ATRA influences the differentiation and fusion of myoblasts by regulating Rarα/Pitx2, leading to abnormal development of the pelvic floor muscles (PFMs) in fetal rats

Hanbin Zhao; Jian Cao; Huaqi Mu; Yang Bi; Zhenhua Guo; Yuan Shi; Yi Wang

doi:10.1371/journal.pone.0345764

. 2026 Apr 17;21(4):e0345764. doi: 10.1371/journal.pone.0345764

ATRA influences the differentiation and fusion of myoblasts by regulating Rarα/Pitx2, leading to abnormal development of the pelvic floor muscles (PFMs) in fetal rats

Hanbin Zhao ², Jian Cao ², Huaqi Mu ², Yang Bi ², Zhenhua Guo ², Yuan Shi ^1,^*, Yi Wang ^2,^*

Editor: Michael Schubert³

PMCID: PMC13089754 PMID: 41996375

Abstract

Anorectal malformation (ARM) is the most common congenital digestive tract anomaly in newborns, and children with ARM often have varying degrees of underdevelopment of the pelvic floor muscles (PFMs). To explore the effects of Rarα (NR1B1) and Pitx2 on the development of rat PFMs, we constructed a rat ARM animal model using all-trans retinoic acid (ATRA), and verified the expression of Rarα and Pitx2 in the PFMs of fetal rats. Additionally, we used rat myoblasts (L6 cells) to investigate the regulatory roles of Rarα and Pitx2 in skeletal muscle myoblast differentiation and their interactions. The results indicated a significant decrease in the expression of Rarα and Pitx2 in the PFMs of fetal rats with ARM. ATRA can also decrease the expression of Rarα and Pitx2 in the L6 cells, while affecting the differentiation and fusion of L6 cells. Knocking down Rarα in L6 cells reduced the expression of Pitx2, Myod1, Mymk, and decreased myogenic activity in L6 cells. When Rarα is activated, the decreased expression of Pitx2, Myod1, and Mymk and myogenic differentiation can be restored to different extents. At the same time, increasing or inhibiting the expression of Pitx2 can counteract the effects of knocking down Rarα and activating Rarα respectively. These results indicate that Pitx2 may be downstream of the transcription factor Rarα, mediating the effects of ATRA on the development of fetal rat PFMs.

Introduction

Anorectal malformation (ARM) is the most common congenital digestive malformation, with an incidence rate of approximately 1/5000 [1]. With the improvement of surgical techniques and postoperative management, most of patients can achieve a positive functional prognosis. However, some children may still experience fecal incontinence or constipation [2,3]. Abnormal development of pelvic floor muscles (PFMs) is an important influencing factor for postoperative defecation dysfunction in ARM patients. Currently, research on the abnormal development of PFMs in children with ARM is limited and primarily focuses on observing related phenotypic differences, without further exploration of the underlying mechanisms [4–6].

The formation of skeletal muscles requires mononuclear myoblasts to exit the cell cycle and fuse with each other to form new multinucleated myotubes. Then, the newly formed myotubes undergo further cell fusion to develop into mature myotubes. Transmembrane protein 8c (Tmem8c), also known as Myomaker (MYMK), is essential for myoblast fusion. It is transiently expressed and effectively promotes myoblast fusion during myogenesis and muscle regeneration processes [7]. MyoD1 is a crucial transcription factor in myogenesis, playing a significant role in determining myoblast fate and regulating the transcription of the majority of muscle-specific genes [8]. Myod1 can directly bind to the promoter of Mymk and induce its transcription during myoblast fusion [9,10]. At the same time, the initial activation of Myod1 requires Pitx2 to directly bind to the core enhancer of MyoD1 [11]. Pitx2 is a paired-related homeobox gene involved in the molecular processes that regulate embryonic and fetal muscle development [12]. It is specifically expressed in all MyoD + , Myf5 + , and myogenin+ cells of embryonic muscle primordia and regulates the proliferation and differentiation of myogenic progenitor cells during myogenesis [13,14]. There is no relevant report on whether Pitx2 is involved in causing abnormal PFMs development in ARM fetal rats.

All-trans retinoic acid (ATRA) is the active form of Vitamin A in the body, and it plays an important role by binding to the retinoic acid nuclear receptor family (Rarα, Rarβ, Rarγ), and physiological levels of ATRA are crucial for maintaining normal embryonic development [15]. Excessive ATRA can cause various malformations, including ARM, neural tube defects, and cleft palate [16]. In our previous study, we summarized a modeling method for ARM with a success rate as high as 97% by testing different concentration gradients and administration times [17].

Rarα can promote the maturation and differentiation of myogenic progenitor cells [18]. Rarα is reduced in the terminal rectum of patients with ARM, while the expression of Rarβ and Rarγ shows no significant abnormalities [19]. Previous studies have reported that there is no Rarα transcription factor in the distal colon region of fetal rats treated with excessive ATRA, and the impairment of the Rarα signal pathway is one of the reasons for the interference of ATRA in the development of the rat caudal region [20]. However, the regulatory role of Rarα in the myoblasts of the fetal rat pelvic floor has not been confirmed. The downstream molecular mechanism of Rarα’s impact on the development of rat caudal region tissues has not been clarified yet.

This study aims to explore the impact of ATRA on fetal rat PFMs and investigate the expression of Rarα and Pitx2 in the PFM tissues of fetal rats with anorectal malformation. In addition, we used rat myoblasts L6 as a model to investigate the correlation between Rarα and Pitx2. This study aims to provide new insights into the molecular mechanisms underlying the abnormal development of PFMs in children with ARM.

Materials and methods

Animal and housing

The Sprague-Dawley (SD) rats (weighing 200–220g) were purchased from the Animal Experiment Center of Chongqing Medical University and were housed in the Experimental Animal Center of Chongqing Medical University Affiliated Children’s Hospital. Male and female rats were housed together in a 1:1 ratio, and the day on which a vaginal plug was observed was designated as embryonic day 0.5 (E0.5). The experimental group used 3% isoflurane inhalation until the rats stopped moving, ATRA at a dose of 80 mg/kg was administered by gavage on E10.5, while the control group received the same amount of corn oil by gavage. Rats were euthanized by passive exposure to CO₂ for 15 min. Pregnant rats were euthanized and fetal rats were collected on E16.5 and E17.5 (supplement Table 1). The animal use protocol has been reviewed and approved by the Ethics Committee of Children’s Hospital of Chongqing Medical University (CHCMU-IACUC20210114038).

Cell culture and differentiation

L6 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Grand Island, NY) containing 10% fetal bovine serum (Gibco, USA), 100 IU/ml penicillin, and 100 IU/ml streptomycin. The cells were plated at approximately 30% fusion degree, allowed them to attach in complete culture medium, and cultured in differentiation medium (DM) containing 2% horse serum (Solarbio, China) for 24 hours before adding stimuli [21]. For immunofluorescence experiments, the cells were plated at 20% confluence and allowed to grow overnight before switching to DM medium for further processing.

Inhibition and activation of Rarα and Pitx2 expression

The Rarα-specific agonist AM580 (Abmole, USA) was used to activate Rarα, and the adenovirus used to inhibit Rarα expression was provided by Associate Professor Bi Yang from the Stem Cell Laboratory, Chongqing Medical University Affiliated Children’s Hospital [22] (supplement Fig 1). The primer sequences can be found in Table 1.

Table 1. sequence of primers.

Name of primers	Sequence of primers
Rat Rarα siRNA site	5’-aGCAAGTACACTACGAACAAtttt-3’
Rat Rarα siRNA site	5’-aTTGTTCGTAGTGTACTTGCtttt-3’

Open in a new tab

Plasmids were utilized to suppress the expression of Pitx2, and transfection was assisted by the cationic transfection reagent Lipofectamine 2000 (Invitrogen, USA). L6 cells were transfected with the plasmid using Lipo 2000 and incubated for 48 hours. Three pairs of shRNA genes were designed to target three gene loci, and the specific oligonucleotide sequences can be found in Table 2. The results indicated that rPitx2-shRNA2 was the most effective in reducing Pitx2 expression in L6 cells, so it was selected for subsequent experiments (supplement Fig 2). Ad-Pitx2 adenovirus was purchased from Tsingke Biotech. After transfection with adenovirus, the cells were switched to DM medium containing ATRA (10 μM) or AM580 (20 nM). After treating with ATRA or AM580 for 48 hours, proteins were extracted for the experiment, and each group was repeated at least 4 times. Cells were cultured in DM medium as the control group.

Table 2. Nucleotide sequence of the small hairpin RNAs targeting Pitx2 mRNA.

Plasmid	Forward primer	Reverse primer
rPitx2-shRNA1	GATCGCCTGAATAACTTGAACAACCCTCGAGGGTTGTTCAAGTTATTCAGGC TTTTTT	AATTAAAAAAGCCTGAATAACTTGAACAACCCTCGAGGGTTGTTCAAGTTATTCAGGC
rPitx2-shRNA2	GATCGCCTTTGATTTCAAAGGAATGCTCGAGCATTCCTTTGAAATCAAAGGC TTTTTT	AATTAAAAAAGCCTTTGATTTCAAAGGAATGCTCGAGCATTCCTTTGAAATCAAAGGC
rPitx2-shRNA3	GATCGCGAGCAAAGGAATGTATATACTCGAGTATATACATTCCTTTGCTCGCTTTTTT	AATTAAAAAAGCGAGCAAAGGAATGTATATACTCGAGTATATACATTCCTTTGCTCGC

Open in a new tab

qRT-PCR

Total RNA was extracted from rat pelvic floor tissue and L6 cells using TRIzol (Invitrogen, USA). The RNA was then reverse transcribed to cDNA using the PrimeScript™ RT Reagent Kit (Takara, Japan) according to the manufacturer’s instructions. The primers used in the study are listed in Table 3, and RT-qPCR was performed using the CXF96 system (Bio-Rad, USA).

Table 3. Sequences of primes used for PCR.

Gene	Forward primer	Reverse primer
Rarα (rat)	CTTCCTCCAACCTGCACAACT	ATCCGTGCAAGTCGGCTAGA
Pitx2 (rat)	GGATCGTGGAAGTCGGCTC	GCAGACTCCAGCCAAACAGA
Gapdh (rat)	TAAAGGGCATCCTGGGCTACACT	TTACTCCTTGGAGGCCATGTAGG

Open in a new tab

Western blot analysis

Total proteins were extracted from rat pelvic floor tissue and cell samples using a total protein extraction kit (Beyotime, China), following the manufacturer’s instructions. The proteins were separated by 12.5% SDS-PAGE and then transferred to a PVDF membranes (Millipore, USA). The membranes were then incubated with diluted primary antibodies against Rarα (1:800, ABclonal, China), Pitx2 (1:1000, Proteintech, China), Mymk (1:1000, ABclonal, China), Myod1 (1:1000, Proteintech, China), and GAPDH (1:1000, ZSGB-BIO, China) overnight at 4℃. Subsequently, the membranes were incubated with secondary antibodies (1:2000, Sizhengbo, China). The chemiluminescent signals were detected using a CEL detection kit (Bio-Rad, USA). Use the G: BOX chemical luminous imaging system (Synoptics, UK) for image collection and band density analysis.

Immunofluorescence assay

For cell immunofluorescence staining, cells on cell-attached slides were fixed with 4% paraformaldehyde for 20 minutes and then treated with 0.3% Triton X-100 (Sigma, Ireland) for 20 minutes to increase cell permeability. Then, the cells were incubated with PBST containing 5% bovine serum albumin (BSA, Sigma-Aldrich, USA) for 25 minutes to block non-specific binding, followed by incubation with diluted primary antibodies against Mymk (1:200, ABclonal, China) and Myod1 (1:200, Invitrogen, USA) at 4℃ overnight. The corresponding secondary antibodies (1:200, chicken anti-mouse IgG Alexa Fluor 488 or chicken anti-rabbit Alexa Fluor 594, Invitrogen, USA) were subsequently incubated for 1 hour. The cells were then stained with DAPI for 40 minutes to visualize the cell nuclei. The slides were mounted with an anti-fluorescence quenching agent (Abcam, USA) and observed and photographed using a C2 + confocal microscope (Nikon, Japan). Differentiation index was measured as the percentage of the nuclei number in Myod1 + cells relative to the total nuclei number. Fusion index was measured as the nuclei number in Mymk+ (three or more nuclei) as a percentage of the total number of nuclei.

For histological analysis of fetal rat pelvic floor tissues, samples were embedded in OCT compound after immersion in 20% sucrose, and then frozen. The frozen tissues were cut into 10μm thick sections, which were then incubated in PBS containing 0.3% Triton X-100 (Sigma, Ireland) for 25 minutes. Subsequently, the sections were blocked with 5% BSA for 1 hour and incubated with mixed primary antibodies, including Pax7 (1:100, Santa Cruz, USA) + Pitx2 (1:200, Bioss, China), Rarα (1:200, Abcam, USA) + Pitx2, Pax7 + Mymk (1:200, ABclonal, China), and Pax7 + Myod1 (1:200, ABclonal, China) at 4℃ overnight. The sections were then washed and incubated with corresponding secondary antibodies (1:200, chicken anti-mouse IgG Alexa Fluor 594 and chicken anti-rabbit Alexa Fluor 488, Invitrogen, USA) for 1 hour at room temperature, followed by DAPI staining for 15 minutes. After sealing with an anti-fluorescence quenching agent, the sections were observed and photographed using a fluorescence microscope (Nikon, Japan).

Statistical analysis

The differentiation rate of L6 cells was determined by calculating the percentage of nuclei in differentiated myotubes (Myod1-positive cells) out of the total number of nuclei. Similarly, the fusion rate of myotubes was determined by calculating the percentage of nuclei in fused myotubes (Mymk-positive cells) out of the total number of nuclei. Image J software (National Institutes of Health, Bethesda, MD) was used to calculate the grayscale values of protein bands in Western blots, and GraphPad Prism 9.5.1 (GraphPad Software, La Jolla, CA) was used for data analysis. All data are presented as means ± standard deviations. The data with a normal distribution were analyzed using analysis of variance (ANOVA) with Tukey’s multiple comparison test. P values less than 0.05 were considered statistically significant.

Results

Poor development of the PFMs in ARM fetal rats

In the normal group of fetal rats, the horizontal section stained with HE revealed a clearly visible rectum and urethra, as well as a symmetrical distribution of muscle fibers on both sides of the rectum and urethra. In the abnormal group (treated with ATRA), there was an absence of an anus, and the distribution of PFMs fibers was disorganized and sparse, accompanied by abnormalities of the sacrococcygeal neural tube (supplement Fig 3 c-h).

Expression of Pitx2, Rarα, and muscle-generating related genes in the PFMs of fetal rat

mRNA and protein levels of Pitx2 and Rarα were investigated in the PFMs of fetal rats at E16.5 and E17.5 (Fig 1a, b). qRT-PCR results showed that the expression of Pitx2 in ARM fetal rat PFMs at E16.5 and E17.5 was significantly lower than that in the normal group（wt） (P < 0.01 and P < 0.001, respectively), and Rarα expression was lower in the ARM group than in the normal group (P < 0.01 and P < 0.001, respectively). Western blot analysis indicated that Pitx2 and Rarα in the PFMs of the ARM group were also expressed at low levels (Fig 1c-e). Pax7 is a specific marker for myoblasts [23], and immunofluorescent staining was performed on horizontal sections of the pelvic floor. The fluorescence labeling of Pax7 was primarily concentrated in the muscle tissue area. Co-localization analysis revealed that the fluorescence intensity of Pitx2 and Rarα in the ARM group PFMs was significantly lower than that in the control group (Fig 1f), but the Pax7 signal was significantly stronger than in the control group (Fig 1g). The expression of the differentiation-related gene Myod1 and the fusion-related gene Mymk was also significantly decreased (Fig 1h, i).

ATRA affects the differentiation and fusion of L6 and the expression of Rarα and Pitx2

Stimulation of L6 cells with 10μM ATRA in DM medium significantly decreased the expression of Rarα and Pitx2 (P < 0.001 and P < 0.05, respectively) (Fig 2a, b). Western blotting showed the same results as qRT-PCR (Fig 2c-e). AM580 (20nM), a specific agonist of Rarα, increased the expression of Pitx2 in L6 cells co-stimulated with ATRA compared to cells stimulated with ATRA alone (P < 0.05). It was also observed that ATRA significantly decreased the expression of Myod1 and Mymk in L6 cells (P < 0.001 and P < 0.05, respectively), while AM580 rescued the effect of ATRA on the expression of Myod1 and Mymk (P < 0.0001 and P < 0.05, respectively) (Fig 2f-h).

To investigate the impact of Pitx2 on the differentiation of L6 cells, we suppressed the expression of Pitx2 using shRNA (rPitx2-shRNA), and upregulated the expression of Pitx2 by transfecting L6 cells with Ad-Pitx2.

In DM medium containing ATRA, transfection of Ad-Pitx2 could only rescue the decrease in Myod1 (P < 0.001), but not the decrease in Mymk (Fig 2f-h). Cell immunofluorescence yielded the same results (Fig 3a). The fusion and differentiation rates of L6 cells were calculated based on co-expression analysis (Fig 3b, c). The differentiation rates of the control group, ATRA group, ATRA+AM580 group, and ATRA+ Ad-Pitx2 group were 0.592 ± 0.167, 0.127 ± 0.082, 0.659 ± 0.129, and 0.776 ± 0.285, respectively. ATRA significantly decreased the differentiation rate of L6 cells (P < 0.01), while AM580 and Ad-Pitx2 rescued the decreased differentiation rate caused by ATRA (P < 0.001 and P < 0.01, respectively). The fusion rates of the groups were 0.302 ± 0.049, 0.087 ± 0.033, 0.323 ± 0.053, and 0.261 ± 0.059, respectively. Similarly, ATRA significantly decreased the fusion rate of L6 cells (P < 0.001), and AM580 and Ad-Pitx2 rescued the decreased fusion rate caused by ATRA (P < 0.001 and P < 0.01, respectively). These results suggest that ATRA may inhibit the myogenic differentiation of L6 cells by downregulating Rarα and Pitx2.

Fig 3 — **(a)** Immunofluorescent staining for Mymk and Myod1 after ATRA, AM580 stimulation and Ad-Pitx2 infection (magnification, 200×). Quantification of the myotube differentiation rate **(b)** and fusion rate **(c)**.

Rarα may affect the expression of Myod1 and Mymk through Pitx2 in L6 cells

The Ad-siRarα adenovirus was used to infect L6 cells to construct L6 cells with downregulated Rarα expression. After downregulating Rarα expression, it was observed that Pitx2, Myod1, and Mymk were all simultaneously decreased (P < 0.0001, P < 0.001, and P < 0.0001, respectively). The addition of AM580 after transient transfection with Ad-siRarα, or co-transfection of Ad-siRarα with Ad-Pitx2, can partially restore the decrease in Pitx2 (P < 0.05 and P < 0.05, respectively) and Myod1 (P < 0.01 and P < 0.01, respectively) resulting from Rarα downregulation (Fig 4a, 4c–4f). Stimulation of L6 cells with AM580 alone also increased the expression of Myod1 (P < 0.01) and Mymk. Simultaneously transfecting rPitx2-shRNA while stimulating L6 cells with AM580 can significantly attenuate the enhanced effect of AM580 on the expression of Myod1 and Mymk (P < 0.001 and P < 0.05, respectively) (Fig 4b, 4g, 4h).

Fig 4 — **(a)** Western blotting analysis of Rarα, Pitx2, Myod1 and Mymk protein expression after transfection with Ad-siRarα and Ad-Pitx2 or followed by treatment with AM580. **(c-f)** Quantification of Rarα (c), Pitx2 (d), Myod1 (e) and Mymk (f) in western blot shown in (a) (n = 4). (b) Western blotting analysis of Myod1 and Mymk protein expression after AM580 treatment and rPitx2-shRNA plasmid transfection. (g, h) Quantification of Myod1 (g) and Mymk (h) in western blot shown in (n = 4) (b).

Discussion

In this study, we confirmed the abnormal development of PFMs in ARM rats, which is consistent with clinical observations. Furthermore, the expression of Rarα and Pitx2 in the PFMs of fetal rats with ARM was decreased. Based on these results, we conducted in vitro experiments and demonstrated that ATRA can affect the myogenic differentiation of rat L6 cells by decreasing the expression of Rarα and Pitx2.

In ARM patients, there are abnormalities in the development and distribution of PFMs, which worsen with the severity of ARM [5,24]. To investigate the mechanisms underlying these developmental abnormalities, we established an ARM model by administering ATRA to pregnant rats. No normal anal opening was observed in the model rats, and a rectourethral fistula was clearly observed in sagittal sections (supplement Fig 3 a, b), indicating the successful modeling of ARM. ATRA plays an important role in the development and functional maintenance of organs, and Rarα is one of its nuclear receptor family members and is present in many tissues, including muscles [25]. There is evidence that increased expression of Rarα can promote the differentiation and fusion of myoblasts [26]. The biological effects of ATRA are highly concentration-dependent. Excessive exposure to ATRA can not only downregulate RARα expression levels but also promote the ubiquitination and degradation of RARα protein by activating the proteasome pathway, thereby exerting negative feedback inhibition on the signaling pathway [18,27,28]. The results of this study revealed abnormal development of PFMs in ARM fetal rats. The expression of Rarα decreased, while immunofluorescence results indicated an increase in Pax7 expression, a marker of myoblasts [29]. Therefore, it is speculated that the effect may be attributed to the action of ATRA on the pelvic floor, leading to a reduction in Rarα in myoblasts, which hinders their ability to differentiate and fuse properly into mature muscle tissue. Knopp et al. demonstrated that Pitx2 promotes myogenic differentiation of myoblasts but reduces their proliferation [30]. Deletion of Rarα in periocular mesenchyme results in decreased expression of Pitx2. Additionally, specific inactivation of Pitx2 leads to abnormalities in periocular development and the maintenance of the optic nerve, similar to the eye defects observed in Rarα knockout rats [31,32]. During the development of PFM, it is unclear whether Rarα and Pitx2 exist in linear genetic pathways. Therefore, we measured the expression of Pitx2, and Mymk, a gene associated with myoblast fusion, and Myod1, a gene associated with differentiation [33,34]. The expression of these genes was significantly decreased in the model group.

To further clarify the effects of ATRA on myoblasts, we conducted in vitro experiments. Stimulation of L6 cells with ATRA in vitro significantly reduced the expression of Rarα and Pitx2, as well as the expression of Mymk and Myod1, which is consistent with the in vivo experiment. Our Western blot and immunofluorescence results indicate that the Rarα agonist AM580 or overexpression of Pitx2 can counteract the effects of ATRA on the differentiation and fusion of L6 cells. These results suggest that ATRA may influence the myogenic differentiation of L6 cells via Rarα or Pitx2.

In order to further investigate the impact of Rarα on L6 differentiation through Pitx2, we successfully achieved down-regulation and overexpression of target genes in L6 cells through RNA interference and exogenous plasmid transfection. By reducing the expression of Rarα, the expression of Pitx2, Mymk, and Myod1 decreased. While reducing Rarα, activating the remaining Rarα with AM580 can partially rescue the expression of Pitx2 and Myod1. The increase in Myod1 is greater than that of Pitx2. It is speculated that the reason for this may be that Pitx2 not only directly promotes Myod1 but also regulates the expression of myoblast prospecification markers such as Tbx1, Tcf21, and Msc. These transcription factors are also required for the activation of Myf5 and Myod1 [35]. Increased expression of Pitx2 can significantly enhance the expression of Mymk and Myod1, while decreasing the expression of Pitx2 can significantly impact the enhancing effect of AM580 on Mymk and Myod1. These results indicate that Pitx2 mediates the action of Rarα in regulating the myogenic differentiation of L6 cells. However, the mechanism of interaction between Rarα and Pitx2 is not clear. Some authors have performed computer analysis of the Pitx2 gene and did not find RarE(retinoic acid response elements) sequences in its promoter. Furthermore, microarray analysis did not reveal that Pitx2 is a target of Rarα [32,36]. Therefore, RA may indirectly regulate Pitx2 through transcription intermediaries. Activation of Rarα can lead to the initiation of intracellular signals triggered by TGF-β in cells [37]. After TGF-β binds to its receptor, the Smad protein bound to the intracellular domain of the receptor is phosphorylated and released. Subsequently, it acts as a transcriptional signal on target genes in the nucleus, leading to cell differentiation and growth inhibition [38]. Studies have shown that the Smad4 protein can bind to the Pitx2 promoter and stimulate the expression of Pitx2 [39]. Therefore, we speculate that the inhibition of L6 cell differentiation by reducing Rarα may be achieved through the TGF-β-Smad4 axis, resulting in reduced Pitx2 expression. In addition, this study also observed that even if Rarα is inhibited, AM580 can still increase the expression of Pitx2 and Myod1. There may be other nuclear transcription factors involved in regulating Pitx2 gene expression in L6 cells, which necessitates further experiments for verification.

In summary, our study results suggest that Rarα is essential for the differentiation of L6 cells, and its role in myogenesis may be mediated by Pitx2. ATRA may affect the development of PFMs in fetal rats through the Rarα/Pitx2 pathway. To further elucidate the mechanisms by which Rarα regulates myogenic differentiation, it would be useful to identify the mediators of Rarα and Pitx2 interactions. Further research is needed.

Supporting information

S1 Fig. Effects of various treatments on Rarα in L6 cells.

(a) L6 cells were induced to differentiate for various lengths of time. Western blotting analysis showing Rarαand Pitx2 expression at various stages. D0 indicates undifferentiated L6 cells, and D1 to D4 indicate L6 cells on Days 1–4, respectively, after initial exposure to differentiation medium. (b, c) Quantification of Rarαand Pitx2 protein expression in (a); (d, e) Differentiated medium (CON), vacuum virus, Rarα inhibitory adenovirus, and AM580 effect on Rarα; *p < 0.05, ***p < 0.001, ****p < 0.0001.

(DOCX)

pone.0345764.s001.docx^{(184.4KB, docx)}

S2 Fig. The effect of different plasmids on Pitx2 expression in L6 cells.

(a, b) Among the three plasmids, sh2 exhibited the most significant inhibitory effect on Pitx2. (c, d) Differentiated medium (CON), vacuum virus, Pitx2 overexpression adenovirus, and blank plasmid, Pitx2 inhibitory plasmid effect on Pitx2. *p < 0.05, ***p < 0.001, ****p < 0.0001.

(DOCX)

pone.0345764.s002.docx^{(206.7KB, docx)}

S1 Table. Comparison of the number of malformed fetal rats between the control group and the model group.

(DOCX)

pone.0345764.s003.docx^{(16.4KB, docx)}

S3 Fig. HE staining of fetal rat sections (magnification, 40×), R: rectum, A: anus, F: fistula, B: bladder, U: urethra, C: cloaca, Red dashed lines indicate muscle areas.

(a) Sagittal section of E17.5 fetal rats in the normal group. (b) Sagittal section of ARM group. (c, d, e) Horizontal sections of fetal rats at E16.5, E17.5, and E18.5 in the normal group. (f, g, h) Horizontal sections of fetal rats at E16.5, E17.5, and E18.5 in the ARM group.

(DOCX)

pone.0345764.s004.docx^{(3.4MB, docx)}

S1 File. Original WB.

(TIF)

pone.0345764.s005.tif^{(5.5MB, tif)}

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

This study was supported by the Program for Youth Innovation in Future Medicine, Chongqing Medical University (grant No. W0125).

References

1.Levitt MA, Peña A. Anorectal malformations. Orphanet J Rare Dis. 2007;2:33. doi: 10.1186/1750-1172-2-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.deVries PA, Peña A. Posterior sagittal anorectoplasty. J Pediatr Surg. 1982;17(5):638–43. doi: 10.1016/s0022-3468(82)80126-7 [DOI] [PubMed] [Google Scholar]
3.Sharma S. Erudition from primary posterior sagittal anorectoplasty for anorectal malformations over two decades. Pediatr Surg Int. 2023;39(1):277. doi: 10.1007/s00383-023-05559-y [DOI] [PubMed] [Google Scholar]
4.Bjørsum-Meyer T, Christensen P, Baatrup G, Jakobsen MS, Asmussen J, Qvist N. Dyssynergic patterns of defecation in constipated adolescents and young adults with anorectal malformations. Sci Rep. 2020;10(1):19673. doi: 10.1038/s41598-020-76841-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Miyake Y, Ochi T, Yamashiro Y, Seo S, Miyano G, Koga H, et al. Levator ani asymmetry and deviation in high-type anorectal malformation evaluated by magnetic resonance imaging. Pediatr Surg Int. 2022;38(5):749–53. doi: 10.1007/s00383-022-05104-3 [DOI] [PubMed] [Google Scholar]
6.Geng Y, Mi J, Gao H, Jia H, Wang W. Spatiotemporal expression of Wnt3a during striated muscle complex development in rat embryos with ethylenethiourea-induced anorectal malformations. Mol Med Rep. 2017;15(4):1601–6. doi: 10.3892/mmr.2017.6207 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Millay DP, O’Rourke JR, Sutherland LB, Bezprozvannaya S, Shelton JM, Bassel-Duby R, et al. Myomaker is a membrane activator of myoblast fusion and muscle formation. Nature. 2013;499(7458):301–5. doi: 10.1038/nature12343 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Braun T, Gautel M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat Rev Mol Cell Biol. 2011;12(6):349–61. doi: 10.1038/nrm3118 [DOI] [PubMed] [Google Scholar]
9.Luo W, Li E, Nie Q, Zhang X. Myomaker, regulated by MYOD, MYOG and miR-140-3p, promotes chicken myoblast fusion. Int J Mol Sci. 2015;16(11):26186–201. doi: 10.3390/ijms161125946 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Zhang H, Wen J, Bigot A, Chen J, Shang R, Mouly V, et al. Human myotube formation is determined by MyoD-Myomixer/Myomaker axis. Sci Adv. 2020;6(51):eabc4062. doi: 10.1126/sciadv.abc4062 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Shih HP, Gross MK, Kioussi C. Cranial muscle defects of Pitx2 mutants result from specification defects in the first branchial arch. Proc Natl Acad Sci U S A. 2007;104(14):5907–12. doi: 10.1073/pnas.0701122104 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Kuriki M, Korb A, Comai G, Tajbakhsh S. Interplay between Pitx2 and Pax7 temporally governs specification of extraocular muscle stem cells. PLoS Genet. 2024;20(6):e1010935. doi: 10.1371/journal.pgen.1010935 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.L’honoré A, Ouimette J-F, Lavertu-Jolin M, Drouin J. Pitx2 defines alternate pathways acting through MyoD during limb and somitic myogenesis. Development. 2010;137(22):3847–56. doi: 10.1242/dev.053421 [DOI] [PubMed] [Google Scholar]
14.Daimi H, Lozano-Velasco E, Haj Khelil A, Chibani JBE, Barana A, Amorós I, et al. Regulation of SCN5A by microRNAs: miR-219 modulates SCN5A transcript expression and the effects of flecainide intoxication in mice. Heart Rhythm. 2015;12(6):1333–42. doi: 10.1016/j.hrthm.2015.02.018 [DOI] [PubMed] [Google Scholar]
15.Mark M, Ghyselinck NB, Chambon P. Function of retinoid nuclear receptors: lessons from genetic and pharmacological dissections of the retinoic acid signaling pathway during mouse embryogenesis. Annu Rev Pharmacol Toxicol. 2006;46:451–80. doi: 10.1146/annurev.pharmtox.46.120604.141156 [DOI] [PubMed] [Google Scholar]
16.Lee LMY, Leung C-Y, Tang WWC, Choi H-L, Leung Y-C, McCaffery PJ, et al. A paradoxical teratogenic mechanism for retinoic acid. Proc Natl Acad Sci U S A. 2012;109(34):13668–73. doi: 10.1073/pnas.1200872109 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Wu F, Gu C, Bi Y, Guo Z, Wang Y. Folic acid rescues all-trans retinoic acid-induced anorectal malformations in rats. Birth Defects Res. 2020;112(20):1850–6. doi: 10.1002/bdr2.1810 [DOI] [PubMed] [Google Scholar]
18.Halevy O, Lerman O. Retinoic acid induces adult muscle cell differentiation mediated by the retinoic acid receptor-alpha. J Cell Physiol. 1993;154(3):566–72. doi: 10.1002/jcp.1041540315 [DOI] [PubMed] [Google Scholar]
19.Wang Z, Wang Q, Gu C, Zhang J, Wang Y. Abnormal serum vitamin A levels and retinoic acid receptor α expression patterns in children with anorectal malformation. Pediatr Surg Int. 2019;35(8):903–10. doi: 10.1007/s00383-019-04495-0 [DOI] [PubMed] [Google Scholar]
20.Bitoh Y, Shimotake T, Kubota Y, Kimura O, Iwai N. Impaired distribution of retinoic acid receptors in the hindgut-tailgut region of murine embryos with anorectal malformations. J Pediatr Surg. 2001;36(2):377–80. doi: 10.1053/jpsu.2001.20721 [DOI] [PubMed] [Google Scholar]
21.Portiér GL, Benders AG, Oosterhof A, Veerkamp JH, van Kuppevelt TH. Differentiation markers of mouse C2C12 and rat L6 myogenic cell lines and the effect of the differentiation medium. In Vitro Cell Dev Biol Anim. 1999;35(4):219–27. doi: 10.1007/s11626-999-0030-8 [DOI] [PubMed] [Google Scholar]
22.Min G, Yang B, Yun Z, Wei J, Jie C, Tingyu L. Construction and identification of small interfering RNAs against rat retinoic acid receptor a by recombinant adenovirus. Chinese Journal of Anatomy. 2012;35(5):562–6. [Google Scholar]
23.Montarras D, L’honoré A, Buckingham M. Lying low but ready for action: the quiescent muscle satellite cell. FEBS J. 2013;280(17):4036–50. doi: 10.1111/febs.12372 [DOI] [PubMed] [Google Scholar]
24.Li L, Ren X, Xiao H, Wang C, Xu H, Ming A, et al. Normal anorectal musculatures and changes in anorectal malformation. Pediatr Surg Int. 2020;36(1):103–11. doi: 10.1007/s00383-019-04583-1 [DOI] [PubMed] [Google Scholar]
25.Zhu G-H, Huang J, Bi Y, Su Y, Tang Y, He B-C, et al. Activation of RXR and RAR signaling promotes myogenic differentiation of myoblastic C2C12 cells. Differentiation. 2009;78(4):195–204. doi: 10.1016/j.diff.2009.06.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Zhang W, Peng Q, Zhang X, Guo J, Tong H, Li S. Vitamin A Promotes the Repair of Mice Skeletal Muscle Injury through RARα. Nutrients. 2023;15(17):3674. doi: 10.3390/nu15173674 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Zhang L, Yan Y, Zhu D, Yang W, Wang W, Hu Y, et al. Nutlin-1 strengthened anti-proliferation and differentiation-inducing activity of ATRA in ATRA-treated p-glycoprotein deregulated human myelocytic leukemia cells. Invest New Drugs. 2012;30(1):37–47. doi: 10.1007/s10637-010-9512-5 [DOI] [PubMed] [Google Scholar]
28.Zhu J, Gianni M, Kopf E, Honoré N, Chelbi-Alix M, Koken M, et al. Retinoic acid induces proteasome-dependent degradation of retinoic acid receptor alpha (RARalpha) and oncogenic RARalpha fusion proteins. Proc Natl Acad Sci U S A. 1999;96(26):14807–12. doi: 10.1073/pnas.96.26.14807 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Zammit PS, Partridge TA, Yablonka-Reuveni Z. The skeletal muscle satellite cell: the stem cell that came in from the cold. J Histochem Cytochem. 2006;54(11):1177–91. doi: 10.1369/jhc.6R6995.2006 [DOI] [PubMed] [Google Scholar]
30.Knopp P, Figeac N, Fortier M, Moyle L, Zammit PS. Pitx genes are redeployed in adult myogenesis where they can act to promote myogenic differentiation in muscle satellite cells. Dev Biol. 2013;377(1):293–304. doi: 10.1016/j.ydbio.2013.02.011 [DOI] [PubMed] [Google Scholar]
31.Evans AL, Gage PJ. Expression of the homeobox gene Pitx2 in neural crest is required for optic stalk and ocular anterior segment development. Hum Mol Genet. 2005;14(22):3347–59. doi: 10.1093/hmg/ddi365 [DOI] [PubMed] [Google Scholar]
32.Matt N, Ghyselinck NB, Pellerin I, Dupé V. Impairing retinoic acid signalling in the neural crest cells is sufficient to alter entire eye morphogenesis. Dev Biol. 2008;320(1):140–8. doi: 10.1016/j.ydbio.2008.04.039 [DOI] [PubMed] [Google Scholar]
33.Zhang Q, Vashisht AA, O’Rourke J, Corbel SY, Moran R, Romero A, et al. The microprotein Minion controls cell fusion and muscle formation. Nat Commun. 2017;8:15664. doi: 10.1038/ncomms15664 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Weintraub H, Tapscott SJ, Davis RL, Thayer MJ, Adam MA, Lassar AB, et al. Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc Natl Acad Sci U S A. 1989;86(14):5434–8. doi: 10.1073/pnas.86.14.5434 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Hernandez-Torres F, Rodríguez-Outeiriño L, Franco D, Aranega AE. Pitx2 in Embryonic and Adult Myogenesis. Front Cell Dev Biol. 2017;5:46. doi: 10.3389/fcell.2017.00046 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Balmer JE, Blomhoff R. Gene expression regulation by retinoic acid. J Lipid Res. 2002;43(11):1773–808. doi: 10.1194/jlr.r100015-jlr200 [DOI] [PubMed] [Google Scholar]
37.Jimi S, Mashima K, Matsumoto T, Hara S, Suzumiya J, Tamura K. RARalpha is a regulatory factor for Am-80-induced cell growth inhibition of hematologic malignant cells. Int J Oncol. 2007;31(2):397–404. doi: 10.3892/ijo.31.2.397 [DOI] [PubMed] [Google Scholar]
38.Heldin CH, Miyazono K, ten Dijke P. TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature. 1997;390(6659):465–71. doi: 10.1038/37284 [DOI] [PubMed] [Google Scholar]
39.Wang Q, Li J, Wu W, Shen R, Jiang H, Qian Y, et al. Smad4-dependent suppressor pituitary homeobox 2 promotes PPP2R2A-mediated inhibition of Akt pathway in pancreatic cancer. Oncotarget. 2016;7(10):11208–22. doi: 10.18632/oncotarget.7158 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0345764.r001

Decision Letter 0

Michael Schubert

31 Jul 2025

Dear Dr. Wang,

Please submit your revised manuscript by Sep 14 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols....

We look forward to receiving your revised manuscript.

Kind regards,

Michael Schubert

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

3. Thank you for stating the following financial disclosure:

“This study was supported by the Program for Youth Innovation in Future Medicine, Chongqing Medical University (grant No. W0125).”

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

3. Thank you for stating the following in the Funding Section of your manuscript:

“This study was supported by the Program for Youth Innovation in Future Medicine, Chongqing Medical University (grant No. W0125).”

We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“This study was supported by the Program for Youth Innovation in Future Medicine, Chongqing Medical University (grant No. W0125).”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. We note that you have indicated that there are restrictions to data sharing for this study. For studies involving human research participant data or other sensitive data, we encourage authors to share de-identified or anonymized data. However, when data cannot be publicly shared for ethical reasons, we allow authors to make their data sets available upon request. For information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

Before we proceed with your manuscript, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially identifying or sensitive patient information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., a Research Ethics Committee or Institutional Review Board, etc.). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. Please see http://www.bmj.com/content/340/bmj.c181.long for guidelines on how to de-identify and prepare clinical data for publication. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories. You also have the option of uploading the data as Supporting Information files, but we would recommend depositing data directly to a data repository if possible.

Please update your Data Availability statement in the submission form accordingly.

6. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

7. Please include a separate caption for each figure in your manuscript.

8. We are unable to open your Supporting Information file [supplement.zip]. Please kindly revise as necessary and re-upload.

9. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.-->

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: Yes

Reviewer #2: Yes

**********

Reviewer #1: Tracking #: PONE-D-25-14533 – Hanbin Zhao et al.

The article entitled “ATRA influences the differentiation and fusion of myoblasts by regulating Rarα/Pitx2, leading to abnormal development of the pelvic floor muscles (PFMs) in fetal rats” presents some interesting new data concerning the mode of action of all-trans retinoic acid (ATRA) in anorectal malformation and in the development of the pelvic floor muscles.

Overall, this is a well-constructed manuscript. The introduction gives a good understanding of the subject and its issues, and provides an adequate bibliographical review. The experimental part is clearly presented and explained. The figures and their legends make it easy to analyze the data.

This interesting paper is based on both animal and cell models, and the methods used are suitable for such a study. Although this work clearly demonstrates that an excess of ATRA causes a decrease in the expression and cellular level of both RARa and Pitx2 proteins, it suffers a conceptual limitation which means that some of the conclusions and interpretations formulated by the authors are a little too assertive.

Following are a few points that need to be clarified or improved to make the article more suitable for publication.

Major points:

1/ Figure 2 - for experiments based on L6 cells, the authors use ATRA at 10µM and Am580 at 20nM. Both ligands are high-affinity agonists for RARa, with Am580 having the best Kd (approx. 1 Log difference). Such concentrations pose a problem for the interpretation of results. Given the respective affinities of ATRA and Am580 for RARa, it is likely that when the two molecules are combined for cell treatment, ATRA is bound to RARa and, by competition, prevents binding of Am580. In this case, the observed effect of Am580 could not be attributed to RARa activation. However, despite the competition between ATRA and Am580 to bind RARa, if a fraction of RARa is bound to and activated by Am580, why would ATRA used alone not cause the same effects as Am580, since ATRA is a RARa agonist like Am580?

Taken together, these considerations make the mechanistic interpretation of the results presented in figure 2 difficult. Without calling the results into question, the mechanisms proposed by the authors should be reassessed.

Minor points:

2/ Did the authors test ATRA at concentrations below 10µM in the assays presented? Defining whether a lower concentration of ATRA is capable of mediating comparable effects could be informative about ATRA's mechanism of action. Also it should be noted that a concentration of 10µM, ATRA can bind to other cellular targets (PPARs, RORs, others) and regulate pathways controlled by these proteins.

3/ A contradiction is observed between Fig2c and Fig2e. The western blot shows an increase in Pitx2 levels (Fig2c) for ATRA-Am580 co-treatment compared with untreated, whereas quantification of this western blot indicates a decrease.

4/ Why is Am580 not used on its own (Fig. 2)? This experimental condition would constitute a relevant control.

5/ Another point is that in vitro a fraction of ATRA can be converted to 9cRA, an agonist for RARs but also for RXR, the heterodimerization partner of RARs. Simultaneous activation of both RAR and RXR partners by an agonist results in transcriptional over-activation, which can bias assays. On the other hand, as RXR is also the heterodimerization partner of other nuclear receptors, its activation by an agonist like 9CRA is likely to affect these other signaling pathways. It would be advisable to check whether 10µM of the ATRA solution used for these studies does not exhibit RXR agonist activity.

6/ Am580 is considered a selective agonist for RARa over RARb and RARg. However, to respect this specificity, it is necessary to be cautious about the amount of ligand used. It is necessary not to exceed a concentration of 10nM of Am580. 20nM is a little too strong. For experiments using cells in culture, 5nM Am580 is sufficient to fully activate RARa.

7/ In the discussion section, authors mention the response elements (RARE) that enable RARs to associate with DNA in regions regulating target gene expression. They write “RarE sequences”. This term and abbreviation should be defined for readers unfamiliar with this field.

8/ Authors write “chemically synthesized shRNA”. What does the term “chemically” refer to in this context?

9/ Authors use trivial name for RARalpha as well for other nuclear receptors. A logical numbering system and receptor code, supporting the trivial names, was made by the International Committee of Pharmacology Committee on Receptor Nomenclature and Classification (NC-IUPHAR). In each manuscript dealing with nuclear receptors, it is recommended that the receptors be identified by the official names at least once in the summary and the introduction. Once the name has been established, authors may use the trivial name for the remainder of the manuscript. For instance, the trivial name and the formal nomenclature for RARalpha is NR1B1.

Reviewer #2: The authors examine the role of Rara and pitx2 in muscle development, focusing on anorectal malformation caused by faulty development of pelvic floor muscles. Sprague-Dawley rats were given all-trans retinoic acid (ATRA) as a model for anorectal malformation. PFMs of the ARM model rats were poorly developed, and displayed lower expression of myod, mymk, (consistent with faulty development), pitx2, and rara, while pax7 was elevated. Additional experiments in ATRA-treated L6 myoblasts allowed more mechanistic examination. ATRA-treated L6s recapitulated the results seen in PRMs, with decreased levels of pitx2, rara, myod, and mymk. Transfection with Ad-Pitx2 recovered much of these decreases, with the exception of Mymk. These results together indicate that ATRA inhibits L6 differentiation through decreasing Rara and pitx2. Further, siRNA of Rara decreased the expression of pitx2, myod, and mymk. Taken together, these results suggest a potent role for Pitx2 and Rara in muscle differentiation, with relevance to ARM.

The experiments are well performed and presented, with the appropriate statistical analyses. The use of ATRA as a model for ARM and studying myoblast differentiation provides a useful approach that is complemented well by the use of Rara siRNA. These findings suggest a strong role for the Pitx2/Rara axis.

The most exciting experiment remains to be done. Having shown the strong effects of siRara on MyoD levels, and the ability of Pitx2 to restore MyoD and Mymk, analyzing the differentiation of L6 myoblasts in these contexts (as in Fig. 3b and c) would provide strong support for the authors' conclusions and strengthen the manuscript.

As a standard procedure for all manuscripts, preliminary checks indicate that AI was not used in generating the manuscript. The reviewer thanks the authors for their time and integrity.

**********

what does this mean?). If published, this will include your full peer review and any attached files.). If published, this will include your full peer review and any attached files.). If published, this will include your full peer review and any attached files.). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our For information about this choice, including consent withdrawal, please see our For information about this choice, including consent withdrawal, please see our For information about this choice, including consent withdrawal, please see our Privacy Policy..-->

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.. Please note that Supporting Information files do not need this step.-->

PLoS One. 2026 Apr 17;21(4):e0345764. doi: 10.1371/journal.pone.0345764.r002

Author response to Decision Letter 1

31 Dec 2025

Dear Editor of PLOS one:

We sincerely thank the editor and all reviewers for their valuable feedback that we have used to improve the quality of our manuscript. The reviewer comments are laid out below in italicized font and specific concerns have been numbered. Our response is given in normal font and changes/additions to the manuscript are given in the red text.

Reviewer #1:

Major points:

Answer1: In our experiment, we initially used high concentrations of ATRA to stimulate L6 cells, followed by a switch to differentiation medium containing AM580 to further stimulate the cells. Previous studies have shown that the biological effects of ATRA are highly concentration-dependent. Excessive exposure to ATRA can not only reduce RARα expression levels but also promote ubiquitination and degradation of the RARα protein by activating the proteasome pathway, thereby exerting negative feedback inhibition on the signaling pathway. Therefore, after high concentrations of ATRA caused a decrease in RARα levels in L6 cells, subsequent stimulation with AM580 enhanced the effects of ATRA on these cells by acting on the remaining RARα.

Minor points:

Answer2: We tested lower concentrations of ATRA (<10 nM) and found that it can increase RARα expression. This study was based on human specimens from previous research. Earlier experiments did not detect changes in RARγ and RARβ expression in the terminal rectum of children with ARM. Therefore, this study focused solely on RARα expression. This represents a limitation of the current study, and we plan to conduct more comprehensive experiments in the future.

Answer3: The result shown in Figure 2e is based on the ratio of the target protein expression level to the GAPDH expression level depicted in Figure 2c. Visually, the concentration of the Pitx2 band in the untreated group in Figure 2c appears low; however, the GAPDH level in the same sample is also low, which explains this outcome.

4/ Why is Am580 not used on its own (Fig. 2)? This experimental condition would constitute a relevant control.

Answer4: As described in Answer 1, AM580 stimulation was applied to L6 cells only after ATRA stimulation; therefore, we did not include results for L6 cells stimulated with AM580 alone.

Answer5: We will continue the experiment to detect the expression level of RXR in the terminal rectum of children with ARM and to investigate the effect of ATRA on RXR expression in L6 cells.

Answer6: The concentrations of ATRA and AM580 used in this study were evaluated using the CCK-8 assay to determine their effects on L6 cells, and the IC50 values were calculated. Subsequently, we will test the effects of varying concentrations of AM580 on L6 cells.

Answer7: Already noted in the article.

8/ Authors write “chemically synthesized shRNA”. What does the term “chemically” refer to in this context?

Answer8: The shRNA was designed and synthesized by a third-party company; therefore, the related description has been removed from the article.

Answer9: The corresponding content has been added to the abstract.

Reviewer #2:

Answer1: Because the only non-fluorescent plasmid or adenovirus we customized is Ad-Pitx2, we only performed immunofluorescence experiments on cells treated with ATRA+Ad-Pitx2.

I would like to take this opportunity to once again express my sincere gratitude to the editors and reviewers, and I extend my best wishes for your continued happiness and well-being!

Sincerely Yours,

Dr. Yi Wang

Attachment

Submitted filename: Response to Reviewer.docx

pone.0345764.s007.docx^{(21.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0345764.r003

Decision Letter 1

Michael Schubert

10 Mar 2026

ATRA influences the differentiation and fusion of myoblasts by regulating Rarα/Pitx2, leading to abnormal development of the pelvic floor muscles (PFMs) in fetal rats.

PONE-D-25-14533R1

Dear Dr. Wang,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support....

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Michael Schubert

Academic Editor

PLOS One

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions??>

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

3. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

4. Have the authors made all data underlying the findings in their manuscript fully available??>

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

Reviewer #1: I would like to thank the authors for their responses and arguments, which have helped to clarify several points in this article. This work now deserves to be continued in order to better define the mechanisms of action involved.

Reviewer #2: (No Response)

**********

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Reviewer #1: No

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0345764.r004

Acceptance letter

Michael Schubert

PONE-D-25-14533R1

PLOS One

Dear Dr. Wang,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS One. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

You will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Michael Schubert

Academic Editor

PLOS One

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Effects of various treatments on Rarα in L6 cells.

(DOCX)

pone.0345764.s001.docx^{(184.4KB, docx)}

S2 Fig. The effect of different plasmids on Pitx2 expression in L6 cells.

(DOCX)

pone.0345764.s002.docx^{(206.7KB, docx)}

S1 Table. Comparison of the number of malformed fetal rats between the control group and the model group.

(DOCX)

pone.0345764.s003.docx^{(16.4KB, docx)}

S3 Fig. HE staining of fetal rat sections (magnification, 40×), R: rectum, A: anus, F: fistula, B: bladder, U: urethra, C: cloaca, Red dashed lines indicate muscle areas.

(DOCX)

pone.0345764.s004.docx^{(3.4MB, docx)}

S1 File. Original WB.

(TIF)

pone.0345764.s005.tif^{(5.5MB, tif)}

Attachment

Submitted filename: Response to Reviewer.docx

pone.0345764.s007.docx^{(21.9KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting information files.

[pone.0345764.ref001] 1.Levitt MA, Peña A. Anorectal malformations. Orphanet J Rare Dis. 2007;2:33. doi: 10.1186/1750-1172-2-33 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref002] 2.deVries PA, Peña A. Posterior sagittal anorectoplasty. J Pediatr Surg. 1982;17(5):638–43. doi: 10.1016/s0022-3468(82)80126-7 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref003] 3.Sharma S. Erudition from primary posterior sagittal anorectoplasty for anorectal malformations over two decades. Pediatr Surg Int. 2023;39(1):277. doi: 10.1007/s00383-023-05559-y [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref004] 4.Bjørsum-Meyer T, Christensen P, Baatrup G, Jakobsen MS, Asmussen J, Qvist N. Dyssynergic patterns of defecation in constipated adolescents and young adults with anorectal malformations. Sci Rep. 2020;10(1):19673. doi: 10.1038/s41598-020-76841-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref005] 5.Miyake Y, Ochi T, Yamashiro Y, Seo S, Miyano G, Koga H, et al. Levator ani asymmetry and deviation in high-type anorectal malformation evaluated by magnetic resonance imaging. Pediatr Surg Int. 2022;38(5):749–53. doi: 10.1007/s00383-022-05104-3 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref006] 6.Geng Y, Mi J, Gao H, Jia H, Wang W. Spatiotemporal expression of Wnt3a during striated muscle complex development in rat embryos with ethylenethiourea-induced anorectal malformations. Mol Med Rep. 2017;15(4):1601–6. doi: 10.3892/mmr.2017.6207 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref007] 7.Millay DP, O’Rourke JR, Sutherland LB, Bezprozvannaya S, Shelton JM, Bassel-Duby R, et al. Myomaker is a membrane activator of myoblast fusion and muscle formation. Nature. 2013;499(7458):301–5. doi: 10.1038/nature12343 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref008] 8.Braun T, Gautel M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat Rev Mol Cell Biol. 2011;12(6):349–61. doi: 10.1038/nrm3118 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref009] 9.Luo W, Li E, Nie Q, Zhang X. Myomaker, regulated by MYOD, MYOG and miR-140-3p, promotes chicken myoblast fusion. Int J Mol Sci. 2015;16(11):26186–201. doi: 10.3390/ijms161125946 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref010] 10.Zhang H, Wen J, Bigot A, Chen J, Shang R, Mouly V, et al. Human myotube formation is determined by MyoD-Myomixer/Myomaker axis. Sci Adv. 2020;6(51):eabc4062. doi: 10.1126/sciadv.abc4062 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref011] 11.Shih HP, Gross MK, Kioussi C. Cranial muscle defects of Pitx2 mutants result from specification defects in the first branchial arch. Proc Natl Acad Sci U S A. 2007;104(14):5907–12. doi: 10.1073/pnas.0701122104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref012] 12.Kuriki M, Korb A, Comai G, Tajbakhsh S. Interplay between Pitx2 and Pax7 temporally governs specification of extraocular muscle stem cells. PLoS Genet. 2024;20(6):e1010935. doi: 10.1371/journal.pgen.1010935 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref013] 13.L’honoré A, Ouimette J-F, Lavertu-Jolin M, Drouin J. Pitx2 defines alternate pathways acting through MyoD during limb and somitic myogenesis. Development. 2010;137(22):3847–56. doi: 10.1242/dev.053421 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref014] 14.Daimi H, Lozano-Velasco E, Haj Khelil A, Chibani JBE, Barana A, Amorós I, et al. Regulation of SCN5A by microRNAs: miR-219 modulates SCN5A transcript expression and the effects of flecainide intoxication in mice. Heart Rhythm. 2015;12(6):1333–42. doi: 10.1016/j.hrthm.2015.02.018 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref015] 15.Mark M, Ghyselinck NB, Chambon P. Function of retinoid nuclear receptors: lessons from genetic and pharmacological dissections of the retinoic acid signaling pathway during mouse embryogenesis. Annu Rev Pharmacol Toxicol. 2006;46:451–80. doi: 10.1146/annurev.pharmtox.46.120604.141156 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref016] 16.Lee LMY, Leung C-Y, Tang WWC, Choi H-L, Leung Y-C, McCaffery PJ, et al. A paradoxical teratogenic mechanism for retinoic acid. Proc Natl Acad Sci U S A. 2012;109(34):13668–73. doi: 10.1073/pnas.1200872109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref017] 17.Wu F, Gu C, Bi Y, Guo Z, Wang Y. Folic acid rescues all-trans retinoic acid-induced anorectal malformations in rats. Birth Defects Res. 2020;112(20):1850–6. doi: 10.1002/bdr2.1810 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref018] 18.Halevy O, Lerman O. Retinoic acid induces adult muscle cell differentiation mediated by the retinoic acid receptor-alpha. J Cell Physiol. 1993;154(3):566–72. doi: 10.1002/jcp.1041540315 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref019] 19.Wang Z, Wang Q, Gu C, Zhang J, Wang Y. Abnormal serum vitamin A levels and retinoic acid receptor α expression patterns in children with anorectal malformation. Pediatr Surg Int. 2019;35(8):903–10. doi: 10.1007/s00383-019-04495-0 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref020] 20.Bitoh Y, Shimotake T, Kubota Y, Kimura O, Iwai N. Impaired distribution of retinoic acid receptors in the hindgut-tailgut region of murine embryos with anorectal malformations. J Pediatr Surg. 2001;36(2):377–80. doi: 10.1053/jpsu.2001.20721 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref021] 21.Portiér GL, Benders AG, Oosterhof A, Veerkamp JH, van Kuppevelt TH. Differentiation markers of mouse C2C12 and rat L6 myogenic cell lines and the effect of the differentiation medium. In Vitro Cell Dev Biol Anim. 1999;35(4):219–27. doi: 10.1007/s11626-999-0030-8 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref022] 22.Min G, Yang B, Yun Z, Wei J, Jie C, Tingyu L. Construction and identification of small interfering RNAs against rat retinoic acid receptor a by recombinant adenovirus. Chinese Journal of Anatomy. 2012;35(5):562–6. [Google Scholar]

[pone.0345764.ref023] 23.Montarras D, L’honoré A, Buckingham M. Lying low but ready for action: the quiescent muscle satellite cell. FEBS J. 2013;280(17):4036–50. doi: 10.1111/febs.12372 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref024] 24.Li L, Ren X, Xiao H, Wang C, Xu H, Ming A, et al. Normal anorectal musculatures and changes in anorectal malformation. Pediatr Surg Int. 2020;36(1):103–11. doi: 10.1007/s00383-019-04583-1 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref025] 25.Zhu G-H, Huang J, Bi Y, Su Y, Tang Y, He B-C, et al. Activation of RXR and RAR signaling promotes myogenic differentiation of myoblastic C2C12 cells. Differentiation. 2009;78(4):195–204. doi: 10.1016/j.diff.2009.06.001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref026] 26.Zhang W, Peng Q, Zhang X, Guo J, Tong H, Li S. Vitamin A Promotes the Repair of Mice Skeletal Muscle Injury through RARα. Nutrients. 2023;15(17):3674. doi: 10.3390/nu15173674 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref027] 27.Zhang L, Yan Y, Zhu D, Yang W, Wang W, Hu Y, et al. Nutlin-1 strengthened anti-proliferation and differentiation-inducing activity of ATRA in ATRA-treated p-glycoprotein deregulated human myelocytic leukemia cells. Invest New Drugs. 2012;30(1):37–47. doi: 10.1007/s10637-010-9512-5 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref028] 28.Zhu J, Gianni M, Kopf E, Honoré N, Chelbi-Alix M, Koken M, et al. Retinoic acid induces proteasome-dependent degradation of retinoic acid receptor alpha (RARalpha) and oncogenic RARalpha fusion proteins. Proc Natl Acad Sci U S A. 1999;96(26):14807–12. doi: 10.1073/pnas.96.26.14807 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref029] 29.Zammit PS, Partridge TA, Yablonka-Reuveni Z. The skeletal muscle satellite cell: the stem cell that came in from the cold. J Histochem Cytochem. 2006;54(11):1177–91. doi: 10.1369/jhc.6R6995.2006 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref030] 30.Knopp P, Figeac N, Fortier M, Moyle L, Zammit PS. Pitx genes are redeployed in adult myogenesis where they can act to promote myogenic differentiation in muscle satellite cells. Dev Biol. 2013;377(1):293–304. doi: 10.1016/j.ydbio.2013.02.011 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref031] 31.Evans AL, Gage PJ. Expression of the homeobox gene Pitx2 in neural crest is required for optic stalk and ocular anterior segment development. Hum Mol Genet. 2005;14(22):3347–59. doi: 10.1093/hmg/ddi365 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref032] 32.Matt N, Ghyselinck NB, Pellerin I, Dupé V. Impairing retinoic acid signalling in the neural crest cells is sufficient to alter entire eye morphogenesis. Dev Biol. 2008;320(1):140–8. doi: 10.1016/j.ydbio.2008.04.039 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref033] 33.Zhang Q, Vashisht AA, O’Rourke J, Corbel SY, Moran R, Romero A, et al. The microprotein Minion controls cell fusion and muscle formation. Nat Commun. 2017;8:15664. doi: 10.1038/ncomms15664 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref034] 34.Weintraub H, Tapscott SJ, Davis RL, Thayer MJ, Adam MA, Lassar AB, et al. Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc Natl Acad Sci U S A. 1989;86(14):5434–8. doi: 10.1073/pnas.86.14.5434 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref035] 35.Hernandez-Torres F, Rodríguez-Outeiriño L, Franco D, Aranega AE. Pitx2 in Embryonic and Adult Myogenesis. Front Cell Dev Biol. 2017;5:46. doi: 10.3389/fcell.2017.00046 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0345764.ref036] 36.Balmer JE, Blomhoff R. Gene expression regulation by retinoic acid. J Lipid Res. 2002;43(11):1773–808. doi: 10.1194/jlr.r100015-jlr200 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref037] 37.Jimi S, Mashima K, Matsumoto T, Hara S, Suzumiya J, Tamura K. RARalpha is a regulatory factor for Am-80-induced cell growth inhibition of hematologic malignant cells. Int J Oncol. 2007;31(2):397–404. doi: 10.3892/ijo.31.2.397 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref038] 38.Heldin CH, Miyazono K, ten Dijke P. TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature. 1997;390(6659):465–71. doi: 10.1038/37284 [DOI] [PubMed] [Google Scholar]

[pone.0345764.ref039] 39.Wang Q, Li J, Wu W, Shen R, Jiang H, Qian Y, et al. Smad4-dependent suppressor pituitary homeobox 2 promotes PPP2R2A-mediated inhibition of Akt pathway in pancreatic cancer. Oncotarget. 2016;7(10):11208–22. doi: 10.18632/oncotarget.7158 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

ATRA influences the differentiation and fusion of myoblasts by regulating Rarα/Pitx2, leading to abnormal development of the pelvic floor muscles (PFMs) in fetal rats

Hanbin Zhao

Jian Cao

Huaqi Mu

Yang Bi

Zhenhua Guo

Yuan Shi

Yi Wang

Roles

Abstract

Introduction

Materials and methods

Animal and housing

Cell culture and differentiation

Inhibition and activation of Rarα and Pitx2 expression

Table 1. sequence of primers.

Table 2. Nucleotide sequence of the small hairpin RNAs targeting Pitx2 mRNA.

qRT-PCR

Table 3. Sequences of primes used for PCR.

Western blot analysis

Immunofluorescence assay

Statistical analysis

Results

Poor development of the PFMs in ARM fetal rats

Expression of Pitx2, Rarα, and muscle-generating related genes in the PFMs of fetal rat

Fig 1. Expression of Rarα and Pitx2 in fetal rat PFMs.

ATRA affects the differentiation and fusion of L6 and the expression of Rarα and Pitx2

Fig 2. ATRA affects the expression of Rarα and Pitx2 in L6 cell.

Fig 3. The genes associated with differentiation and fusion in L6 cells were detected using immunofluorescence.

Rarα may affect the expression of Myod1 and Mymk through Pitx2 in L6 cells

Fig 4. Rarα affect the expression of Myod1 and Mymk through Pitx2.

Discussion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Michael Schubert

Roles

Author response to Decision Letter 1

Decision Letter 1

Michael Schubert

Roles

Acceptance letter

Michael Schubert

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases