or allicin (20, 40 and 80 μM). Incubation and sample pretreatment were performed as described in 2.2.3. Enzyme kinetics parameters for the midazolam hydroxylation rezction were derived from the Lineweaver-Burk plot, which represents a linear regression of the inverse substrate concentration (1/[S]) versus the inverse reaction velocity (1/V). The maximum reaction velocity (Vmax) and Michaelis constant (Km) were calculated from the mean values, and the inhibition constant (Ki) was determined based on the pattern of the regression lines.

Effects of allicin on CYP3A37 inhibition with a time- and concentration-dependence

A time-dependent inhibition study was conducted to evaluate the effects of incubation time and allicin concentration on CYP3A37 activity. The incubation and sample pretreatment procedures followed the method described in section 2.2.3. The reaction systems contained a serial of allicin concentrations (20, 40, and 80 μM) and were preincubated for varying durations (0, 15, 45 and 60 min). The results were expressed as the relative metabolism rate of midazolam, calculated as the ratio of 1-OH midazolam in the allicin-treated experimental group to that in the untreated blank control group.

Statistical analysis

There were three replications of the entire experiment to ensure the reproducibility in the research. The IC50 values and Ki values were calculated using GraphPad version 8 software (GraphPad Software Inc., San Diego, CA, USA). All statistical significance of differences were performed using one-way analysis of variance (GraphPad Prism 8). P < 0.05 was considered significant, P < 0.01 and P < 0.001 were considered extremely significant.

Results

Allicin exhibits a biphasic effect on hepatic CYP3A37 activity in broilers

The effect of allicin on hepatic microsomal CYP3A37 enzyme activity was assessed by measuring the formation of the midazolam metabolite, 1-hydroxymidazolam (1-OH midazolam). As showed in Fig. 2, administration of allicin at 40 mg/kg and 80 mg/kg via dietary supplementation for 14 days significantly induced the liver microsomes CYP37A activity. The production of 1-OH midazolam increased by 1.8- (P < 0.001) and 1.2-fold (P < 0.01), respectively, compared with the control group. In contrast, after 28 and 42 days of treatment with the same doses, CYP37A activity was significantly inhibited, the formation of 1-OH midazolam reduced to approximately 80 % and 90 % of the control levels, respectively (P < 0.001). These results indicated that allicin exerts a time dependent biphasicly affected CYP3A37 enzyme activity in broilers, showing initial induction followed by inhibition.

Fig. 2.

Fig 2 dummy alt text

The Effect of Allicin Feeding for Different Time on the Activity of CYP3A37 Enzyme in Liver Tissues of Broilers (n = 5). Data showed as mean ± SEM; **P < 0.01, ***P < 0.001.

Allicin downregulated mRNA and protein expression of CYP3A37 in broilers in a time- dependent manner

The effects of allicin (40 and 80 mg/kg) on hepatic CYP3A37 protein and mRNA expression in broilers at different ages (14, 28 and 42 days) are shown in Fig. 3A and 3B, respectively. No significant changes in CYP3A37 mRNA or protein expression were observed on day 14 compared with the control group (P>0.05). However, prolonged administration of allicin led to a significant downregulation. On day 28, CYP3A37 mRNA expression reduced to 70 % of the control level (P < 0.05), while protein expression was reduced to 60 % (P < 0.01). By day 42, the inhibitory effect was more pronounced: mRNA expression declined to 50 % of the control (P < 0.05), and protein expression was further suppressed to 60 % and 40 % of the control in the 40 and 80 mg/kg groups, respectively (P < 0.01). The overall tread in protein expression was consistent with that of mRNA. These results clearly demonstrate that long-term administration of allicin significantly inhibited both the transcription and translation of CYP3A37 in the liver of broilers.

Fig. 3.

Fig 3 dummy alt text

The Effect of Allicin Feeding for Different Time on The Expression of CYP3A37 Protein and mRNA in Liver Tissues of Broilers (n = 6). Data showed as mean ± SEM; *P < 0.05, **P < 0.

Allicin alters dapsone pharmacokinetics in broilers

The mean plasma concentration-time profiles of dapsone in broilers following oral administration of allicin (40 and 80 mg/kg) and in the control group are shown in Fig. 4, with the corresponding pharmacokinetic parameters detailed in Table 2. As shown in Fig. 4 and Table 2, allicin co-administration significantly influenced the pharmacokinetics of dapsone. The high dose of allicin (80 mg/kg) increased the area under the curve (AUC0∼∞) of dapsone from 12.88 to 7.92 (h·mg/L) (P < 0.05). Furthermore, both 40 mg/kg and 80 mg/kg allicin treatments significantly decreased the systemic clearance (CLz) of dapsone from 1.70 L/h/kg in the control to 0.91, and 0.96 L/h/kg, respectively(P < 0.05). These results indicate that the allicin- induced down-regulation of CYP3A37 enzyme activity can significantly alter the pharmacokinetic behavior of dapsone in healthy broilers.

Fig. 4.

Fig 4 dummy alt text

Pharmacokinetics Curves of Dapsone in Chicken Plasma after Treatment with Allicin (n = 8). Data showed as mean±SEM.

Table 2.

Pharmacokinetic parameters of dapsone orally administered in broilers on 28th Day (mean ± SEM, n = 8).

Paramaters (Unit) Control Allicin (40mg/kg) Allicin (80mg/kg)
AUC0∼24h (h·mg/L) 7.18 ± 1.07 8.87 ± 0.70 9.64 ± 1.54
AUC0∼∞ (h·mg/L) 7.92 ± 1.03 10.90 ± 1.14 12.88 ± 1.35*
MRT0∼24h (h) 2.20 ± 0.15 2.42 ± 0.12 2.34 ± 0.24
MRT0∼∞ (h) 2.73 ± 0.24 2.88 ± 0.14 2.87 ± 0.25
Cmax (mg/L) 2.83 ± 0.53 3.40 ± 0.30 3.57 ± 0.63
Tmax (h) 0.60 ± 0.10 0.77 ± 0.14 0.88 ± 0.18
CLz (L/h) 1.70 ± 0.26 0.91 ± 0.07* 0.96 ± 0.15*
Vz (L) 3.12 ± 0.58 2.50 ± 0.40 2.39 ± 0.35
t1/2 (h) 1.67 ± 0.10 1.77 ± 0.26 1.70 ± 0.16

*P < 0.05, compared with control.

AUC0∼24h and AUC0∼∞: area under the plasma concentration-time curves; MRT: mean retation time; Cmax: maximal plasma concentration; Tmax: time to obtain Cmax; CLz: apparent clearance; Vz: apparent volume of distribution; t1/2: elimination half-life.

IC50 of allicin on CYP3A37

The inhibition curves of CYP3A37 by ketoconazole and allicin were fitted (Fig. 5A and 5B, respectively). Ketoconazole exhibited potent, dose-dependent inhibition of CYP3A37, with a calculated IC50 value of 2.85 μM. This result is consistent with its known profile as a strong CYP3A37 inhibitor, validating the reliability of the experimental system. Under identical assay conditions, allicin also inhibited CYP3A37 activity in a dose-dependent manner, with a calculated IC50 value of 57.31 μM.

Fig. 5.

Fig 5 dummy alt text

Inhibition Curves of Ketoconazole (A) and Allicin (B) on CYP3A37 Activities Using Probe Substrates in CLMs (n = 3). Data showed as mean±SEM.

Enzyme kinetics of midazolam and inhibition mechanisms of allicin

Enzyme kinetic and inhibition parameters for midazolam metabolism in chicken liver microsomes were systematically characterized. The formation of 1-hydroxymidazolam followed classic Michaelis-Menten kinetics (Fig. 6A), with a Km of 3.92 ± 0.28 μM and a Vmax of 1.31 ± 0.03 nmol/min/mg protein. Analysis of Lineweaver-Burk plots (Fig. 6B) indicated that ketoconazole acted as a mixed-competitive inhibitor of CYP3A37, with an inhibition constant (Ki) of 4.77 μM (Fig. 6C). In contrast, allicin exhibited a non-competitive inhibition pattern, with a Ki value of 85.53 μM (Fig. 6D and 6E).

Fig. 6.

Fig 6 dummy alt text

Inhibition Kinetic Study of Ketoconazole and Allicin on Midazolam in Chicken Liver Microsomes (n = 3). (A) Michaelis-Menten plot analysis of midazolam activity in chicken liver microsomes. Lineweaver-Burk plot analysis of inhibition kinetics of ketoconazole (B) and allicin (D) on midazolam in chicken liver microsomes. The Ki transformation plot of inhibition kinetics of ketoconazole (C) and allicin (E) on midazolam in chicken liver microsomes. Data showed as mean±SEM.

Allicin inhibition on CYP3A37 with a time- and concentration-dependent manner

The effects of incubation time and allicin concentration on CYP3A37 inhibition are shown in Fig. 7. CYP3A37 activity decreased significantly with prolonged incubation time (P < 0.05, Fig. 7A), demonstrating a time-dependent inhibitory effect. Similarly, enzyme activity was significantly suppressed with increasing allicin concentrations (P < 0.01, Fig. 7B), indicating clear concentration-dependence.

Fig. 7.

Fig 7 dummy alt text

Effect of Allicin on CYP3A37 Inhibition in Chickens at Different Treatment Times (A) and Concentrations (B) (n = 3). The amount of 1-OH midazolam produced as a percentage of the control represents the remaining CYP3A37 enzyme activity. Data showed as mean±SEM. *P < 0.05; **P < 0.01; ***P < 0.001.

Disussion

The use of natural products as antibiotics alternatives in liverstock and poultry production has gained considerable interest due to their potential to enhance growth and prevent diseases. However, the ability of these compounds to modulate CYP450 expression or activity raise important safety concerns, as such alterations can lead to complex drug-drug interactions (DDIs) and serious adverse effects. For instance, piperine and quercetin have been reported to inhibit CYP450 activity, disrupting the metabolism of co-administered fluroquinolones and potentially causing toxicity or even mortality in broilers (Patel, et al., 2021). Furthermore, several natural compounds, including naringin (Choi and Kang, 2008), grapefruit (Guttman, et al., 2020), and quercetin (Yim, et al., 2020), are known to be potent inhibitors of CYP3A37. It is noteworthy that inhibition-mediated DDIs carry greater clinical significance than those induced by enzyme induction, accounting for approximately 70 % and 23 % of such interaction, respectively (Wienkers and Heath, 2005). Therefore, in addition to efficacy evaluation, the safety assessment of natural feed additives must include a thorough investigation of their effects on hepatic drug-metabolizing enzymes. Based on thees considerations, this study represents the first comprehensive evaluation of the impact of allicin, the active ingredient in garlic powder, on the activity and expression of the CYP3A37 enzyme in broilers, using both in vivo and in vitro models.

Allicin is known for its chemical instability owing to its reactive sulfoxide and allyl groups, decomposing within hours under ambient conditions (Li, et al., 2022). To overcome this limitation, we utilized a stabilized garlic powder formulation containing alliin and alliinase, which releases active allicin in vivo to exert its therapeutic effects (Maitisha, et al., 2021). Using the substrate probe method, we evaluated the effect of allicin on CYP3A37 activity in chicken liver microsomes in vivo. Notably, CYP3A37 activity was significantly induced on day 14 in the allicin-treated groups compared to the control, but was markedly suppressed on day 28 and 42. Further analysis revealed that the mRNA and protein expression levels of CYP3A37 followed a similar trend, consistent with the observed enzyme activity at the later time points, though no significant changes were detected at day 14. These results suggest that allicin exerts a biphasic regulatory effect on hepatic CYP3A37 in chickens, characterized by initial induction followed by inhibition. Similar biphasic phenomena have been reported for other natural compounds. For example, quercetin and naringenin modulate CYP1A2 activity in a concentration-dependent manner, exhibiting either inhibitory or stimulatory effects on MeIQ metabolism (Kang, et al., 2004). In contrast, an aqueous extract of Schisandra chinensis was shown to induce a reverse biphasic effect on hepatic CYP3A, beginning with inhibition and followed by induction (Lai, et al., 2009). These examples illustrate that herb-drug or natural product interactions are often complex and context-dependent. Therefore, further investigation is warranted to elucidate the molecular mechanisms underlying the biphaic modulation of CYP3A37 by allicin.

Modulation of CYP450 or P-gp activity by herbals or natural products can significantly influence the absorption and bioavailability of their substrate drugs (Zhang, et al., 2016). In this study, we further investigated the effect of allicin on the pharmacokinetics of dapsone, a known CYP3A37 probe substrate (Su, et al., 2013), in broilers by a cocktail-substrate approach. Our results demonstrated that pretreatment with allicin significantly increased the plasma concentration of dapsone and reduced its clearance, indicating that allicin may elicit herb-drug interaction (HDIs) when administrated concurrently with conventional antimicrobials in poultry. This finding is consistent with previous reports on other natural compounds. For instance, glycyrrhizin was shown to reduce the plasma concentration of paeoniflorin by inducing the activity of P-gp and CYP450 enzymes (Sun, et al., 2019). Conversely, several natural compounds like piperie, quercetin, genistein, naringin, sinomenine, glycyrrhizin and nitrile glycoside have been found to enhance the bioavailability of co-administered drugs by inhibiting drug efflux pumps or oxidative metabolism (Lee, et al., 2018; Patel, Patel, Mathapati and Modi, 2021; Wang, et al., 2018). While inhibiting CYP450 can be a useful strategy to improve the plasma exposure of poorly permeable drugs, it also carries the risk of undesired side-effects, particularly for drugs with a narrow margin of safety (Chua, et al., 2015; Ma and Ma, 2016). Therefore, special attention is warranted when substrates of CYP3A37 are coadministered with its inhibitors or inducers in veterinary practice.

In vitro inhibition data are widely recognized as valuable tools for predicting the magnitude of clinical drug-drug interactions (Obach, et al., 2006). Our in vivo findings indicated that long-term administration of allicin significantly inhibits CYP3A37 activity. To further characterize this interaction, we optimized a probe-substrate method and conducted enzyme kinetic studies to determine the inhibition type of allicin on CYP3A37. Although enzyme kinetic parameters such as Km and Vmax for chicken CYP3A37 have been reported in only a limited number of studies, the Km value obtained in our study aligns with previously published results (Cortright and Craigmill, 2006). The slightly higher midazolam metabolic activity observed here may be attributed to differences in microsomal protein or substrate concentrations. Ketoconazole, a potent CYP3A37 inhibitor, strongly suppressed midazolam metabolism in chicken liver microsomes, with an IC₅₀ of 2.85 μM and a Ki of 4.77 μM. Lineweaver–Burk analysis indicated a mixed competitive-noncompetitive inhibition mechanism. These results are consistent with earlier reports (Novotna, et al., 2014), supporting the reliability of our in vitro incubation system. Under the same experimental conditions, allicin exhibited non-competitive inhibition of CYP3A37, with IC₅₀ and Ki values of 57.31 μM and 85.53 μM, respectively. This suggests that allicin binds to a site distinct from the substrate-binding pocket, reducing the apparent Vmax without affecting Km. The precise inhibitory mechanism, however, warrants further investigation.

In addition to reversible inhibition, CYP450 enzymes can also be subject to irreversible inhibition via covalent modification. Our results indicate that allicin induces time- and concentration-dependent irreversible inhibition of CYP3A37, likely through metabolic activation to a reactive intermediate that inactivates the enzyme (Stresser, et al., 2014). As enzyme activity can only be restored through de novo synthesis, such time-dependent inhibition raises concerns for potential drug-drug interactions. Therefore, co-administration of allicin with CYP3A37 substrates may lead to clinically significant interactions and an increased risk of idiosyncratic toxicity.

While this work provides novel insights, certain limitations must be considered when interpreting the results. The scope was intentionally focused on CYP3A37 due to its clinical significance; however, the impact of allicin on other pharmacologically relevant isoforms (e.g., CYP1A, CYP2C) remains unknown and warrants future investigation. Furthermore, our experimental design captured a snapshot of gene and protein expression, and a multi-time-point dynamic study would be valuable to elucidate the complete temporal profile of induction or inhibition. Additionally, the hepatocyte culture concentrations were selected to establish a clear dose-response relationship, and their direct physiological relevance to in vivo hepatic exposure following dietary intake requires further pharmacokinetic confirmation.

Conclusions

In summary, the present study demonstrates that allicin exerts a biphasic regulatory effect on hepatic CYP3A37 in broilers, characterized by initial induction followed by sustained inhibition. This inhibition occurs in a non-competitive, time- and concentration-dependent manner, accompanied by downregulation of CYP3A37 mRNA and protein expression. As a result, allicin significantly reduces the metabolic clearance of the CYP3A37 substrate dapsone, leading to elevated systemic exposure. These findings highlight the potential for clinically significant drug-drug interactions when allicin is co-administered with other CYP3A37-metabolized drugs in poultry, underscoring the importance of considering such interactions in veterinary therapeutic practice and feed safety evaluation.

Funding

This work was supported by grants from the Taizhou Social Development Project (TSL202522), Major Basic Research Project of the Natural Science Foundation of the Jiangsu Higher Education Institutions (24KJA230001), and Jiangsu Provincial Vice President of Science and Technology (FZ20250796).

Institutional review board statement

This study was approved by the Animal Ethics Committee of Nanjing Agricultural University (Approved No.: NJAU.NO20211130184), China. All procedures were conducted in strict compliance with the State Regulations for the Administration of Experimental Animals.

Informed consent statement

Not applicable.

Data availability statement

Not applicable.

CRediT authorship contribution statement

Yanyan Li: Writing – original draft, Methodology, Formal analysis, Data curation, Conceptualization. Heling Yuan: Writing – original draft, Project administration, Methodology, Investigation, Data curation. Jing Wang: Writing – review & editing, Investigation, Formal analysis, Data curation. Shaojie Yin: Writing – review & editing, Project administration, Formal analysis. Xiaohan Qiu: Writing – review & editing, Visualization, Data curation. Haifeng Yang: Writing – review & editing, Supervision, Funding acquisition, Conceptualization.

Disclosures

The authors declare that they have no competing financial or non-financial interests.

Footnotes

Scientific section :Metabolism and Nutrition;

References

  1. Borlinghaus J., Albrecht F., Gruhlke M.C., Nwachukwu I.D., Slusarenko A.J. Allicin: chemistry and biological properties. Molecules. 2014;19:12591–12618. doi: 10.3390/molecules190812591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Catanzaro E., Canistro D., Pellicioni V., Vivarelli F., Fimognari C. Anticancer potential of allicin: a review. Pharmacol. Res. 2022;177 doi: 10.1016/j.phrs.2022.106118. [DOI] [PubMed] [Google Scholar]
  3. Chan J.Y., Yuen A..C., Chan R.Y., Chan S.W. A review of the cardiovascular benefits and antioxidant properties of allicin. PhytOther Res. 2013;27:637–646. doi: 10.1002/ptr.4796. [DOI] [PubMed] [Google Scholar]
  4. Choi J.S., Kang K.W. Enhanced tamoxifen bioavailability after oral administration of tamoxifen in rats pretreated with naringin. Arch. Pharm. Res. 2008;31:1631–1636. doi: 10.1007/s12272-001-2161-7. [DOI] [PubMed] [Google Scholar]
  5. Chua Y.T., Ang X..L., Zhong X.M., Khoo K.S. Interaction between warfarin and Chinese herbal medicines. Singap Med J. 2015;56:11–18. doi: 10.11622/smedj.2015004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cortright K.A., Craigmill A.L. Cytochrome P450-dependent metabolism of midazolam in hepatic microsomes from chickens, turkeys, pheasant and bobwhite quail. J. Vet. Pharmacol. Ther. 2006;29:469–476. doi: 10.1111/j.1365-2885.2006.00793.x. [DOI] [PubMed] [Google Scholar]
  7. Gong H.Z., Lang W..Y., Lan H.N., Fan Y.Y., Wang T.P., Chu Q.R., Wang J.H., Li D., Zheng X., Wu M. Effects of laying breeder hens dietary beta-carotene, curcumin, allicin, and sodium butyrate supplementation on the jejunal microbiota and immune response of their offspring chicks. Poult. Sci. 2020;99:3807–3816. doi: 10.1016/j.psj.2020.03.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Guttman Y., Yedidia I., Nudel A., Zhmykhova Y., Kerem Z., Carmi N. New grapefruit cultivars exhibit low cytochrome P4503A4-inhibition activity. Food Chem. Toxicol. 2020;137 doi: 10.1016/j.fct.2020.111135. [DOI] [PubMed] [Google Scholar]
  9. Huang L., Jia S., Wu R., Chen Y., Ding S., Dai C., He R. The structure, antioxidant and antibacterial properties of thiol-modified soy protein isolate induced by allicin. Food Chem. 2022;396 doi: 10.1016/j.foodchem.2022.133713. [DOI] [PubMed] [Google Scholar]
  10. Huang R.H., Qiu X..S., Shi F.X., Hughes C.L., Lu Z.F., Zhu W.Y. Effects of dietary allicin on health and growth performance of weanling piglets and reduction in attractiveness of faeces to flies. Animal. 2011;5:304–311. doi: 10.1017/S1751731110001953. [DOI] [PubMed] [Google Scholar]
  11. Huang Y., Zheng S.L., Zhu H.Y., Xu Z.S., Xu R.A. Effects of aescin on cytochrome P450 enzymes in rats. J. Ethnopharmacol. 2014;151:583–590. doi: 10.1016/j.jep.2013.11.016. [DOI] [PubMed] [Google Scholar]
  12. Kang I.H., Kim H..J., Oh H., Park Y.I., Dong M.S. Biphasic effects of the flavonoids quercetin and naringenin on the metabolic activation of 2-amino-3,5-dimethylimidazo[4,5-f]quinoline by Salmonella typhimurium TA1538 co-expressing human cytochrome P450 1A2, NADPH-cytochrome P450 reductase, and cytochrome b5. Mutat. Res. 2004;545:37–47. doi: 10.1016/j.mrfmmm.2003.08.002. [DOI] [PubMed] [Google Scholar]
  13. Lai L., Hao H., Wang Q., Zheng C., Zhou F., Liu Y., Wang Y., Yu G., Kang A., Peng Y., Wang G., Chen X. Effects of short-term and long-term pretreatment of Schisandra lignans on regulating hepatic and intestinal CYP3A in rats. Drug Metab. Dispos. 2009;37:2399–2407. doi: 10.1124/dmd.109.027433. [DOI] [PubMed] [Google Scholar]
  14. Lee S.H., Kim H..Y., Back S.Y., Han H.K. Piperine-mediated drug interactions and formulation strategy for piperine: recent advances and future perspectives. Expert. Opin. Drug Metab. Toxicol. 2018;14:43–57. doi: 10.1080/17425255.2018.1418854. [DOI] [PubMed] [Google Scholar]
  15. Li M., Yun W., Wang G., Li A., Gao J., He Q. Roles and mechanisms of garlic and its extracts on atherosclerosis: a review. Front. Pharmacol. 2022;13 doi: 10.3389/fphar.2022.954938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ma B.L., Ma Y.M. Pharmacokinetic herb-drug interactions with traditional Chinese medicine: progress, causes of conflicting results and suggestions for future research. Drug Metab. Rev. 2016;48:1–26. doi: 10.3109/03602532.2015.1124888. [DOI] [PubMed] [Google Scholar]
  17. Magliocco G., Thomas A., Desmeules J., Daali Y. Phenotyping of Human CYP450 enzymes by endobiotics: current knowledge and methodological approaches. Clin. Pharmacokinet. 2019;58:1373–1391. doi: 10.1007/s40262-019-00783-z. [DOI] [PubMed] [Google Scholar]
  18. Maitisha G., Aimaiti M., An Z., Li X. Allicin induces cell cycle arrest and apoptosis of breast cancer cells in vitro via modulating the p53 pathway. Mol. Biol. Rep. 2021;48:7261–7272. doi: 10.1007/s11033-021-06722-1. [DOI] [PubMed] [Google Scholar]
  19. Meng L., Li Y., Xue C., Ding C., Wang X., Fu R., Li Y., Li X., Dong Z. Compound danshen dripping pills affect the pharmacokinetics of azisartan by regulating the expression of cytochrome P450 2B1, 2C6, and 2C11 in rats. J. Pharm. Biomed. Anal. 2021;195 doi: 10.1016/j.jpba.2020.113887. [DOI] [PubMed] [Google Scholar]
  20. Mosbauer K., Fritsch V.N., Adrian L., Bernhardt J., Gruhlke M.C.H., Slusarenko A.J., Niemeyer D., Antelmann H. The effect of allicin on the proteome of SARS-CoV-2 infected calu-3 cells. Front. Microbiol. 2021;12 doi: 10.3389/fmicb.2021.746795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Novotna A., Krasulova K., Bartonkova I., Korhonova M., Bachleda P., Anzenbacher P., Dvorak Z. Dual effects of ketoconazole cis-enantiomers on CYP3A4 in human hepatocytes and HepG2 cells. PLoS. One. 2014;9 doi: 10.1371/journal.pone.0111286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Obach R.S., Walsky R..L., Venkatakrishnan K., Gaman E.A., Houston J.B., Tremaine L.M. The utility of in vitro cytochrome P450 inhibition data in the prediction of drug-drug interactions. J. Pharmacol. Exp. Ther. 2006;316:336–348. doi: 10.1124/jpet.105.093229. [DOI] [PubMed] [Google Scholar]
  23. Patel H.B., Patel U..D., Mathapati B.S., Modi C.M. Corrigendum to "effect of piperine and quercetin alone or in combination with marbofloxacin on CYP3A37 and MDR1 mRNA expression levels in broiler chickens". Res. Vet. Sci. 2021;135:568. doi: 10.1016/j.rvsc.2019.10.008. [DOI] [PubMed] [Google Scholar]
  24. Patoine D., Petit M., Pilote S., Picard F., Drolet B., Simard C. Modulation of CYP3a expression and activity in mice models of type 1 and type 2 diabetes. Pharmacol. Res. Perspect. 2014;2 doi: 10.1002/prp2.82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Robyn J., Rasschaert G., Hermans D., Pasmans F., Heyndrickx M. Is allicin able to reduce Campylobacter jejuni colonization in broilers when added to drinking water? Poult. Sci. 2013;92:1408–1418. doi: 10.3382/ps.2012-02863. [DOI] [PubMed] [Google Scholar]
  26. Rossi B., Toschi A., Piva A., Grilli E. Single components of botanicals and nature-identical compounds as a non-antibiotic strategy to ameliorate health status and improve performance in poultry and pigs. Nutr. Res. Rev. 2020;33:218–234. doi: 10.1017/S0954422420000013. [DOI] [PubMed] [Google Scholar]
  27. Sanchez-Gloria J.L., Arellano-Buendia A..S., Juarez-Rojas J.G., Garcia-Arroyo F.E., Arguello-Garcia R., Sanchez-Munoz F., Sanchez-Lozada L.G., Osorio-Alonso H. Cellular mechanisms underlying the cardioprotective role of Allicin on cardiovascular diseases. Int. J. Mol. Sci. 2022;23 doi: 10.3390/ijms23169082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Stresser D.M., Mao J.., Kenny J.R., Jones B.C., Grime K. Exploring concepts of in vitro time-dependent CYP inhibition assays. Expert. Opin. Drug Metab. Toxicol. 2014;10:157–174. doi: 10.1517/17425255.2014.856882. [DOI] [PubMed] [Google Scholar]
  29. Su T., Mao C., Yin F., Yu Z., Lin Y., Song Y., Lu T. Effects of unprocessed versus vinegar-processed Schisandra chinensis on the activity and mRNA expression of CYP1A2, CYP2E1 and CYP3A4 enzymes in rats. J. Ethnopharmacol. 2013;146:734–743. doi: 10.1016/j.jep.2013.01.028. [DOI] [PubMed] [Google Scholar]
  30. Sun H., Wang J., Lv J. Effects of glycyrrhizin on the pharmacokinetics of paeoniflorin in rats and its potential mechanism. Pharm. Biol. 2019;57:550–554. doi: 10.1080/13880209.2019.1651876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang K., Gao Q., Zhang T., Rao J., Ding L., Qiu F. Inhibition of CYP2C9 by natural products: insight into the potential risk of herb-drug interactions. Drug Metab. Rev. 2020;52:235–257. doi: 10.1080/03602532.2020.1758714. [DOI] [PubMed] [Google Scholar]
  32. Wang L., Jiao H., Zhao J., Wang X., Sun S., Lin H. Allicin alleviates reticuloendotheliosis virus-induced immunosuppression via ERK/mitogen-activated protein kinase pathway in specific pathogen-free chickens. Front. Immunol. 2017;8:1856. doi: 10.3389/fimmu.2017.01856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang Y., Jin Y., Yun X., Wang M., Dai Y., Xia Y. Co-administration with simvastatin or lovastatin alters the pharmacokinetic profile of sinomenine in rats through cytochrome P450-mediated pathways. Life Sci. 2018;209:228–235. doi: 10.1016/j.lfs.2018.08.012. [DOI] [PubMed] [Google Scholar]
  34. Wang Z.B., Ding L..A., Liu J.J., Savarin P., Wang X.L., Zhao K., Ding W.Y., Hou Y.L. Allicin ameliorates glucose and lipid metabolism via modulation of gut microbiota and bile acid profile in diabetic rats. J. Funct. Foods. 2023;111 doi: 10.1016/j.jff.2023.105899. [DOI] [Google Scholar]
  35. Wienkers L.C., Heath T.G. Predicting in vivo drug interactions from in vitro drug discovery data. Nat. Rev. Drug Discov. 2005;4:825–833. doi: 10.1038/nrd1851. [DOI] [PubMed] [Google Scholar]
  36. Xu B., Fu J., Zhu L., Li Z., Jin M., Wang Y. Overall assessment of antibiotic substitutes for pigs: a set of meta-analyses. J. Anim. Sci. Biotechnol. 2021;12:3. doi: 10.1186/s40104-020-00534-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Xu S., Liao Y., Wang Q., Liu L., Yang W. Current studies and potential future research directions on biological effects and related mechanisms of allicin. Crit. Rev. Food Sci. Nutr. 2023;63:7722–7748. doi: 10.1080/10408398.2022.2049691. [DOI] [PubMed] [Google Scholar]
  38. Yan Z., Feng C., Jin X., Liu D., Hong Y., Qiao Y., Bai Y., Moon H.B., Qadeer A., Wu F. In vitro metabolic kinetics of cresyl diphenyl phosphate (CDP) in liver microsomes of crucian carp (Carassius carassius) Environ. Pollut. 2021;274 doi: 10.1016/j.envpol.2021.116586. [DOI] [PubMed] [Google Scholar]
  39. Yim S.K., Kim K.., Chun S., Oh T., Jung W., Jung K., Yun C.H. Screening of Human CYP1A2 and CYP3A4 inhibitors from Seaweed In Silico and In Vitro. Mar. Drugs. 2020;18:603. doi: 10.3390/md18120603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zanger U.M., Schwab M. Cytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol. Ther. 2013;138:103–141. doi: 10.1016/j.pharmthera.2012.12.007. [DOI] [PubMed] [Google Scholar]
  41. Zhang G., Ou R., Li F., Wu J., Zheng L., Tong Y., Liu Y., Liu Z., Lu L. Regulation of drug-metabolizing enzymes and efflux transporters by Astragali radix decoction and its main bioactive compounds: implication for clinical drug-drug interactions. J. Ethnopharmacol. 2016;180:104–113. doi: 10.1016/j.jep.2016.01.031. [DOI] [PubMed] [Google Scholar]
  42. Zhang L., Wang X., Wang L., Badawy S., Liu Z., Xie C., Wang X., Tao Y. A new drug-drug interaction-tilmicosin reduces the metabolism of enrofloxacin through CYP3A4. Res. Vet. Sci. 2022;148:33–41. doi: 10.1016/j.rvsc.2022.05.004. [DOI] [PubMed] [Google Scholar]
  43. Zhang L.L., Zhang J..R., Guo K., Ji H., Zhang Y., Jiang S.X. Effects of fluoroquinolones on CYP4501A and 3A in male broilers. Res. Vet. Sci. 2011;90:99–105. doi: 10.1016/j.rvsc.2010.04.025. [DOI] [PubMed] [Google Scholar]
  44. Zhou S.F. Drugs behave as substrates, inhibitors and inducers of human cytochrome P450 3A4. Curr. Drug Metab. 2008;9:310–322. doi: 10.2174/138920008784220664. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.


Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES