Skip to main content
Materials Today Bio logoLink to Materials Today Bio
. 2026 Mar 31;38:103067. doi: 10.1016/j.mtbio.2026.103067

CGRP-empowered stem cell sheet/short nanofiber sponge via enhancing neurovascular coupling for bone regeneration

Yukun Jia a,1, Zhilin Wu a,1, Zhiyu Chen a,1, Dagang Tang a, Ningdao Li a, Yanran Huang a, Runhan Zhao a, Yafei Zhu a, Juan Wang b,, Xiaoji Luo a,c,⁎⁎, Jun Zhang a,⁎⁎⁎
PMCID: PMC13091065  PMID: 42006713

Abstract

Functional repair of critical-sized bone defects is highly dependent on the synergistic establishment of a neurovascularized microenvironment. However, current strategies face a critical bottleneck: the lack of effective coupling and synchronization between newly formed blood vessels and regenerating nerves. This “decoupling” results in immature vascular network and absent neurotrophic support, which subsequently limits osteogenic activity and ultimately leads to the formation of low-quality repair tissue with insufficient blood supply and neural innervation, severely restricting functional healing of bone defects. To address this challenge, we developed a calcitonin gene-related peptide (CGRP)-empowered composite delivery system consisting of stem cell sheets and short nanofiber sponges. The system was fabricated by embedding CGRP-loaded polydopamine microspheres into bone marrow mesenchymal stem cell sheets, which were then assembled with poly-L-lysine-modified short nanofiber sponges through electrostatic interactions. Multidimensional analysis of neural and vascular markers revealed that CGRP not only rapidly initiated angiogenesis and recruited neural ingrowth, but also synergistically interacted with endogenous CGRP secreted by newly formed nerves, thereby establishing a self-sustaining positive feedback loop that achieved tight coupling and coordinated regeneration of nerve-vessel-bone networks. This process enhanced osteogenic differentiation capacity through activation of the MAPK/ERK signaling pathway. Both in vitro and in vivo experiments demonstrated that this system effectively promoted the coordinated regeneration of neural, vascular, and bone tissues, significantly improving bone defect repair efficiency. This study provides a functional strategy with significant translational potential for overcoming clinical bottlenecks in neurovascularized bone regeneration.

Keywords: Bone regeneration, CGRP, BMSCs sheets, Neurovascular regulation, Short nanofibrous sponges

Graphical abstract

The CGRP-empowered Stem Cell Sheet/Short Nanofiber Sponge synergistically promotes osteogenic differentiation, angiogenesis, and neurogenesis through activation of the MAPK/ERK signaling pathway. By establishing a neurovascularized microenvironment, this integrated regulatory mechanism significantly accelerates the repair of critical-sized bone defects, demonstrating superior regenerative outcomes compared to conventional approaches.

Image 1

Highlights

  • A novel scaffold system synchronizes nerve and blood vessel growth for bone repair.

  • Sustained peptide release creates self-reinforcing regeneration in damaged bone.

  • Engineered cell sheets combined with nanofibers mimic natural bone environment.

  • New strategy accelerates functional bone healing through coupled tissue regeneration.

1. Introduction

Bone defect repair represents a major challenge in modern medicine, posing serious threats to patient health [1]. Bone tissue is a complex structure enriched with nerve and vascular networks, which not only provide essential nutrients and growth factors for bone growth but also play a critical role in regulating osteogenesis [2,3]. Studies have demonstrated that early establishment of neurovascular networks is crucial for bone regeneration [4,5]. Specifically, the vascular system supplies oxygen and nutrients necessary for tissue healing [6], while bioactive factors such as calcitonin gene-related peptide (CGRP) released by neural cells stimulate bone repair and modulate inflammatory responses [7,8]. Notably, neural innervation enhances the expression of vascular endothelial growth factor, creating a favorable microenvironment for vascular regeneration and forming a positive feedback loop that accelerates bone defect repair [9]. To harness this neurovascular coupling mechanism, current strategies for nerve-vessel-bone regeneration primarily include: (1) co-delivery of multiple growth factors to simultaneously stimulate osteogenesis, angiogenesis, and neurogenesis [10]; (2) construction of vascularized tissue-engineered bone grafts through pre-vascularization or microfluidic technologies [11,12]; and (3) development of bioactive scaffolds with neurotrophic properties using conductive materials [13]. However, these approaches face significant limitations including complex manufacturing processes, inadequate spatiotemporal coordination of multi-factor release, insufficient recreation of the native neurovascular microenvironment, and suboptimal nerve-vessel synergistic regeneration efficiency, which collectively hinder their clinical translation [[14], [15], [16], [17], [18]]. Therefore, constructing multifunctional scaffolds capable of systematically activating neurovascular synergistic regeneration and enhancing osteogenesis has become a core challenge and research hotspot in contemporary bone tissue engineering.

CGRP is a neurotransmitter predominantly distributed in the periosteum and bone marrow that plays a pivotal role in fracture healing. At the molecular level, CGRP promotes neuronal survival and axonal growth by activating its receptor and downstream signaling pathways such as PI3K/Akt, while upregulating the expression of proangiogenic factors including vascular endothelial growth factor and fibroblast growth factor [[19], [20], [21]]. At the tissue level, CGRP establishes a neurovascularized microenvironment by synergistically enhancing neural innervation and angiogenesis, thereby creating essential support for bone regeneration. This neurovascular coupling effect effectively promotes the invasion of neurovascular networks into bone defect sites and activates osteogenic differentiation of periosteal stem cells and BMSCs, thereby providing comprehensive microenvironmental support for bone regeneration.

Cell sheet technology (CST), as a scaffold-free form of tissue engineering, serves as a natural carrier system enabling precise delivery and retention of cells at injury sites. This technology constructs detachable tissue layers through cell proliferation and endogenous extracellular matrix (ECM) formation, and has demonstrated tremendous potential in the repair of cartilage, cardiac tissue, cornea, and other fields [[22], [23], [24]]. CST enables the harvest of seed cells without enzymatic digestion, thereby preserving abundant ECM and intercellular connections. Studies have shown that ECM plays a critical role in recruiting abundant endogenous stem cells or progenitor cells to injury sites and promoting self-healing of lesions [25,26]. Through dynamic interactions with surrounding cells, ECM plays an important role in cell proliferation and differentiation [26]. In the field of bone regeneration, CST has been employed to enhance allograft integration and improve repair outcomes [27]. More importantly, CST can mimic the function of periosteum, providing nutrition to bone defects and promoting bone regeneration [27]. In recent years, numerous studies have utilized CST to promote bone regeneration. For instance, Xie et al. [28] developed human ethmoid sinus mucosa-derived mesenchymal stem cell sheets and demonstrated their effective promotion of bone regeneration, representing a promising approach for accelerating bone regeneration. Qi et al. [29] combined rat bone marrow mesenchymal stem cells (BMSCs) sheets with calcium phosphate particles and platelet-rich fibrin gel, finding that this composite material significantly promoted bone regeneration at defect sites. You et al. [30] utilized a mechanical system to fabricate human amniotic mesenchymal stem cell sheets and demonstrated their significant efficacy in cartilage regeneration. Although CST has demonstrated broad application prospects in tissue repair, conventional cell sheet technology still possesses limitations, particularly when lacking neurovascular network support, where its efficacy in tissue repair is often constrained. Therefore, developing novel CST strategies capable of integrating neurovascular networks holds significant importance for further enhancing its application efficacy in bone regeneration.

In this study, we propose an innovative strategy for promoting the repair of critical-sized bone defects by constructing a CGRP-empowered stem cell sheet/short nanofiber sponge (NS) (CGRP/BMSCs sheet/NS) to achieve synergistic regeneration of nerve-vessel-bone (Scheme 1). Compared to existing multi-factor delivery strategies that require complex formulation and face challenges in spatiotemporal coordination, our approach leverages CGRP as a single bioactive molecule to simultaneously activate neurovascular coupling, integrated within a functionalized cell sheet platform for precise delivery. This design offers three key innovations: (1) a sustained and controlled CGRP delivery system based on polydopamine microspheres that overcomes the limitations of traditional direct administration; (2) a functionalized BMSCs sheet empowered with neurogenic and angiogenic capacity, serving as both a living cell carrier and a bioactive factor delivery platform; and (3) a synergistic nerve-vessel-bone regeneration strategy that achieves systematic neurovascular coupling through molecular-cellular-structural multi-level coordination, avoiding the complexity of multi-factor systems.Specifically, CGRP-loaded polydopamine microspheres were integrated with BMSCs sheets to achieve sustained CGRP release, empowering the stem cell sheets to enhance neurogenic and angiogenic capacity. Subsequently, poly-L-lysine-modified short nanofiber sponges were fabricated via electrospinning technology to provide a three-dimensional supportive microenvironment for cell growth, migration, and differentiation. Through electrostatic interactions, the CGRP-functionalized stem cell sheets were precisely assembled with the short nanofiber sponges to construct a biomimetic composite system with a bilayer structure. The morphological structure, mechanical properties, CGRP release behavior, and biocompatibility of the scaffold were systematically characterized. Building upon this foundation, the regulatory effects of the CGRP/BMSCs sheet/NS on neurogenic differentiation, angiogenesis, and osteogenic differentiation of BMSCs were systematically investigated at the cellular and molecular levels, with transcriptomic sequencing analysis revealing potentially involved key signaling pathways. Finally, the in vivo repair efficacy of the CGRP/BMSCs sheet/NS in promoting early neurovascularization and bone tissue regeneration was validated in a rat calvarial defect model, with elucidation of its underlying molecular mechanisms. The CGRP-empowered stem cell sheet/short nanofiber sponge proposed in this study provides a functional strategy with significant clinical translation prospects for neurovascularized bone regeneration.

Scheme 1.

Scheme 1

Schematic illustration of the CGRP-empowered stem cell sheet/short nanofibrous sponge for bone defect repair. The system design integrates bioactive components to promote neurovascularized bone regeneration. a) Design of the NS scaffold, providing a porous matrix support; b) Design of the BMSCs sheet; c) Synthesis of CGRP@MPDA and assembly of the CGRP/BMSCs sheet/NS; d) The system enhances osteogenic differentiation, angiogenesis, and neurogenesis through activation of the MAPK signaling pathway, ultimately accelerating bone defect repair.

2. Materials and methods

2.1. Preparation and characterization of CGRP-loaded mesoporous

Polydopamine Nanoparticles: Synthesis of MPDA Nanoparticles: Mesoporous polydopamine (MPDA) nanoparticles were synthesized using a “soft-template” method. In a clean 4-L reaction flask, 1.5 mL of ethanol solution containing 50 mg Pluronic F-127 (Sigma-Aldrich, USA), 1.5 mL of aqueous solution containing 15 mg dopamine (Sigma-Aldrich, USA), and 20 mL of 1,3,5-trimethylbenzene (Sigma-Aldrich, USA) were mixed. After ultrasonication until completely clear, 90 μL of NH3·H2O (Sigma-Aldrich, USA) was added, and the mixture was stirred to promote dopamine polymerization. After reacting at room temperature for 60 min, the soft template F-127, 1,3,5-trimethylbenzene, and unreacted dopamine were removed by high-speed centrifugation (12,000 rpm, 10 min), and the precipitate was washed three times each with deionized water and ethanol. Finally, the precipitate was resuspended in ultrapure water, lyophilized, and stored at −20 °C until use.

CGRP Loading: CGRP (α-CGRP, ≥95% purity by HPLC, MW 3789.36 Da, MedChemExpress, USA) was loaded onto MPDA nanoparticles via an adsorption method. Briefly, 10 mg of MPDA nanoparticles were dispersed in 5 mL of PBS (pH 7.4) and sonicated for 10 min. Subsequently, 2 mg of CGRP (dissolved in PBS at 1 mg/mL; GenScript, USA) was added to the MPDA dispersion (MPDA:CGRP mass ratio of 5:1), and the mixture was stirred at room temperature (25 °C) for 1 h to facilitate CGRP binding via catechol groups of polydopamine. After the reaction, MPDA@CGRP nanoparticles were collected by centrifugation (12,000 rpm, 10 min), washed three times with PBS to remove unbound CGRP, lyophilized, and stored at −20 °C until use.

The morphology of nanoparticles was observed by SEM. The average diameter and zeta potential of nanoparticles were measured using a dynamic light scattering (DLS) instrument. Additionally, the distribution of CGRP within the nanoparticles was evaluated using a confocal laser scanning microscope (Zeiss, Germany). To assess the release behavior of CGRP, 2 mg of CGRP-loaded MPDA nanoparticles were immersed in 10 mL phosphate-buffered saline (PBS) and incubated at 37 ± 1 °C for 28 days. At days 3, 7, 14, 21, and 28, 8 mL of sample solution was collected, and the CGRP concentration was determined using an enzyme-linked immunosorbent assay (ELISA) kit (Elabscience, China). Four parallel measurements were performed in each experiment to obtain the mean value. After each sampling, 8 mL of fresh PBS was replenished, and incubation was continued at 37 ± 1 °C to evaluate the subsequent release behavior.

The pH of the release medium and the zeta potential of nanoparticles were monitored throughout the degradation process. The pH was measured using a calibrated pH meter at 37 °C before each sampling time point. The zeta potential was determined at day 0, 7, 14, 21, and 28 using dynamic light scattering after gentle mixing of the nanoparticle suspension.

2.2. Isolation of BMSCs

Four-week-old male Sprague-Dawley (SD) rats were euthanized by intraperitoneal injection of an overdose of pentobarbital sodium to harvest BMSCs. The rat carcasses were immersed in 75% ethanol for disinfection for 30 min, after which bilateral femurs were isolated and rinsed three times (5 min each) with PBS containing 100 μg mL−1 streptomycin and 200 U mL−1 penicillin. Subsequently, bone marrow cavity cells were flushed and transferred to alpha-modified Eagle's minimum essential medium (α-MEM; Boster, China) containing 10% fetal bovine serum (FBS; Servell, China), 100 μg mL−1 streptomycin, and 200 U mL−1 penicillin for culture. Cells were passaged upon reaching 90%–95% confluence, and passage 3 cells were used for subsequent experiments. All animal experiments were approved by the Institutional Animal Care and Use Committee of Chongqing Medical University (Approval ID: IACUC-CQMU-2025-0466; Chongqing, China) and conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals.

2.3. Fabrication and characterization of BMSCs sheets

BMSCs were seeded in 6 cm culture dishes at a density of 1 × 106 cells cm−2. After culturing in normal medium for 2 days, the medium was replaced with cell sheet induction medium containing 10% (v/v) FBS, 50 μg mL−1 ascorbic acid, 1% (v/v) penicillin/streptomycin (P/S), 1% (v/v) glutamine, and 1% (v/v) non-essential amino acids. The medium was changed every two days, and BMSCs were continuously cultured without passaging to form dense cell sheets. After 7 days of culture, BMSCs sheets formed at the bottom of the culture dishes. Subsequently, the cell sheets were harvested from the dishes using a cell scraper and subjected to the following characterization experiments.

First, the morphology of BMSCs sheets was evaluated by macroscopic observation. Next, the cellular morphology of the cell sheets was observed under a microscope. After completion of cell sheet culture, BMSCs sheets were stained with a live/dead assay kit according to the manufacturer's instructions to assess cell viability. Additionally, the cytoskeleton was stained with FITC-labeled phalloidin, nuclei were stained with DAPI, and cellular morphology analysis was performed after fixation of the cell sheets. Observation was then conducted using a confocal laser scanning microscope (Zeiss, Germany). Furthermore, the surface structure of BMSCs sheets was examined using scanning electron microscopy (SEM). For histological evaluation, BMSCs sheets were fixed in 4% (w/v) buffered paraformaldehyde, dehydrated through graded ethanol series, embedded in paraffin, and sectioned. The sections were stained using hematoxylin-eosin (HE) staining to observe the tissue structure of the cell sheets. In addition, the expression level of type I collagen in the cell sheets was detected using immunofluorescence staining.

2.4. Fabrication of CGRP/BMSCs sheet

MPDA@CGRP nanoparticles were dispersed in PBS at pH 7.4 to prepare a nanoparticle suspension at a concentration of 2 mg mL−1. Then, 100 μL of the suspension was uniformly dropped onto the surface of BMSCs sheets and allowed to stand for 30 min at room temperature to facilitate nanoparticle adsorption. Subsequently, the scaffold surface was gently rinsed with PBS to remove unbound nanoparticles, forming a CGRP/BMSCs sheet for subsequent experiments.

2.5. Fabrication of three-dimensional short NS

Collagen/poly lactic acid (Col/PLA, w/w = 80:20) nanofibers (NF) were fabricated via electrospinning according to previous methods [31]. Collagen (Sigma-Aldrich, USA) and PLA (Sigma-Aldrich, USA) were dissolved at a mass ratio of 80:20 in 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP; Sigma-Aldrich, USA) to prepare a 10% (w/v) spinning solution. Electrospinning parameters were as follows: applied voltage of 18 kV, needle-to-collector distance of 15 cm, and solution flow rate of 3.0 mL/h. The resulting nanofiber mats were dried in a vacuum oven at room temperature for 48 h.

After fabrication, the nanofiber mats were cut into small pieces and dispersed in tert-butanol. The nanofibers were then homogenized using a high-speed homogenizer (IKA, Germany) to uniformly pulverize the fiber fragments, followed by freeze-drying to obtain a three-dimensional porous NS. Finally, the NS scaffolds were chemically crosslinked to enhance their structural stability and mechanical properties.

2.6. Preparation of scaffold extracts

Due to the difficulty in directly observing cell morphology on the NS scaffold surface and the interference caused by dye absorption, a scaffold extract method was employed to indirectly evaluate the effects of NS on BMSC viability, adhesion, and proliferation. Briefly, the scaffolds were immersed in serum-free medium and incubated at 37 °C in 5% CO2 for 3 days. Subsequently, the medium was collected, supplemented with 10% FBS, and filtered through a 0.22-μm filter (Millipore, USA) to obtain scaffold extracts containing 10% FBS for subsequent cell culture.

2.7. Fabrication of CGRP/BMSCs sheet/NS

CGRP/BMSCs sheets were assembled with NS through electrostatic interactions and pre-cultured in normal medium (α-MEM + 10% (v/v) FBS) for 24 h to ensure sufficient integration of BMSCs sheets with the scaffolds, forming a CGRP/BMSCs sheet/NS.

2.8. Assessment of neurogenic differentiation potential

Immunofluorescence Staining: The protein expression of neuronal differentiation marker TUBB3 (β-III-tubulin) and SOX10 in BMSCs sheets was detected by immunofluorescence staining. Cells were fixed with 4% PFA for 15 min, permeabilized with 0.1% Triton X-100 for 10 min, and blocked with 5% BSA for 1 h. Subsequently, cells were incubated with anti-TUBB3 primary antibody (1:200 dilution; Abcam, UK) at 4 °C overnight. After washing three times with PBS, cells were incubated with Alexa Fluor 488-conjugated secondary antibody (1:500 dilution; Invitrogen, USA) for 1 h at room temperature in the dark. Nuclei were counterstained with DAPI, and images were captured using a laser scanning confocal microscope (LSM 880, Zeiss, Germany). Fluorescence intensity of TUBB3 was quantified using ImageJ software.

Quantitative Real-Time PCR (qRT-PCR): The mRNA expression levels of neurogenic differentiation-related genes in BMSCs sheets were detected by qRT-PCR. Total RNA was extracted using TRIzol reagent (Invitrogen, USA), and cDNA was synthesized using a reverse transcription kit (TaKaRa, Japan). Using GAPDH as the internal reference gene, qRT-PCR was performed using SYBR Green PCR Master Mix (TaKaRa, Japan) on a real-time PCR system (ABI 7500, Applied Biosystems, USA). Target genes included TUBB3 and S100β, with primer sequences listed in Table 1. Relative expression levels were calculated using the 2^(-ΔΔCt) method.

Table 1.

Sequences of primers for qRT-PCR experiments.

Gene Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
GADPH TTCCAGGAGCGAGACCCCACTA GGGCGGAGATGATGACCCTTTT
RUNX2 TCTTTTGGGATCCGAGCACC ATCTCCACCATGGTGCGGTT
OCN GCCCTGACTGCATTCTGCCTCT TCACCACCTTACTGCCCTCCTG
SPARC CCACTCGCTTCTTTGAGACC TAGTGGAAGTGGGTGGGGAC
CD31 CACCGTGATACTGAACAGCAA GTCACAATCCCACCTTCTGTC
CD34 CACCAGAGCTATTCCCGAAA TTCTGTGTCAGCCACCACAT
VEGF CATAGGAGAGATGAGCTTCCTGC CTCTGAACAAGGCTCACAGTGATTTTC
TUBB3 CAACTATGTGGGGGACTCGG TGGCTCTGGGCACATACTTG
S100β CAGGAGCCTCCGGGATGT TCCTGCTCTTTGATTTCCTCCA
nestin TGCAGGCCACTGATAAGTTCCA TTCTCCTGCTCCAGGGCTTCCA

2.9. Assessment of angiogenic potential

Human umbilical vein endothelial cells (HUVECs) are immortalized cell lines obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China).The expression of endothelial markers CD31 and CD34 in BMSCs within the BMSC sheets was observed through immunofluorescence staining. In addition, qRT-PCR was employed to evaluate the mRNA levels of angiogenesis-related genes (including CD31 and CD34) in BMSCs within the BMSC sheets, with primer sequences listed in Table 1.

The expression of endothelial markers CD31 and CD34 in BMSCs within BMSCs sheets was observed by immunofluorescence staining. In addition, the mRNA levels of angiogenesis-related genes (including CD31 and CD34) in BMSCs within BMSCs sheets were evaluated using qRT-PCR, with primer sequences listed in Table 1.

2.10. Assessment of osteogenic differentiation

Matrix mineralization and osteogenic potential of BMSCs were evaluated by alizarin red S (ARS) staining and alkaline phosphatase (ALP) staining, respectively, according to the manufacturers' protocols. In addition, the mRNA and protein expression levels of osteogenesis-related genes in BMSCs were detected using qRT-PCR and Western blotting (WB) according to the manufacturer's instructions, with primer sequences listed in Table 1. The osteogenesis-related genes in this study included osteocalcin (OCN), osteopontin (OPN), and runt-related transcription factor 2 (RUNX2). Furthermore, the protein expression levels of OPN and OCN in BMSCs were detected by immunofluorescence staining.

2.11. Transcriptome sequencing and bioinformatics analysis

To identify the differential expression of RNA transcripts between BMSCs treated with BMSCs sheet/NS and CGRP/BMSCs sheet/NS, whole-genome transcriptome sequencing was performed. Differential expression analysis between groups was conducted using the DESeq2 R package (n = 4). Differential gene expression levels were considered statistically significant when P < 0.05 as determined by DESeq2. In addition, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed. To investigate pathway activation, BMSCs were seeded on NS scaffolds and CGRP/BMSCs sheet/NS composites and cultured for 7 days, and the expression of pathway genes was detected by WB.

2.12. In vivo osteogenesis

In this study, all animal experiments were conducted in accordance with the ARRIVE guidelines. Male SD rats (body weight approximately 300–350 g) were anesthetized by intraperitoneal injection of 2% sodium pentobarbital. After shaving and disinfecting the surgical area, the skin was incised along the midline and the periosteum was stripped. Subsequently, a critical-sized bone defect with a diameter of 5 mm was created on the calvarium using a trephine bur. The experiment was divided into four groups: Group A (control group, defect left uncovered, n = 12); Group B (BMSCs sheet group, defect covered with BMSCs sheets, n = 12); Group C (BMSCs sheet/NS group, defect covered with BMSCs sheet/NS composite, n = 12); Group D (CGRP/BMSCs sheet/NS group, defect covered with CGRP/BMSCs sheet/NS composite, n = 12). Penicillin was administered for three consecutive days postoperatively to prevent infection. Rats were euthanized at 4 and 8 weeks postoperatively, and cranial specimens were collected for further evaluation. First, micro-computed tomography (micro-CT) scanning was performed to assess bone regeneration in the defect area under different treatment conditions.

2.13. Histological evaluation

At 4 and 8 weeks postoperatively, cranial specimens were collected and fixed in 4% paraformaldehyde at room temperature for 24 h, followed by decalcification for approximately 2 weeks. Subsequently, the specimens were embedded in paraffin for histological sectioning. Centered on the defect area, the embedded specimens were sectioned into 5 μm-thick histological sections and subjected to hematoxylin–eosin (HE) staining and Masson's trichrome staining, respectively, for histological evaluation.

2.14. Statistical analysis

Data are expressed as mean ± standard deviation (Mean ± SD). Statistical analyses were performed using Origin 21 software (USA). For comparisons between two groups, independent samples t-tests were conducted. For comparisons among multiple groups, one-way analysis of variance (one-way ANOVA) was performed, followed by Tukey's multiple comparison test to assess the statistical significance of differences between groups. Statistical significance is indicated as ∗P < 0.05,∗∗P < 0.01,∗∗∗P < 0.001.

3. Results

3.1. CGRP promotes migration, osteogenesis, angiogenesis, and neurogenesis of BMSCs

Bone healing is a complex physiological process involving the synergistic actions of neurogenesis, angiogenesis, and osteogenesis, where the integration of neurovascular networks is essential for the formation of functional bone tissue. CGRP can simultaneously regulate these processes, thereby accelerating neurovascular integration in the periosteum and creating a favorable microenvironment for bone regeneration.

Transwell assays demonstrated that CGRP significantly promoted BMSCs migration in a dose-dependent manner (Fig. 1A). Immunofluorescence staining further confirmed dose-dependent enhancement of RUNX2 expression by CGRP (Fig. 1B). Subsequently, alkaline phosphatase (ALP) and alizarin red S (ARS) staining assessed osteogenic differentiation, revealing that ALP activity and mineralization nodules in the 10 nM and 100 nM CGRP groups were significantly higher than in the 1 nM group and control group, indicating dose-dependent promotion of BMSCs osteogenesis by CGRP (Fig. 1C). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) detection of osteogenic–related genes (RUNX2, OPN, OCN) showed expression levels consistent with the above results, confirming CGRP's pro-osteogenic effects (Fig. 1D).

Fig. 1.

Fig. 1

CGRP promotes migration, osteogenesis, angiogenesis, and neurogenesis of BMSCs. A) Transwell migration assay of BMSCs (n = 6); B) Immunofluorescence staining of RUNX2 (n = 6); C) ALP and ARS staining of different treatment groups (n = 6); D) RT-qPCR of RUNX2 and OCN in different treatment groups (n = 6); E) Immunofluorescence staining of TUBB3 (n = 6); F) RT-qPCR of TUBB3 and nestin in different treatment groups (n = 6); G) Immunofluorescence staining of CD31; H) RT-qPCR of CD31 and VEGF in different treatment groups (n = 6).

Further studies using immunofluorescence and qRT-PCR revealed that 10 nM and 100 nM CGRP promoted BMSCs differentiation toward TUBB3-positive (neural marker) and CD31-positive (vascular marker) cells (Fig. 1E, F, G, and H). Based on dose-response analysis, 10 nM was selected as the optimal concentration. These results reveal that CGRP, through synergistic regulation of osteo-neuro-vascular coupling, provides a molecular basis for constructing neurovascularized bone regeneration microenvironments.

3.2. Preparation and Characterization of CGRP-loaded MPDA nanoparticles

As described in previous studies [32], MPDA nanoparticles, due to their abundant phenolic hydroxyl groups, can adsorb various molecules via electrostatic interactions and hydrogen bonding. CGRP, a positively charged peptide with multiple amine groups, can be effectively loaded onto MPDA. In this study, MPDA nanoparticles were successfully prepared by self-assembly of Pluronic F127 and primary polydopamine nanoparticles at the water/1,3,5-trimethylbenzene (TMB) interface, resulting in smooth-surfaced, uniform-sized particles (Fig. 2A). The encapsulation efficiency (EE) and loading efficiency (LE) of MPDA nanoparticles were determined by measuring the free CGRP content in the supernatant after centrifugation. The EE and LE were calculated to be 61.05 ± 1.87% and 32.51 ± 2.15%, respectively.

Fig. 2.

Fig. 2

Preparation and Characterization of CGRP-Loaded MPDA Nanoparticles. A) SEM image of MPDA nanoparticles; B) Size distribution (DLS) of MPDA and MPDA@CGRP nanoparticles, with diameters of 205 nm and 245 nm, respectively (n = 3); C) Zeta potential of MPDA and MPDA@CGRP nanoparticles (n = 3); D) UV-Vis spectra of MPDA, CGRP, and MPDA@CGRP nanoparticles, displaying characteristic absorption peaks at 195 nm; E) Fourier transform infrared (FTIR) spectra of MPDA, CGRP, and MPDA@CGRP nanoparticles; F) Bright-field and fluorescence images of MPDA@CGRP (red representing Cy5-labeled CGRP), with fluorescence overlapping particle boundaries; G) Cumulative release curve of CGRP from MPDA@CGRP nanoparticles in PBS (pH 7.4), showing initial burst followed by sustained release (n = 6); H) Cell proliferation assay images of BMSCs treated with MPDA@CGRP (n = 6); I) Semi-quantitative results of cell proliferation assay (n = 6); J) CCK-8 assay results, confirming MPDA@CGRP promotion of BMSCs proliferation (n = 6). ∗P < 0.05,∗∗P < 0.01,∗∗∗P < 0.001.

DLS analysis showed hydrodynamic diameters of 205 nm for MPDA and 245 nm for MPDA@CGRP (Fig. 2B). Zeta potential measurements indicated a rebound in potential for MPDA@CGRP after loading positively charged CGRP onto negatively charged MPDA (Fig. 2C). During the 28-day degradation process, the zeta potential of MPDA@CGRP gradually shifted from positive to negative as CGRP was released (Supplementary Fig. S1), while the pH remained stable. UV–Vis spectra detected characteristic absorption peaks for MPDA, CGRP, and MPDA@CGRP at 195 nm (Fig. 2D). Fourier transform infrared (FTIR) spectra further confirmed that MPDA@CGRP retained the same characteristic peaks as CGRP, indicating successful loading (Fig. 2E). To visualize loading efficiency, CGRP was labeled with Cy5 fluorescent dye and loaded onto MPDA. Confocal microscopy imaging revealed strong red Cy5 fluorescence at nanoparticle locatio ns, precisely overlapping with particle boundaries in bright-field images, confirming successful encapsulation of CGRP (Fig. 2F).

Transwell assays verified that MPDA@CGRP significantly promoted migration of BMSCs and HUVECs (Supplementary Fig. S2). In vitro release experiments (PBS, pH 7.4) showed an initial burst release of approximately 50% CGRP within the first 7 days, followed by a sustained release phase, reaching a cumulative release of about 80% by day 28 (Fig. 2G). CGRP concentrations in the release solution increased in a time-dependent manner: 28.54 μg/mL (14.27 %), 89.47 μg/mL (44.74 %), 124.15 μg/mL (62.58 %), and 154.13 μg/mL (77.07 %) at days 1, 3, 7, and 14, respectively (Supplementary Fig.S3). These results demonstrate that the porous structure of MPDA enables controlled and sustained release of CGRP, with good stability for long-term induction of BMSCs osteogenesis.

Furthermore, CCK-8 and cell proliferation assays confirmed that MPDA@CGRP significantly promoted BMSCs proliferation without significant toxicity (Fig. 2H, I and J). Overall, MPDA nanoparticles serve as an efficient delivery vehicle for CGRP, maintaining its bioactivity while achieving controlled release, providing an ideal platform for bone regeneration applications.

3.3. Construction and characterization of CGRP/BMSCs sheets

First, for the preparation of BMSC sheets, BMSCs were cultured in culture medium for 7 days. After this period, the high-density BMSCs rapidly proliferated and formed BMSC sheets in the culture dish. As shown in Fig. 3A, the BMSCs sheets exhibited a white, translucent membrane-like structure that could be completely detached from the bottom of the culture plate and easily folded into specific shapes (Fig. 3B). Uniform cell arrangement was observed under an inverted microscope (Fig. 3C). The morphology of the sheets was further examined by laser confocal microscopy, revealing that the cell sheets were populated with abundant elongated spindle-shaped cells arranged in a compact manner (Fig. 3D). Subsequently, cell viability in the BMSCs sheets was assessed by live/dead staining. The results showed that the majority of cells in the sheets were viable (green fluorescence), with only a few dead cells (red fluorescence), indicating that the induced BMSCs sheets maintained good cell viability (Fig. 3E). Scanning electron microscope (SEM) was employed to further examine cell arrangement and ECM secretion in the BMSCs sheets. As shown in the figure, abundant ECM was formed around the BMSCs, with cells distributed uniformly and arranged compactly, demonstrating good intercellular connections and matrix secretion capacity (Fig. 3F). In addition, H&E staining revealed that the BMSCs sheets were composed of abundant cells capable of secreting rich ECM (Fig. 3G). Immunofluorescence staining showed that the cell sheets contained abundant collagen I (Cy3-labeled) secreted by BMSCs, further confirming the extracellular matrix components of the cell sheets (Fig. 3H).

Fig. 3.

Fig. 3

Construction and characterization of BMSCs sheets. A) Schematic illustration of BMSCs sheet acquisition; B) Macroscopic photographs of BMSCs sheets. The BMSCs sheets possessed good mechanical toughness and could be retrieved from the well plates and folded into specific shapes (n = 3); C) Microscopic observation of BMSCs sheets (n = 3); D) Phalloidin staining of BMSCs sheets, with blue indicating cell nuclei. Abundant elongated spindle-shaped cells were distributed throughout the BMSCs sheets (n = 3); E) Live/dead cell staining of BMSCs sheets, with green indicating viable cells and red indicating dead cells (n = 3); F) Microstructure of BMSCs sheets (surface and cross-section of BMSCs sheets examined by SEM) (n = 3); G) H&E staining of BMSCs sheets, showing that the BMSCs sheets were composed of abundant ECM and numerous cells (n = 3); H) Immunofluorescence staining of BMSCs sheets, demonstrating that the BMSCs sheets contained abundant collagen type I (n = 3). I) MPDA nanoparticles and BMSCs sheets; J) CGRP-loaded MPDA nanoparticles located on BMSCs sheets, with arrows indicating MPDA nanoparticles.

Subsequently, we constructed CGRP/BMSCs sheets. Specifically, an aqueous solution of CGRP-loaded MPDA nanoparticles was first uniformly dropped onto the surface of BMSCs sheets, after which the cell sheets were carefully wrapped around NS scaffolds to construct CGRP/BMSCs sheets (Fig. 3I). To verify the construction efficacy, the system was observed under an inverted microscope. The results showed that CGRP-loaded MPDA nanoparticles were uniformly distributed within the BMSCs sheets (Fig. 3J). Furthermore, H&E staining analysis of the CGRP-loaded cell sheets was performed to further reveal their histological characteristics. The results showed that BMSCs in the sheets were arranged in an orderly manner with multilayered dense distribution, and the extracellular matrix exhibited no obvious voids or necrotic areas (Supplementary Fig.S4). Moreover, MPDA nanoparticles displayed no cytotoxicity (live/dead staining, Supplementary Fig.S5).

3.4. Preparation and characterization of NS scaffolds

The preparation of NS scaffolds involved three key steps: electrospinning, nanofiber homogenization, and crosslinking. First, gelatin/polylactide NF were fabricated using electrospinning technology, resulting in a white membrane primarily composed of gelatin (Fig. 4A). Subsequently, these nanofibers were uniformly pulverized using a high-speed homogenizer (Fig. 4B). Finally, the fragmented fibers were dispersed in tert-butanol and lyophilized to obtain porous short fiber scaffolds (NS, uncrosslinked). Uncrosslinked NS could not maintain structural stability in water, so glutaraldehyde was used for chemical crosslinking to stabilize the three-dimensional structure and enhance mechanical properties (Fig. 4C). After crosslinking, the scaffolds were immersed in 5% glycine/HCl solution for 48 h to remove residual glutaraldehyde. As shown in Fig. 4D, the crosslinked NS maintained a stable and intact morphology in PBS.

Fig. 4.

Fig. 4

Preparation and Characterization of NS Scaffolds. A) Macroscopic image of NF, appearing as a white membrane; B) Macroscopic image of NF cut into blocks, showing fragments before homogenization; C) Macroscopic image of NS scaffold, displaying porous three-dimensional structure; D) Macroscopic image of NS scaffold after immersion in PBS, confirming structural stability post-crosslinking; E) Typical SEM images of NF and NS scaffolds at different magnifications, with NF showing smooth surfaces and NS composed of randomly arranged short fibers (n = 3); F) H&E staining, revealing uniform short fibers and ECM-like structure in the scaffold (n = 3); G) Phalloidin staining (F-actin, red fluorescence), illustrating fiber arrangement and cytoskeleton mimicry (n = 3); H) Nanofiber diameter distribution of NF and NS scaffolds, with no statistical difference (n = 6); I) Porosity comparison between NF and NS scaffolds, with NS significantly higher (88.9% vs. 61.3%) (n = 6); J) Water absorption rate curves for NS scaffold and BMSCs sheet/NS scaffold (n = 6); K) Swelling rate curves, higher for BMSCs sheet/NS (n = 6); L) Water absorption reversibility test, showing no significant change in absorption rate after compression cycles (n = 6).

SEM observation revealed that NF had a smooth surface, while NS consisted of randomly arranged short fibers, mimicking the structure of natural ECM and facilitating cell adhesion and growth (Fig. 4E). H&E staining and phalloidin staining further confirmed that NS was composed of short fibers with uniform diameter and size, demonstrating a highly homogeneous structure (Fig. 4F and G). Fiber diameter analysis showed no statistical difference between NF and NS (Fig. 4H). Although individual fiber diameters exhibit a certain range of distribution during the electrospinning process due to fluctuations in electric field intensity, variations in solution flow rate, and environmental factors, this microscale diameter distribution is an inherent characteristic of electrospinning technology and remains within an acceptable range. Notably, this moderate diameter variation does not compromise the overall performance of the scaffold; rather, it better mimics the diversity of fiber diameters in native extracellular matrix (ECM), which is beneficial for cell adhesion, migration, and differentiation.Porosity is a critical indicator of scaffold performance, essential for cell ingrowth, nutrient transport, and metabolite exchange. Liquid immersion measurements indicated that the porosity of NF and NS was 61.3% and 88.9%, respectively, with the latter being significantly higher (Fig. 4I).

Additionally, both NS scaffolds and BMSCs sheet/NS reached maximum water absorption and swelling rates within 1 min of water contact (Fig. 4J and K). The maximum swelling rate of BMSCs sheet/NS was higher than that of NS, correlating with its greater porosity. The water absorption was reversible: under 80% strain compression, most absorbed water could be expelled, and the maximum absorption rate showed no significant change after 5 compression cycles (Fig. 4L). These properties provide unique advantages for tissue repair, such as local hemostasis and prevention of infection caused by excessive exudate. In vitro degradation studies demonstrated that NS scaffolds possess controlled degradation characteristics (Supplementary Fig.S6), exhibiting gradual and stable degradation profiles ideal for supporting sustained bone regeneration.

Overall, the prepared NS scaffolds exhibit high porosity, stable structure, and excellent hydrophilicity, providing an ideal platform for cell loading and bone regeneration applications.

3.5. Biocompatibility of NS scaffolds and their ability to promote osteogenic differentiation of BMSCs

Due to the poor mechanical strength of cell sheets, they cannot be used to repair large bone defects. In contrast, NS scaffolds, prepared by electrospinning technology, possess a three-dimensional porous structure with a microstructure similar to bone tissue, mimicking mineralized bone matrix and providing a more suitable microenvironment for cell growth, proliferation, and differentiation.

Good biocompatibility of scaffold materials is a fundamental prerequisite for their in vivo application. Therefore, we evaluated the compatibility of NS scaffolds with BMSCs and simultaneously investigated the effect of NS scaffolds on osteogenic differentiation of BMSCs. The experimental workflow is detailed in Fig. 5A. As shown in Fig. 5B, live/dead cell assay results demonstrated that cell numbers continuously increased with prolonged culture time (Fig. 5C), confirming that NS scaffolds had no toxic effects on BMSCs. CCK-8 assays further verified the non-cytotoxicity of the scaffolds (Fig. 5D). Next, we validated the role of NS scaffolds in promoting osteogenic differentiation of BMSCs through ALP staining, Alizarin Red S staining, immunofluorescence analysis, qRT-PCR, and Western blot. First, qRT-PCR detection showed that the gene expression levels of RUNX2, OPN, and OCN in the NS scaffold group were significantly higher than those in the control group (Fig. 5E). Subsequently, ALP staining was performed after 7 days of culture (as a key early osteogenic marker), and the results indicated that the staining intensity in the NS scaffold group was significantly higher than that in the BMSC control group, confirming that the scaffolds could effectively induce osteogenic differentiation of BMSCs (Fig. 5F). Furthermore, to evaluate the osteogenic differentiation potential of BMSCs after 21 days of culture, we conducted ARS staining experiments to detect calcium deposition, an important late-stage osteogenic characteristic. In the NS scaffold group, more dense and numerous calcium nodules were observed, highlighting its superior osteogenic induction capacity (Fig. 5F). As shown in Fig. 5G, Western blot analysis further confirmed that the protein expression levels of RUNX2, OPN, and OCN in the NS scaffold group were significantly higher than those in the control group. To further corroborate this effect, we performed immunofluorescence staining for OPN and OCN, and the results similarly demonstrated that NS scaffolds possessed stronger osteogenic induction capacity (Fig. 5H). These data indicate that NS scaffolds can not only maintain the biological activity of BMSCs but also significantly enhance their osteogenic differentiation potential by mimicking the natural microenvironment.

Fig. 5.

Fig. 5

Biocompatibility of NS scaffolds and their effects on promoting osteogenic differentiation of BMSCs. A) Schematic illustration of the effects of NS scaffolds on BMSC proliferation and osteogenic differentiation. First, NS scaffolds were immersed in culture medium at 37 °C and 5% CO2 for 3 days. Then, the extracts were collected, supplemented with 10% FBS, and co-cultured with BMSCs to test the effects of NS on BMSC proliferation and osteogenic differentiation. B) Live/dead staining of BMSCs cultured with scaffold extracts on days 1, 3, and 5 (n = 6); C) Viable cell counts from live/dead staining (n = 6); D) CCK-8 results of BMSCs cultured with scaffold extracts on days 1, 3, and 5 (n = 5); E) RT-PCR results of RUNX2, OPN, and OCN mRNA expression (n = 6); F) ALP and Alizarin Red staining (n = 6). G) Western blot results of RUNX2, OPN, and OCN protein expression (n = 4); H) Immunofluorescence staining results of OPN and OCN protein expression (n = 6).

3.6. Construction of the CGRP/BMSCs sheet/NS and its effects on neurogenesis and angiogenesis

This study investigated the regulatory role of sustained CGRP release from the CGRP/BMSCs sheet/NS composite in key processes of bone repair in depth. Specifically, an integrated scaffold was first constructed by wrapping CGRP/BMSCs sheets onto NS via electrostatic interactions (Fig. 6A and B). The growth status of cells was observed by live/dead staining, and the results showed that BMSCs exhibited excellent cell growth behavior on the NS scaffolds. Furthermore, the spreading and extension state of cells was further verified by cytoskeletal staining, which revealed abundant F-actin, an ideal component of the cytoskeleton, in the BMSCs sheets. BMSCs were able to firmly attach to the scaffold surface and spread with normal spindle-shaped morphology, indicating that the NS scaffolds possessed good cell adhesion capacity, which facilitated the formation and deposition of ECM secreted by BMSCs (Fig. 6C and D). Finally, the structure of BMSCs sheet/NS scaffolds was observed by H&E staining, and the results showed that BMSCs sheets could secrete abundant ECM and were composed of numerous cells, further confirming the supporting role of NS scaffolds in cell sheet growth and matrix secretion (Fig. 6E). To complement the histological analysis, SEM observation of the composite scaffold was also performed, revealing intimate contact between the BMSCs sheet and nanofibers (Supplementary Fig.S7). The combination of H&E staining and SEM provided comprehensive structural characterization of the CGRP/BMSCs sheet/NS composite material at different scales.

Fig. 6.

Fig. 6

Construction of CGRP/BMSCs sheet/NS and its effects on BMSCs. A) Schematic illustration of CGRP/BMSCs sheet/NS construction; B) Construction of CGRP/BMSCs sheet/NS by wrapping CGRP/BMSCs sheets onto NS scaffolds (n = 3); C) Calcein-AM staining of BMSCs on CGRP/BMSCs sheet/NS after two days of incubation, with green representing viable cells (n = 3); D) Phalloidin staining of BMSCs on CGRP/BMSCs sheet/NS after two days of incubation, with blue indicating cell nuclei and green representing the cytoskeleton (n = 3); E) H&E staining of cross-sections of CGRP/BMSCs sheet/NS (n = 3). F). Immunofluorescence staining of neural differentiation markers (TUBB3 and SOX10) in BMSCs sheets treated with control (untreated) or CGRP@MPDA sustained-release system (n = 6). G). Immunofluorescence staining of vascular differentiation markers (CD31 and CD34) in BMSCs sheets treated with control (untreated) or CGRP@MPDA sustained-release system (n = 6).H) Schematic illustration of verification of the effects of CGRP/BMSCs sheet/NS on BMSCs by RT-qPCR (n = 6); I) RT-qPCR results of neural differentiation genes (TUBB3 and SOX10) (n = 6); J) RT-qPCR results of angiogenic differentiation genes (CD31 and CD34) (n = 6); K) RT-qPCR results of osteogenic differentiation genes (RUNX2 and OCN) (n = 6). ∗P < 0.05,∗∗P < 0.01,∗∗∗P < 0.001.

To characterize the CGRP release behavior in the composite system, we evaluated the release kinetics of CGRP from the CGRP/BMSCs sheet/NS composite scaffolds over 28 days. As shown in Supplementary Fig.S8, the composite material exhibited sustained CGRP release with an initial release of approximately 38% within the first 3 days, followed by steady and continuous release. The cumulative release reached approximately 84% by day 28, demonstrating favorable sustained-release characteristics. These results confirmed that the CGRP@MPDA nanoparticles maintained stable release kinetics within the composite scaffold system.Bone repair requires not only the activation of osteoblasts but also relies on the coordination of nerve regeneration and angiogenesis to rebuild functionally complete bone tissue. Therefore, we further investigated how the sustained release of CGRP from the CGRP/BMSCs sheet/NS influences these events. By utilizing BMSCs sheets on the scaffolds, we evaluated the neurogenic and angiogenic differentiation capacity of the cells. Immunofluorescence analysis demonstrated that BMSCs sheets treated with the CGRP@MPDA sustained-release system displayed significantly higher expression of neural differentiation markers (TUBB3 and SOX10) and vascular differentiation markers (CD31 and CD34) compared to the untreated control group (Fig. 6F and G). These results indicate that the CGRP sustained-release system effectively promotes neurovascular differentiation of the BMSCs sheets. The neurogenic and angiogenic differentiation capacity of BMSCs on the scaffolds was further assessed by qRT-PCR (Fig. 6H). The results showed that, compared with the control group and the BMSCs sheet/NS group, the CGRP/BMSCs sheet/NS significantly upregulated the expression levels of neurogenic differentiation marker genes (S100β and TUBB3;Fig. 6I), angiogenesis-related genes (CD31 and CD34;Fig. 6J), and osteogenesis-related genes (RUNX2 and OCN;Fig. 6K) at day 7. These results confirm that the sustained release of CGRP can synergistically promote the neurogenic differentiation, angiogenic activity, and osteogenic differentiation capacity of BMSCs, providing a novel strategy for constructing tissue-engineered scaffolds with multi-lineage differentiation potential.

We constructed the CGRP/BMSCs sheet/NS composite. The system utilizes the NS to provide a three-dimensional supporting framework, promoting BMSC attachment, proliferation, and directed differentiation. Meanwhile, through the controlled release of CGRP, it promotes early angiogenesis and neurogenesis. This biomimetic scaffold can not only reconstruct bone defect structures but also accelerate the bone repair process by modulating the biological microenvironment.

3.7. The CGRP/BMSCs sheet/NS composite activates the MAPK signaling pathway

Prior to transcriptome sequencing, BMSCs were divided into three groups for pre-culture: the BMSCs group (cultured in complete medium), the BMSCs/NS group (supplemented with NS scaffold extracts), and the CGRP treatment group (supplemented with NS scaffold extracts and 10 nM CGRP). All groups were incubated at 37 °C with 5% CO2 for 7 days. Subsequently, cells were collected for RNA extraction and transcriptome sequencing to compare the gene expression profiles of BMSCs under different treatment conditions. The sequencing workflow is shown in Fig. 7A, and the volcano plot displays the differentially expressed genes (DEGs) among the groups (Fig. 7B). KEGG enrichment analysis revealed that the MAPK signaling pathway was activated among the BMSCs/NS group, CGRP/BMSCs/NS group, and control group (Fig. 7C and D). The heatmap illustrates the differentially expressed genes in the MAPK signaling pathway (Fig. 7E). Previous studies have demonstrated that activation of the MAPK-ERK1/2 signaling pathway promotes osteogenic differentiation of BMSCs [33]. To confirm this, we examined the expression of key proteins involved in the MAPK-extracellular signal-regulated kinase (ERK)1/2 pathway. Western blot assay results showed that there were no differences in the expression levels of ERK, MEK1/2, and P38 among the three groups. However, Western blot analysis indicated that the phosphorylation of ERK, MEK1/2, and P38 was enhanced in BMSCs treated with NS or CGRP/NS compared to control cells (Fig. 7F). GAPDH was used as the loading control for all proteins (the GAPDH bands for P38 and p-P38 are provided in Supplementary Fig.S9). Quantitative analysis of the gray values is presented in the Supplementary Fig.S10. These findings suggest that CGRP/NS activates the MAPK-ERK1/2 signaling pathway in BMSCs, thereby upregulating the expression of downstream RUNX2 and OCN, which in turn enhances osteogenesis (Fig. 7G). Quantitative analysis of the gray values is presented in the Supplementary Fig.S11.

Fig. 7.

Fig. 7

Effects of CGRP/BMSCs sheet/NS activation of the MAPK signaling pathway on osteogenic mechanisms. A) Sequencing workflow; B) Volcano plot depicting the differentially expressed genes identified in the BMSC/NS and CGRP/BMSC/NS groups compared to the control BMSC group; C) KEGG enrichment analysis between the BMSC and BMSC/NS groups; D) KEGG enrichment analysis between the BMSC/NS and CGRP/BMSC/NS groups; E) Heatmap of significantly differentially expressed genes in the MAPK signaling pathway; F) Western blot detection of protein expression levels of key molecules in the MAPK signaling pathway (p-ERK1/2, ERK1/2, p-MEK1/2, MEK1/2, p-p38, and p38) and osteogenic proteins (Col1a1, RUNX2, OPN, SPARC, and OCN) in BMSCs of each group (n = 3); G) Schematic illustration of osteogenesis by CGRP/BMSC/NS.

3.8. In vivo osteogenesis

This experiment utilized the widely accepted 5 mm diameter rat calvarial defect model, focusing on neurogenesis and angiogenesis associated with new bone formation. At 4 and 8 weeks after scaffold implantation, rats were sacrificed and calvarial specimens were collected for evaluation (Fig. 8A). To observe bone regeneration in the defect area, Micro-computed tomography (Micro-CT) scans were performed. The results showed that the model group (untreated group) induced almost no new bone tissue formation, with obvious voids remaining in the defect area at both 4 and 8 weeks, whereas the experimental scaffold groups induced significant bone formation in the central region of the defect, with new bone growing from the defect edges toward the interior of the scaffolds (Fig. 8B and C). As expected, the most significant new bone formation was observed in the CGRP/BMSCs sheet/NS group. To facilitate comparison, quantitative analyses of bone mineral density (BMD), bone volume fraction (BV/TV), trabecular number (Tb.N), and trabecular thickness (Tb.Th) were performed. The results showed that the CGRP/BMSCs sheet/NS group exhibited the highest BV/TV and BMD values among all groups (Fig. 8D, E, F, and G). These imaging results were consistent with the in vitro experimental trends, confirming the superiority of CGRP/BMSCs sheet/NS in bone regeneration.

Fig. 8.

Fig. 8

Effects of different scaffolds on in vivo calvarial bone regeneration. A) Schematic illustration of the in vivo experimental procedure; B) 3D reconstructed images of the bone defect area by Micro-CT at 4 weeks post-surgery (n = 6); C) 3D reconstructed images of the bone defect area by Micro-CT at 8 weeks post-surgery (n = 6); D) Quantitative analysis of BMD (n = 6); E) Quantitative analysis of BV/TV (n = 6); F) Quantitative analysis of Tb.N (n = 6); G) Quantitative analysis of Tb.Th (n = 6). ∗P < 0.05,∗∗P < 0.01,∗∗∗P < 0.001.

H&E staining and Masson's trichrome staining are commonly used histological evaluation methods that can be employed to observe collagen synthesis and bone maturation after scaffold implantation. As shown in Fig. 9A and C, compared with the other groups, the CGRP/BMSCs sheet/NS group formed bone tissue with more regular arrangement in the bone defect area, covered with cuboidal osteoblast-like cells. In contrast, the bone defect areas in the other groups were mainly filled with fibrous tissue with only partial regenerated bone, indicating poor bone regeneration capacity. In the control group, BMSCs sheet/NS group, and BMSCs sheet group, obvious gaps or abundant fibrous tissue and loose soft tissue growth were observed, covering the bone defect area and blocking new bone formation. Under Masson's trichrome staining, the BMSCs sheet/NS group and BMSCs sheet group showed lighter staining, whereas the CGRP/BMSCs sheet/NS group exhibited deep blue staining, indicating abundant collagen formation, while the red-stained areas corresponded to calcified extracellular matrix. Evidently, new bone tissue had grown into the interior of the CGRP/BMSCs sheet/NS, whereas the other groups were mainly infiltrated by fibrous connective tissue (Fig. 9B–D).

Fig. 9.

Fig. 9

Histological analysis by HE and Masson's trichrome staining. A-B) H&E staining and Masson's trichrome staining at 4 weeks (n = 6). C-D) H&E staining and Masson's trichrome staining at 8 weeks (n = 6).

The nervous system enhances osteoblast differentiation, activity, and defect remodeling capacity through the release of neuropeptides, while blood vessels transport nutrients from surrounding tissues to the defect site to promote cellular activities. Given that CGRP/BMSCs sheet/NS have demonstrated activation of neurogenic and angiogenic differentiation of BMSCs in vitro, we further investigated whether these scaffolds could trigger similar biological events in vivo. At 4 weeks, immunofluorescence staining was performed to detect the neurogenesis marker CGRP (red fluorescence) and the angiogenesis marker CD31 (green fluorescence). The results showed that the intensity of red and green fluorescence followed the order: model group < BMSCs sheet group < BMSCs sheet/NS group < CGRP/BMSCs sheet/NS group, confirming the synergistic effect of CGRP/BMSCs sheet/NS in enhancing neural and vascular formation. Furthermore, the CGRP/BMSCs sheet/NS group exhibited the strongest RUNX2 expression (Fig. 10A), and the semi-quantitative results were consistent with the statistical analysis of fluorescence intensity (Fig. 10B, C, and D). To further quantify the repair efficacy on defective bone tissue, qRT-PCR analysis was employed to detect the expression levels of osteogenic (RUNX2), angiogenic (CD31), and neurogenic (CGRP) genes at the defect site. Compared with the BMSCs sheet group and BMSCs sheet/NS group, the CGRP/BMSCs sheet/NS group showed increased expression of all genes, with the highest expression levels.

Fig. 10.

Fig. 10

Analysis of in vivo osteogenesis, angiogenesis, and neurogenesis at 4 weeks after scaffold implantation. A) Representative immunofluorescence images of CGRP (red), CD31 (green), and RUNX2 (yellow) in the bone defect area (n = 6) and B-D) semi-quantitative statistical graphs of fluorescence intensity (n = 6); E-G) Expression of osteogenic, angiogenic, and neurogenic genes in newly formed tissue at 4 weeks after calvarial bone defect implantation (n = 6). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

At 8 weeks, immunofluorescence staining was also performed to detect the neurogenesis marker CGRP (red fluorescence) and the angiogenesis marker CD31 (green fluorescence). The immunofluorescence and semi-quantitative results were consistent with those at 4 weeks (Fig. 11A, B, C, and D). Immunofluorescence staining for neural (CGRP), vascular (CD31), and osteogenic differentiation (RUNX2) markers showed the most pronounced positive expression in the CGRP/BMSCs sheet/NS group. These findings strongly demonstrated the superior angiogenic and neurogenic potential of the CGRP/BMSCs sheet/NS group. qRT-PCR analysis was employed to detect the expression levels of osteogenic (RUNX2), angiogenic (CD31), and neurogenic (CGRP) genes at the defect site. Compared with the BMSCs sheet group and BMSCs sheet/NS group, the CGRP/BMSCs sheet/NS group showed increased expression of all genes, with the highest expression levels. Specifically, compared with the BMSCs sheet group, the fold changes in the BMSCs sheet/NS group were 2.31 ± 0.93-fold for RUNX2, 3.01 ± 0.66-fold for CD31, and 2.72 ± 0.99-fold for CGRP. In the CGRP/BMSCs sheet/NS group, these values increased to 4.21 ± 1.69-fold, 5.45 ± 1.19-fold, and 7.35 ± 2.18-fold, respectively (Fig. 11E, F, and G). The enhanced results observed in the CGRP/BMSCs sheet/NS group may be attributed to the synergistic effects of CGRP in promoting neural and vascular formation. During the treatment of calvarial defects, the MPDA nanoparticles attached to the BMSCs sheets at the defect site gradually degraded and continuously released CGRP. This process not only promoted the recruitment of BMSCs to the bone defect site but also effectively enhanced the neurovascular differentiation of stem cells, providing a favorable microenvironment for bone regeneration and thereby significantly enhancing the regeneration and repair capacity of bone defects. Compared to BMSCs sheets alone and BMSCs sheet/NS scaffolds, the CGRP/BMSCs sheet/NS demonstrated more significant bone repair effects in the rat calvarial defect model through synergistic regulation of the neurovascular microenvironment and promotion of stem cell survival and osteogenic differentiation. In summary, the CGRP-empowered stem cell sheet/short nanofiber sponge is effective for neurovascularized bone regeneration.

Fig. 11.

Fig. 11

Analysis of in vivo osteogenesis, angiogenesis, and neurogenesis at 8 weeks after scaffold implantation. A) Representative immunofluorescence images of CGRP (red), CD31 (green), and RUNX2 (yellow) in the bone defect area (n = 6) and B-D) semi-quantitative statistical graphs of fluorescence intensity (n = 6); E-G) Expression of osteogenic, angiogenic, and neurogenic genes in newly formed tissue at 8 weeks after calvarial bone defect implantation (n = 6). ∗P < 0.05,∗∗P < 0.01,∗∗∗P < 0.001.

To comprehensively evaluate the biosafety of the composite scaffold system, we conducted a systematic in vivo safety assessment in rats from four experimental groups: Control, BMSCs sheet, BMSCs sheet/NS, and CGRP/BMSCs sheet/NS. During the treatment period and post-treatment, no significant changes were observed in body weight or organ indices of major organs across all groups, indicating that the material implantation did not adversely affect overall health (Supplementary Fig.S12). At the experimental endpoint, major organs (heart, liver, spleen, lungs, and kidneys) were collected for histological evaluation. H&E staining showed that tissue architecture of all organs remained intact with no inflammatory lesions, cellular necrosis, or tissue damage, and were comparable to the Control group (Supplementary Fig.S13). These results indicate that metabolic products from NS scaffold and CGRP@MPDA microsphere degradation did not cause organ toxicity. Blood routine and biochemical parameters were also assessed. Hematological parameters (red blood cell count, hemoglobin, white blood cell count, and platelet count) were within normal physiological ranges in all groups (Supplementary Fig.S14). Hepatorenal function markers (ALT, AST, CREB, and UREA) showed no significant differences among groups and were all within normal ranges (Supplementary Fig.S15). These results demonstrate that local implantation of the CGRP/BMSCs sheet/NS composite scaffold system did not induce systemic adverse reactions or organ toxicity.

4. Discussion

Bone is a highly neurovascularized tissue, and bone regeneration requires not only osteogenic differentiation and matrix mineralization of BMSCs, but also a highly coordinated microenvironment of nerves and blood vessels, forming a synergistic nerve–vessel–bone network that collectively determines the quality of bone regeneration. Therefore, leveraging this mechanism, we developed a biological system for bone regeneration: a CGRP-empowered BMSCs sheet/NS composite scaffold, aimed at regulating stem cell recruitment and differentiation, angiogenesis and neurogenesis, as well as mineralization following bone defects. CGRP, as a neuropeptide, accelerates sensory nerve repair and promotes the reconstruction of microvascular networks, while the BMSCs sheet provides an abundant source of stem cells for bone regeneration, and NS enhances the mechanical strength of the scaffold. In vitro experiments demonstrated that the CGRP/BMSCs sheet/NS scaffold possessed significant osteogenic and angiogenic potential. Subsequently, we further evaluated the in vivo therapeutic efficacy of this composite scaffold in a rat calvarial defect model. In vivo experimental results indicated that, compared to other experimental groups, the CGRP/BMSCs sheet/NS scaffold exhibited superior performance in promoting bone regeneration. These findings suggest that the CGRP/BMSCs sheet/NS scaffold provides a novel therapeutic strategy for bone regeneration.

Bone defects caused by various etiologies are common clinical problems that impose an enormous burden on society and severely affect patients' quality of life [34]. Over the past two decades, the rapid development of tissue engineering has provided new directions for bone regeneration. However, traditional bone tissue engineering approaches, including cell suspension injection and transplantation of cell-seeded scaffolds, still face some urgent issues that need to be addressed [35,36]. For instance, injected cells are prone to loss in vivo, and the number of cells that can be administered in a single injection is limited. Moreover, achieving uniform cell distribution after injection is challenging [37]. In recent years, CST, as an emerging tissue engineering technology, has gradually gained attention from researchers. CST can obtain seed cells without enzymatic digestion, effectively preserving the ECM and cell-cell connections, thereby achieving uniform cell distribution and high cell density in vivo [38]. The periosteum is a thin connective tissue covering the bone surface (except for joints) and plays an important role in bone development and regeneration [39]. Many studies have utilized CST to construct engineered biomimetic periosteum for bone regeneration [40,41]. However, the abundant neurovascular network in the periosteum is crucial for cell growth, as it provides essential nutrients and signaling to cells [42,43]. Nevertheless, current CST technology has difficulty constructing neurovascular network-rich tissues, which limits its application in bone regeneration therapy. In this study, we constructed a CGRP-empowered BMSCs sheet by uniformly dispersing MPDA@CGRP nanoparticles on the BMSCs sheet and investigated its effects on neural differentiation and angiogenesis.

Cell sheets, owing to their assembly flexibility, have demonstrated great potential in repairing various tissue defects and have been successfully applied in the reconstruction of damaged cornea, trachea, heart, and periodontal tissues [44,45]. However, their application in bone defect repair remains limited, primarily because the insufficient mechanical properties of cell sheets make it difficult to meet the stiffness requirements for bone regeneration. Additionally, cell sheets require an additional substrate during transplantation to enable precise manipulation. To address this issue, researchers have attempted to combine cell sheets with three-dimensional scaffold materials to enhance their mechanical properties and promote bone regeneration. For instance, three-dimensional collagen nanofibrous sponges (NS) fabricated by electrospinning technology have emerged as an ideal scaffold material due to their high porosity and good biocompatibility. Studies [31] have shown that compared to traditional electrospun fibers, NS possess the following unique advantages: 1) higher porosity, which facilitates cell adhesion and ingrowth; 2) high-porosity structure that promotes nutrient exchange and metabolic waste removal; 3) better mimicry of the natural bone matrix, providing a more suitable microenvironment for cell growth, proliferation, and differentiation. The combination of BMSC sheets with NS not only enhances the mechanical properties of the scaffold but also provides abundant cell sources and extracellular matrix for bone regeneration. This combination strategy has demonstrated significant promotional effects in in vivo bone regeneration.

By integrating CGRP-loaded BMSCs sheets with porous NS, we constructed a CGRP-empowered BMSCs sheet/NS composite scaffold to circumvent the limitations faced by direct stem cell injection and stem cell sheets alone in bone tissue regeneration. As demonstrated in previous studies [46], stem cells implanted at bone defect sites can differentiate into osteoblasts and secrete growth factors to promote bone repair. We found that the implanted biomimetic periosteum–bone composite scaffold was able to survive long-term in rat bone defects, which is consistent with previous findings regarding in vivo stem cell retention [47]. During the treatment of calvarial defects, MPDA nanoparticles on the BMSCs sheet attached to the defect site gradually degraded and sustainably released CGRP. This process not only promoted the recruitment of BMSCs to the bone defect site, but also effectively facilitated the neurovascular differentiation of stem cells, providing a favorable microenvironment for bone regeneration and thereby significantly enhancing the regenerative and reparative capacity of bone defects. Compared to BMSCs sheets alone and BMSCs sheet/NS scaffolds, the CGRP/BMSCs sheet/NS scaffold demonstrated more pronounced bone repair effects in the rat calvarial defect model through synergistic regulation of the neurovascular microenvironment and promotion of stem cell survival and osteogenic differentiation.

Mitogen-activated protein kinases (MAPKs) are evolutionarily conserved serine/threonine kinase cascades that transduce extracellular signals into intracellular responses, regulating cell proliferation, differentiation, survival, and apoptosis [48]. In bone biology, the MEK/ERK pathway is a critical regulator of osteoblast differentiation and bone formation [49]. However, its role in mediating the pro-osteogenic effects of CGRP in biomaterial-based regenerative systems remains inadequately explored. Through RNA-seq, we identified enrichment of the MAPK pathway in CGRP-treated BMSCs and performed targeted Western blot analysis. Under osteogenic conditions, BMSCs cultured on CGRP/NS scaffolds for 7 days showed significantly increased phosphorylation of MEK1/2 and ERK1/2 compared with controls without CGRP. Total MEK1/2 and ERK1/2 protein levels remained unchanged, indicating activation through post-translational phosphorylation rather than changes in expression or stability. These findings demonstrate that CGRP drives osteogenic differentiation through MEK/ERK activation, consolidating the regenerative efficacy of our scaffold system.

The CGRP/BMSCs sheet/NS system developed in this study demonstrates significant clinical potential for treating critical-sized bone defects caused by trauma, tumor resection, and congenital malformations. Compared to autologous bone grafting, our system avoids donor site morbidity; compared to conventional scaffolds, it provides superior neurovascular modulation. The modular design allows for patient-specific customization, and the potential for developing off-the-shelf allogeneic cell sheet products could enhance clinical accessibility. Beyond bone regeneration, this neurovascular coupling strategy may extend to cartilage repair, tendon-bone interface healing, and periodontal regeneration. Despite the achievements of this study, several limitations remain. First, we did not evaluate different CGRP concentrations in vivo to investigate the effects of concentration gradients on osteogenic outcomes. Second, due to the absence of long-term tracking of the implanted cell sheets in vivo post-surgery, the survival, integration, and functional performance of the cell sheets at the calvarial defect site could not be definitively determined. Future studies need to further explore the in vivo fate of transplanted cell sheets to better understand their mechanisms of action in bone regeneration. Third, the current study was conducted only in small animal models, whereas transplantation of the composite scaffold into large animal models would more accurately simulate clinical application scenarios and provide more reliable evidence for clinical translation. Finally, this study did not thoroughly investigate the underlying molecular mechanisms by which the composite scaffold promotes calvarial defect repair, which is crucial for elucidating its mode of action and optimizing therapeutic strategies. Future research should focus on these aspects to further refine the clinical application prospects of this technology.

5. Conclusion

In summary, by drawing inspiration from the structural and functional characteristics of natural bone, this study developed a CGRP-empowered stem cell sheet/short nanofibrous sponge to mimic the composition and microenvironment of natural bone. The CGRP/BMSCs sheet/NS enables sustained release of the bioactive molecule CGRP. Comprehensive in vitro and in vivo experimental results demonstrate that this system not only promotes neural differentiation and angiogenesis but also significantly enhances bone regeneration outcomes. Therefore, this system holds great promise as a novel strategy for bone regeneration therapy with significant clinical translation potential.

Data and materials availability

All relevant data supporting the findings of this study are included in the article and its Supplementary Information.

Funding sources

This study was supported by the National Natural Science Foundation of China (NSFC) (82402779), the China Posdoctoral Science Foundation (2024MD754029), Chongqing Natural Science Foundation project (CSTB2024NSCQ-MSX1218), Chongqing Special Postdoctoral Funding (2023CQBSHTB3089) and Doctoral Research Innovation Project of the First Clinical College of Chongqing Medical University (CYYY-BSYJSKYCXXM202409).

CRediT authorship contribution statement

Yukun Jia: Formal analysis, Validation, Visualization, Writing – original draft. Zhilin Wu: Formal analysis, Methodology, Writing – original draft. Zhiyu Chen: Software, Writing – original draft. Dagang Tang: Data curation. Ningdao Li: Data curation. Yanran Huang: Data curation. Runhan Zhao: Data curation, Software. Yafei Zhu: Data curation, Software. Juan Wang: Methodology, Supervision, Writing – review & editing. Xiaoji Luo: Conceptualization, Writing – review & editing. Jun Zhang: Funding acquisition, Supervision, Writing – review & editing.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

None.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.mtbio.2026.103067.

Contributor Information

Juan Wang, Email: zhangjuncq1215@163.com.

Xiaoji Luo, Email: 202982@hospital.cqmu.edu.cn.

Jun Zhang, Email: juanwang1006@126.com.

Glossary

(ALP)

alkaline phosphatase

(ARS)

alizarin red S

(BMSC)

bone marrow mesenchymal stem cell

(CGRP)

calcitonin gene-related peptide

(CST)

cell sheet technology

(DLS)

dynamic light scattering

(ECM)

extracellular matrix

(PBS)

phosphate-buffered saline

(RUNX2)

runt-related transcription factor 2

(qRT-PCR)

quantitative reverse transcription polymerase chain reaction

(MPDA)

mesoporous polydopamine

(MAPKs)

mitogen-activated protein kinases

(NS)

nanofiber sponge

Appendix A. Supplementary data

The following is/are the supplementary data to this article:

Multimedia component 1
mmc1.docx (16.3MB, docx)

Data availability

Data will be made available on request.

References

  • 1.Wu M., Liu H., Zhu Y., Chen F., Chen Z., Guo L., Wu P., Li G., Zhang C., Wei R., Cai L. Mild photothermal-stimulation based on injectable and photocurable hydrogels orchestrates immunomodulation and osteogenesis for high-performance bone regeneration. Small. 2023;19 doi: 10.1002/smll.202300111. [DOI] [PubMed] [Google Scholar]
  • 2.Reznikov N., Bilton M., Lari L., Stevens M.M., Kröger R. Fractal-like hierarchical organization of bone begins at the nanoscale. Science. 2018:360. doi: 10.1126/science.aao2189. New York, N.Y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Reznikov N., Shahar R., Weiner S. Bone hierarchical structure in three dimensions. Acta Biomater. 2014;10:3815–3826. doi: 10.1016/j.actbio.2014.05.024. [DOI] [PubMed] [Google Scholar]
  • 4.Yang Z., Yang Z., Ding L., Zhang P., Liu C., Chen D., Zhao F., Wang G., Chen X. Self-adhesive hydrogel biomimetic periosteum to promote critical-size bone defect repair via synergistic osteogenesis and angiogenesis. ACS Appl. Mater. Interfaces. 2022;14:36395–36410. doi: 10.1021/acsami.2c08400. [DOI] [PubMed] [Google Scholar]
  • 5.Yang Y., Xu T., Zhang Q., Piao Y., Bei H.P., Zhao X. Biomimetic, stiff, and adhesive periosteum with osteogenic-angiogenic coupling effect for bone regeneration. Small. 2021;17 doi: 10.1002/smll.202006598. [DOI] [PubMed] [Google Scholar]
  • 6.Wu M., Liu H., Zhu Y., Wu P., Chen Y., Deng Z., Zhu X., Cai L. Bioinspired soft-hard combined system with mild photothermal therapeutic activity promotes diabetic bone defect healing via synergetic effects of immune activation and angiogenesis. Theranostics. 2024;14:4014–4057. doi: 10.7150/thno.97335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Liu Z., Wan X., Wang Z.L., Li L. Electroactive biomaterials and systems for cell fate determination and tissue regeneration: design and applications. Adv. Mater. 2021;33 doi: 10.1002/adma.202007429. [DOI] [PubMed] [Google Scholar]
  • 8.Zhang Y., Xu J., Ruan Y.C., Yu M.K., O'Laughlin M., Wise H., Chen D., Tian L., Shi D., Wang J., Chen S., Feng J.Q., Chow D.H.K., Xie X., Zheng L., Huang L., Huang S., Leung K., Lu N., Zhao L., Li H., Zhao D., Guo X., Chan K., Witte F., Chan H.C., Zheng Y., Qin L. Implant-derived magnesium induces local neuronal production of CGRP to improve bone-fracture healing in rats. Nat. Med. 2016;22:1160–1169. doi: 10.1038/nm.4162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Li X.-L., Zhao Y.-Q., Miao L., An Y.-X., Wu F., Han J.-Y., Han J.-Y., Tay F.R., Mu Z., Jiao Y., Wang J. Strategies for promoting neurovascularization in bone regeneration. Milit. Med. Res. 2025;12:9. doi: 10.1186/s40779-025-00596-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chen W., Yi Z., Wang X., Wang S., Wang W., Zhang A., Liu F., Shi R., Zheng Y., Liu B. Composite hydrogel-microsphere delivery system promotes early nerve-mediated bone regeneration and late-stage mechanotransduction-driven bone remodeling via sequential release of NGF and Yoda1. Bioact. Mater. 2026;57:531–550. doi: 10.1016/j.bioactmat.2025.10.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhu C., Li Z., Qiu X., Zhao B., Wang H., Wang L., Zhuang M., Liu J., Han F., Li B. A functional 3D biomimetic osteon accelerates bone regeneration. Adv. Funct. Mater. 2025;35 [Google Scholar]
  • 12.Duan J., Fang Y., Tian Y., Wang Z., Yang B., Xiong Z. 3D bioprinting of prevascularized bone organoids for rapid in situ cranial bone reconstruction. Adv. Healthcare Mater. 2025;14 doi: 10.1002/adhm.202501376. [DOI] [PubMed] [Google Scholar]
  • 13.Mi J., Xu J.K., Yao Z., Yao H., Li Y., He X., Dai B.Y., Zou L., Tong W.X., Zhang X.T., Hu P.J., Ruan Y.C., Tang N., Guo X., Zhao J., He J.F., Qin L. Implantable electrical stimulation at dorsal root ganglions accelerates osteoporotic fracture healing via calcitonin gene-related peptide. Adv. Sci. (Weinh.) 2022;9 doi: 10.1002/advs.202103005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Xia Y., Wei W., Chen P., Zhu Y., Wu X., Dai H. 3D printed flexible composite scaffold with ultrasonic-driven wireless electrical stimulation promotes neuro-vascularization for critical-size bone defects regeneration. Bioact. Mater. 2026;56:181–196. doi: 10.1016/j.bioactmat.2025.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sun W., Ye B., Chen S., Zeng L., Lu H., Wan Y., Gao Q., Chen K., Qu Y., Wu B., Lv X., Guo X. Neuro-bone tissue engineering: emerging mechanisms, potential strategies, and current challenges. Bone Res. 2023;11:65. doi: 10.1038/s41413-023-00302-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhang Z., Hao Z., Xian C., Fang Y., Cheng B., Wu J., Xia J. Neuro-bone tissue engineering: multiple potential translational strategies between nerve and bone. Acta Biomater. 2022;153:1–12. doi: 10.1016/j.actbio.2022.09.023. [DOI] [PubMed] [Google Scholar]
  • 17.Wu Q., Fu S., Xiao H., Du J., Cheng F., Wan S., Zhu H., Li D., Peng F., Ding X., Wang L. Advances in extracellular vesicle nanotechnology for precision theranostics. Adv. Sci. (Weinh.) 2023;10 doi: 10.1002/advs.202204814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hua P., Pan X., Liu J., Chen X., Li M., Guo Y., Li X., Leng P., Fan G., Zheng M., Yu K., Ma P., Zhang C., Shen X. Development of a novel LBL@DHBA/Cu-MOF coating on titanium implants to accelerate early osseointegration by promoting neural-vascular-bone coupling regeneration. Chem. Eng. J. 2025;514 [Google Scholar]
  • 19.Mi J., Xu J., Yao H., Li X., Tong W., Li Y., Dai B., He X., Chow D.H.K., Li G., Lui K.O., Zhao J., Qin L. Calcitonin gene-related peptide enhances distraction osteogenesis by increasing angiogenesis. Tissue Eng. 2021;27:87–102. doi: 10.1089/ten.TEA.2020.0009. [DOI] [PubMed] [Google Scholar]
  • 20.Zhao X., Wu G., Zhang J., Yu Z., Wang J. Activation of CGRP receptor-mediated signaling promotes tendon-bone healing. Sci. Adv. 2024;10 doi: 10.1126/sciadv.adg7380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Luo R., Chen Z., Zhe M., Wu W., Xiao Y., Jiang J., Liu H., Liu M., Xing F. Angiogenesis-osteogenesis coupling and immunomodulatory CGRP@nano MOF-Loaded CMCS/GelMA hydrogel for bone regeneration. J. Mater. Chem. B. 2025;13:6199–6218. doi: 10.1039/d5tb00113g. [DOI] [PubMed] [Google Scholar]
  • 22.Kobayashi T., Kan K., Nishida K., Yamato M., Okano T. Corneal regeneration by transplantation of corneal epithelial cell sheets fabricated with automated cell culture system in rabbit model. Biomaterials. 2013;34:9010–9017. doi: 10.1016/j.biomaterials.2013.07.065. [DOI] [PubMed] [Google Scholar]
  • 23.Zhao Y.H., Zhang M., Liu N.X., Lv X., Zhang J., Chen F.M., Chen Y.J. The combined use of cell sheet fragments of periodontal ligament stem cells and platelet-rich fibrin granules for avulsed tooth reimplantation. Biomaterials. 2013;34:5506–5520. doi: 10.1016/j.biomaterials.2013.03.079. [DOI] [PubMed] [Google Scholar]
  • 24.Matsuura K., Shimizu T., Okano T. Toward the development of bioengineered human three-dimensional vascularized cardiac tissue using cell sheet technology. Int. Heart J. 2014;55:1–7. doi: 10.1536/ihj.13-337. [DOI] [PubMed] [Google Scholar]
  • 25.Agrawal V., Johnson S.A., Reing J., Zhang L., Tottey S., Wang G., Hirschi K.K., Braunhut S., Gudas L.J., Badylak S.F. Epimorphic regeneration approach to tissue replacement in adult mammals. Proc. Natl. Acad. Sci. U. S. A. 2010;107:3351–3355. doi: 10.1073/pnas.0905851106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Vorotnikova E., McIntosh D., Dewilde A., Zhang J., Reing J.E., Zhang L., Cordero K., Bedelbaeva K., Gourevitch D., Heber-Katz E., Badylak S.F., Braunhut S.J. Extracellular matrix-derived products modulate endothelial and progenitor cell migration and proliferation in vitro and stimulate regenerative healing in vivo, matrix biology. journal of the International Society for Matrix Biology. 2010;29:690–700. doi: 10.1016/j.matbio.2010.08.007. [DOI] [PubMed] [Google Scholar]
  • 27.Liu Y., Ming L., Luo H., Liu W., Zhang Y., Liu H., Jin Y. Integration of a calcined bovine bone and BMSC-sheet 3D scaffold and the promotion of bone regeneration in large defects. Biomaterials. 2013;34:9998–10006. doi: 10.1016/j.biomaterials.2013.09.040. [DOI] [PubMed] [Google Scholar]
  • 28.Xie Q., Wang Z., Huang Y., Bi X., Zhou H., Lin M., Yu Z., Wang Y., Ni N., Sun J., Wu S., You Z., Guo C., Sun H., Wang Y., Gu P., Fan X. Characterization of human ethmoid sinus mucosa derived mesenchymal stem cells (hESMSCs) and the application of hESMSCs cell sheets in bone regeneration. Biomaterials. 2015;66:67–82. doi: 10.1016/j.biomaterials.2015.07.013. [DOI] [PubMed] [Google Scholar]
  • 29.Qi Y., Niu L., Zhao T., Shi Z., Di T., Feng G., Li J., Huang Z. Combining mesenchymal stem cell sheets with platelet-rich plasma gel/calcium phosphate particles: a novel strategy to promote bone regeneration. Stem Cell Res. Ther. 2015;6:256. doi: 10.1186/s13287-015-0256-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.You Q., Liu Z., Zhang J., Shen M., Li Y., Jin Y., Liu Y. Human amniotic mesenchymal stem cell sheets encapsulating cartilage particles facilitate repair of rabbit osteochondral defects. Am. J. Sports Med. 2020;48:599–611. doi: 10.1177/0363546519897912. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang J., Chen L., Wang J., Lei Y., Huang Y., Xu J., Hu N., Huang W., Cui W., Luo X. Multisite captured copper ions via phosphorus dendrons functionalized electrospun short nanofibrous sponges for bone regeneration. Adv. Funct. Mater. 2023;33 [Google Scholar]
  • 32.Liu Y., Fan Q., Huo Y., Liu C., Li B., Li Y. Construction of a mesoporous Polydopamine@GO/Cellulose nanofibril composite hydrogel with an encapsulation structure for controllable drug release and toxicity shielding. ACS Appl. Mater. Interfaces. 2020;12:57410–57420. doi: 10.1021/acsami.0c15465. [DOI] [PubMed] [Google Scholar]
  • 33.Park K.-R., Lee J.Y., Cho M., Yun H.-M. Ziyuglycoside I upregulates RUNX2 through ERK1/2 in promoting osteoblast differentiation and bone mineralization. Am. J. Chin. Med. 2021;49:883–900. doi: 10.1142/S0192415X21500427. [DOI] [PubMed] [Google Scholar]
  • 34.Ji C., Qiu M., Ruan H., Li C., Cheng L., Wang J., Li C., Qi J., Cui W., Deng L. Transcriptome analysis revealed the symbiosis niche of 3D scaffolds to accelerate bone defect healing. Adv. Sci. (Weinh.) 2022;9 doi: 10.1002/advs.202105194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhu Y., Liu H., Wu P., Chen Y., Deng Z., Cai L., Wu M. Multifunctional injectable hydrogel system as a mild photothermal-assisted therapeutic platform for programmed regulation of inflammation and osteo-microenvironment for enhanced healing of diabetic bone defects in situ. Theranostics. 2024;14:7140–7198. doi: 10.7150/thno.102779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yang Z., Zhu Y., Cheng J., Chen Y., Wu P., Liu X., Cai L., Du L., Wu M. Polyphenol-derived nanoarmor-functionalized photothermal hydrogel platform for programmed modulation of the regenerative microenvironment and bone defect healing. Small. 2025 doi: 10.1002/smll.202510733. [DOI] [PubMed] [Google Scholar]
  • 37.Lu Y., Zhang W., Wang J., Yang G., Yin S., Tang T., Yu C., Jiang X. Recent advances in cell sheet technology for bone and cartilage regeneration: from preparation to application. Int. J. Oral Sci. 2019;11:17. doi: 10.1038/s41368-019-0050-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yorukoglu A.C., Kiter A.E., Akkaya S., Satiroglu-Tufan N.L., Tufan A.C. A concise review on the use of mesenchymal stem cells in cell sheet-based tissue engineering with special emphasis on bone tissue regeneration. Stem Cell. Int. 2017;2017 doi: 10.1155/2017/2374161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Liu L., Shang Y., Li C., Jiao Y., Qiu Y., Wang C., Wu Y., Zhang Q., Wang F., Yang Z., Wang L. Hierarchical nanostructured electrospun membrane with periosteum-mimic microenvironment for enhanced bone regeneration. Adv. Healthcare Mater. 2021;10 doi: 10.1002/adhm.202101195. [DOI] [PubMed] [Google Scholar]
  • 40.Zhang H., Zhou Y., Zhang W., Wang K., Xu L., Ma H., Deng Y. Construction of vascularized tissue-engineered bone with a double-cell sheet complex. Acta Biomater. 2018;77:212–227. doi: 10.1016/j.actbio.2018.07.024. [DOI] [PubMed] [Google Scholar]
  • 41.Zhang D., Gao P., Li Q., Li J., Li X., Liu X., Kang Y., Ren L. Engineering biomimetic periosteum with β-TCP scaffolds to promote bone formation in calvarial defects of rats. Stem Cell Res. Ther. 2017;8:134. doi: 10.1186/s13287-017-0592-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Qin Q., Lee S., Patel N., Walden K., Gomez-Salazar M., Levi B., James A.W. Neurovascular coupling in bone regeneration. Exp. Mol. Med. 2022;54:1844–1849. doi: 10.1038/s12276-022-00899-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Li S., Zhang L., Liu C., Kim J., Su K., Chen T., Zhao L., Lu X., Zhang H., Cui Y., Cui X., Yuan F., Pan H. Spontaneous immunomodulation and regulation of angiogenesis and osteogenesis by Sr/Cu-borosilicate glass (BSG) bone cement to repair critical bone defects. Bioact. Mater. 2023;23:101–117. doi: 10.1016/j.bioactmat.2022.10.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sasagawa T., Shimizu T., Sekiya S., Haraguchi Y., Yamato M., Sawa Y., Okano T. Design of prevascularized three-dimensional cell-dense tissues using a cell sheet stacking manipulation technology. Biomaterials. 2010;31:1646–1654. doi: 10.1016/j.biomaterials.2009.11.036. [DOI] [PubMed] [Google Scholar]
  • 45.Matsuda N., Shimizu T., Yamato M., Okano T. Tissue engineering based on cell sheet technology. Adv. Mater. 2007;19:3089–3099. [Google Scholar]
  • 46.Pan S., Wu S., Wei Y., Liu J., Zhou C., Chen T., Zhu J., Tan W., Huang C., Feng S., Zhang B., Wei W., Zhan X., Liu C. Exploring the causal relationship between inflammatory cytokines and inflammatory arthritis: a Mendelian randomization study. Cytokine. 2024;173 doi: 10.1016/j.cyto.2023.156446. [DOI] [PubMed] [Google Scholar]
  • 47.Embree M.C., Chen M., Pylawka S., Kong D., Iwaoka G.M., Kalajzic I., Yao H., Shi C., Sun D., Sheu T.J., Koslovsky D.A., Koch A., Mao J.J. Exploiting endogenous fibrocartilage stem cells to regenerate cartilage and repair joint injury. Nat. Commun. 2016;7 doi: 10.1038/ncomms13073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Martin-Vega A., Cobb M.H. ERK1/2-MAPK signaling: Metabolic, organellar, and cytoskeletal interactions. Curr. Opin. Cell Biol. 2025;95 doi: 10.1016/j.ceb.2025.102526. [DOI] [PubMed] [Google Scholar]
  • 49.Yang J., Zhang L., Wang Y., Wang N., Wei H., Zhang S., Ding Q., Sun S., Ding C., Liu W. Dihydromyricetin-loaded oxidized polysaccharide/L-arginine chitosan adhesive hydrogel promotes bone regeneration by regulating PI3K/AKT signaling pathway and MAPK signaling pathway. Carbohydr. Polym. 2024;346 doi: 10.1016/j.carbpol.2024.122614. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (16.3MB, docx)

Data Availability Statement

Data will be made available on request.


Articles from Materials Today Bio are provided here courtesy of Elsevier

RESOURCES