Skip to main content
Animal Nutrition logoLink to Animal Nutrition
. 2026 Mar 14;25:523–535. doi: 10.1016/j.aninu.2025.09.019

Evaluating dietary cholesterol and taurine interactions: Implications for growth performance, bile acid metabolism, and lipid regulation in Chinese mitten crab (Eriocheir sinensis)

Qiuran Yu a, Xiaodan Wang a,, Song Wang a, Han Wang a, Chuanjie Qin b, Jianguang Qin c, Erchao Li a, Liqiao Chen a,
PMCID: PMC13091118  PMID: 42004259

Abstract

Cholesterol serves as a precursor for bile acids and molting hormones, while taurine is involved in bile acid conjugation and lipid regulation in vertebrates. However, their synergetic roles in crustacean nutrition remain poorly understood. This study investigated the interactions between dietary cholesterol (0%, 0.64%, and 1.00%) and taurine (0% and 0.65%) in juvenile Chinese mitten crabs (Eriocheir sinensis). A total of 960 juvenile crabs (3.08 ± 0.02 g) were randomly assigned to six dietary treatments (four replicates per treatment, 40 crabs per replicate) in a 3 × 2 factorial design for 8 weeks. Growth performance, body proximate composition, serum and hepatopancreas biochemical indices, bile acid profiles, and expression of genes related to lipid metabolism and the nutrient-sensitive mammalian target of rapamycin (mTOR) signaling pathway were evaluated. Significant improvements in final body weight, weight gain, specific growth rate, and feed conversion ratio were observed in crabs fed the diet containing 0.64% cholesterol and 0.65% taurine (P < 0.05). Dietary cholesterol significantly increased hepatopancreas total cholesterol and bile acid contents (P < 0.05), particularly taurohyodeoxycholic acid and epi-allolithocholic acid, while taurine supplementation further elevated cholic acid content. Taurine effectively reduced serum total cholesterol and low-density lipoprotein cholesterol concentrations (P < 0.05), especially at higher dietary cholesterol levels. The combination of cholesterol and taurine significantly alleviated antioxidant impairment by increasing superoxide dismutase activity (P < 0.001), and upregulated key genes in lipid metabolism (fas and cpt1a), cholesterol transport (abcg8), and mTOR pathway components (mtorc1, s6k1, and 4ebp1) (P < 0.05). Dietary 0.64% cholesterol in combination with 0.65% taurine optimized growth performance and improved the health of E. sinensis. Taurine enhanced cholesterol utilization by facilitating its conversion into bile acids and activating key nutrient-sensing pathways such as the mTOR pathway, thereby improving lipid metabolism and antioxidant capacity. These findings reveal a synergistic metabolic interaction in which taurine enhances the nutritional value of cholesterol by facilitating its conversion into signaling-active bile acids and directly modulating lipid metabolism pathways.

Keywords: Cholesterol, Eriocheir sinensis, Taurine, Bile acids, Lipid metabolism

1. Introduction

Cholesterol is an indispensable nutrient for crustaceans because most aquatic animals cannot synthesize it de novo and must obtain it from the diet (Kumar et al., 2018). Adequate dietary cholesterol is fundamental for growth, molting, and lipid metabolism in crustaceans (Zhu et al., 2022). In particular, cholesterol is a key structural component of cell membranes and lipoproteins, facilitating lipid absorption and transport and promoting lipid deposition in tissues (Yu et al., 2024). Therefore, maintaining an optimal supply and balance of dietary cholesterol is critical. For instance, in marine crustaceans such as Pacific white shrimp (Penaeus vannamei), an excessive supply of dietary cholesterol can increase whole body lipid and reduce protein content (Niu et al., 2012). This suggests that cholesterol supplied beyond physiological requirements may disrupt normal lipid deposition and protein accumulation.

Taurine is a free amino sulfonic acid that promotes growth and regulates multiple metabolic processes in aquatic animals. Although taurine is not a protein constituent, it has diverse physiological functions, including antioxidant defense, osmoregulation, and growth modulation (De Luca et al., 2015; Liu et al., 2006; Sun et al., 2023; Wang et al., 2024). Taurine supplementation has been shown to improve protein accretion and health in species such as pompano and turbot (Liu et al., 2024) by stimulating digestive enzyme activity and enhancing amino acid absorption (Shi et al., 2021). Cholesterol primarily influences lipid metabolism and deposition, whereas taurine can affect protein deposition and metabolic regulation. In this context, a critical question arises as to whether taurine can synergistically interact with other nutrients to optimize nutrient utilization, balance lipid and protein deposition, and ultimately enhance crustacean growth. In vertebrates, cholesterol is metabolized into bile acids and other signaling molecules to regulate macronutrient metabolism (Fleishman and Kumar, 2024). Some fish conjugate these bile acids with taurine to form taurine-conjugated bile salts, thereby increasing the solubility and bioactivity of bile acids for digestion (Kim et al., 2015; Shi et al., 2021; Xu et al., 2020). In many vertebrates, particularly carnivorous teleost fish, taurine is the sole or primary amino acid used for bile acid conjugation, forming taurine-conjugated salts that are critical for lipid emulsification and absorption. This makes taurine functionally necessary for normal digestive physiology in these species. In stark contrast, the nature and even the existence of a comparable bile acid conjugation pathway in crustaceans remain poorly defined. Although bile acids have been detected in some invertebrates, their metabolic origin and the potential role of taurine in their modification remain subjects of debate. This knowledge gap is a significant barrier to understanding crustacean nutritional physiology and optimizing aquafeed formulations. Accordingly, a central question is whether taurine plays a functional role in bile acid metabolism in crabs and whether it can synergistically interact with dietary cholesterol to enhance nutrient utilization and growth.

In the past, comparative research on the role of bile acids in invertebrate versus vertebrate physiology was scarce because the ability of crustaceans to synthesize bile acids remains incompletely understood. Bile acids have been detected in some invertebrates, such as sea cucumber, Pacific white shrimp, and Pacific oyster (Li et al., 2023, Li et al., 2023; Zhang et al., 2023; Zhao et al., 2022). However, it remains debatable whether bile acids in invertebrates are produced de novo, or derived from dietary or gut microbiota (Li et al., 2022). This premise is supported by preliminary data in E. sinensis, in which dietary cholesterol was shown to increase total bile acid content in the hepatopancreas, thereby establishing a direct link between cholesterol supply and the bile acid pool (Yu et al., 2024). In other aquaculture species, this link is further enhanced by taurine. For instance, the synergistic effects of co-supplementing cholesterol and taurine have been demonstrated to improve growth and cholesterol metabolism in both juvenile turbot (Scophthalmus maximus L.) and Pacific white shrimp (P. vannamei) (Yun et al., 2012; Thiruvasagam et al., 2024). Building on evidence from vertebrate physiology, analogous findings in aquaculture, and preliminary data in crabs, it is hypothesized that dietary taurine acts synergistically with cholesterol in E. sinensis. It is further proposed that taurine enhances the utilization of dietary cholesterol by promoting its conversion into a larger and more diverse pool of bioactive bile acids, thereby optimizing lipid metabolism, nutrient utilization, and overall growth.

This study aimed to evaluate the interactive effects of dietary cholesterol and taurine on growth performance, bile acid metabolism, and lipid and protein metabolic balance in the E. sinensis. Specifically, It was investigated whether taurine supplementation modulates cholesterol utilization and bile acid profiles, and how this interaction affects somatic growth and nutrient deposition. Clarifying these relationships will provide critical insights into crustacean nutritional physiology, thereby facilitating the development of sustainable diet formulations and promoting optimal growth and health in crab aquaculture.

2. Materials and methods

Experiments were conducted following the guidelines for the Care and Use of Laboratory Animals in China, approved by the Committee on the Ethics of Animal Experiments at East China Normal University (approval No. f20201001).

2.1. Experimental diets

A 3 × 2 factorial design was employed to evaluate the interactive effects of dietary cholesterol and taurine. Six isonitrogenous and isolipidic experimental diets were formulated for the study. The cholesterol levels were set at 0% (negative control), a target of 0.6% (near-optimal), and 1.2% (supra-optimal). This design was based on our previous research indicating that the optimal cholesterol level for juvenile E. sinensis growth is approximately 0.58% (Yu et al., 2024). The 1.2% level was included to assess dose-dependent responses and potential interactions at a high inclusion rate. The basal diet was formulated using purified casein and gelatin as the primary protein sources, which are inherently cholesterol-free, thus requiring no pre-treatment for sterol removal. Taurine levels were 0% or 0.6%. Detailed formulations are provided in Table 1. Actual dietary cholesterol level was determined by gas chromatography (6890B GC System, Agilent Technologies Inc., Santa Clara, CA, USA; method 994.10; AOAC, 1995), and actual dietary taurine level was determined by high-performance liquid chromatography (Agilent 1100 Series, Agilent Technologies Inc., Santa Clara, CA, USA; method 999.12; AOAC, 2000). The actual compositions were as follows: C0-T0 (cholesterol and taurine undetectable), C0.64-T0 (0.64% cholesterol, taurine undetectable), C1.00-T0 (1.00% cholesterol, taurine undetectable), C0-T0.65 (cholesterol undetectable, 0.65% taurine), C0.64-T0.65 (0.64% cholesterol, 0.65% taurine), and C1.00-T0.65 (1.00% cholesterol, 0.65% taurine). Feed pellets were prepared, air-dried, and stored at −20 °C.

Table 1.

Ingredient formulation and proximate composition of the six experimental diets fed to Eriocheir sinensis.

Items Groups, g/kg
C0-T0 C0.64-T0 C1.00-T0 C0-T0.65 C0.64-T0.65 C1.00-T0.65
Ingredients, g/kg, dry matter basis
Casein (vitamin-free) 360 360 360 360 360 360
Gelatin 90 90 90 90 90 90
Corn starch 250 250 250 250 250 250
Fish oil 6 6 6 6 6 6
Soybean oil 54 48 42 54 48 42
Cholesterol1 0 6 12 0 6 12
Lecithin 10 10 10 10 10 10
Betaine 30 30 30 30 30 30
Vitamin premix2 40 40 40 40 40 40
Mineral premix3 20 20 20 20 20 20
Choline chloride 5 5 5 5 5 5
Butylated hydroxytoluene (BHT) 1 1 1 1 1 1
Carboxymethyl cellulose 20 20 20 20 20 20
Cellulose 114 114 114 114 114 114
Taurine4 6 6 6 6 6 6
Total 1000 1000 1000 1000 1000 1000
Nutrient compositions, %,wet weight basis
Dry matter 87.23 88.56 86.79 87.10 88.92 86.45
Crude protein 42.15 41.89 42.73 41.47 42.06 41.98
Crude lipid 7.25 6.78 6.91 6.34 7.03 7.06
Organic matter 96.11 95.88 96.25 995.97 96.19 995.82
1

Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China; reagent grade, purity ≥ 97.0%).

2

Vitamin premix (per 100 g premix): retinol acetate, 0.043 g; thiamine hydrochloride, 0.15 g; riboflavin, 0.0625 g; pantothenate, 0.3 g; niacin, 0.3 g; pyridoxine hydrochloride, 0.225 g; para-aminobenzoic acid, 0.1 g; ascorbic acid, 0.5 g; biotin, 0.005 g; folic acid, 0.025 g; cholecalciferol, 0.0075 g; α-tocopherol acetate, 0.5 g; menadione, 0.05 g, cyanocobalamin, 0.01 g, and inositol, 1 g. All ingredients were filled with α-cellulose to 100 g.

3

Mineral premix (per 100 g premix): KH2PO4, 21.5 g; NaH2PO4, 10.0 g; Ca(H2PO4)2, 26.5 g; CaCO3, 10.5 g; KCl, 2.8 g; MgSO4·7H2O, 10.0 g; AlCl3·6H2O, 0.024 g; ZnSO4·7H2O, 0.476 g; MnSO4·6H2O, 0.143 g; KI, 0.023 g; CuCl2·2H2O, 0.015 g; CoCl2·6H2O, 0.14 g; calcium lactate, 16.50 g; and Fe-citrate, 1 g. All ingredients were diluted with α-cellulose to 100 g.

4

Rhawn Chemical Technology Co., Ltd. (Shanghai, China; biotechnology grade, purity ≥ 99%).

2.2. Experimental animals

A total of 960 healthy and active juvenile crabs (3.08 ± 0.02 g) were obtained from a commercial hatchery in Chongming, Shanghai, China. Upon arrival, crabs were acclimated under controlled laboratory conditions for two weeks, during which they were fed the basal diet. Following acclimation, the crabs were randomly assigned to six dietary treatment groups (four replicates per group, 24 tanks total, 40 crabs per tank, 300 L per tank). Tanks had shelters (plastic tubes, tiles) to reduce aggression. Crabs were fed to apparent satiation twice daily (13:00 and 21:00) for 8 weeks. Mortality and molting were monitored daily. Uneaten feed was removed, and 50% water was replaced daily. Water quality was maintained at 24 to 27 °C, pH 7.4 to 8.0, dissolved oxygen > 7.0 mg/L, and ammonia nitrogen < 0.05 mg/L.

2.3. Sample collection

After 8 weeks, crabs were fasted for 24 h before sampling. For biochemical and molecular analyses, only crabs in the intermolt stage (stage C), identified by a fully rigid and hardened exoskeleton (Drach and Tchernigovtzeff, 1967), were selected to minimize metabolic variations associated with the molt cycle. The number of crabs in each tank was recorded, and all crabs were weighed. Four crabs/replicate were used for whole-body composition analysis. Eight crabs per replicate were anesthetized on ice. Hemolymph was collected using a 1-mL sterile syringe from the arthrodial membrane at the base of the fourth or fifth pair of pereiopods (a minimally invasive and representative sampling site). The collected hemolymph was transferred to a 1.5-mL microcentrifuge tube, allowed to clot on ice for 30 min, and then centrifuged (4000 × g, 10 min, 4 °C). Supernatant was stored at −80 °C. The hepatopancreas was dissected, frozen in liquid nitrogen, and stored at −80 °C for enzyme activity and gene expression assays. Growth performance was evaluated using the following equations:

Weight gain (%) = 100 × [Final body weight (g) – Initial bodyweight(g)]/Initial body weight (g);
Specific growth rate (%/d) = 100 × [Ln Final body weight (g) – Ln Initial body weight (g)]/Days;
Feed conversion ratio = Dry feed intake (g)/Wet weight gain (g);
Condition factor = 100 × Final body weight (g)/Cephalothorax length (cm)3;
Feed intake (g/d) = Weight of feed consumed (g)/(Final number alive × Days);
Protein efficiency ratio = Weight gain (g)/Protein intake (g);
Survival rate (%) = 100 × Final number alive/Initial number;
Molting rate (%) = 100 × Molting number/Final number alive.

2.4. Feed and body composition analysis

Dry matterwas determined by drying at 105 °C to constant weight (method 934.01; AOAC, 2023). Crude protein (diet and whole body) was analyzed with the Kjeldahl method (method 988.05; AOAC, 2023). Crude lipids (diet and whole body) were extracted using Soxhlet extraction with diethyl ether (method 920.39; AOAC, 2023). Ash was analyzed by incineration at 550 °C for 6 h (method 920.39; AOAC, 2023). Organic matter (OM) was calculated using the following equation: OM (%) = 100 - Ash (%). Specimen analyses were conducted in quadruplicate.

2.5. Biochemical index of serum and hepatopancreas analysis

The levels of serum alanine aminotransferase (ALT; Cat. No. C009-2-1) and aspartate aminotransferase (AST; Cat. No. C010-2-1), hepatopancreas malondialdehyde (MDA; Cat. No. A003-1-2), superoxide dismutase (SOD; Cat. No. A001-3-2) and total bile acids (Cat. No. E003-2-1), as well as serum and hepatopancreas triglyceride (TG; Cat. No. A110-1-1), low-density lipoprotein cholesterol (LDL-C; Cat. No. A113-1-1), high-density lipoprotein cholesterol (HDL-C; Cat. No. A112-1-1) and total cholesterol (TCHO; Cat. No. A111-1-1) were analyzed using commercial kits (Nanjing Jiancheng Biotechnology Research Institute Co., Ltd., Nanjing, Jiangsu, China) per manufacturer protocols. Absorbance was analyzed on a microplate reader (Epoch, BioTek Instruments, Inc., Winooski, VT, USA). Sample measurements were triplicate. The comprehensive suite of analyses, from organismal to molecular levels, facilitates a multi-level investigation of dietary effects.

2.6. Analysis of bile acids

2.6.1. Sample preparation

For detailed hepatopancreatic bile acid composition, four representative groups were selected: C0-T0 (control), C0.64-T0 (optimal cholesterol, no taurine), C0-T0.65 (no cholesterol, with taurine), and C0.64-T0.65 (optimal cholesterol, with taurine). This targeted selection allowed efficient investigation of main effects and the cholesterol-taurine (CHO-TAU) interaction on bile acids. Samples (approximately 60 mg) were thawed at 4 °C, homogenized in pre-chilled methanol (600 μL), shaken (5 min), stood (4 °C, 30 min), and centrifuged (13,500 × g, 10 min). The extraction was repeated. Combined extracts were dried under nitrogen, then redissolved in 0.20 mL 80% methanol–water (containing 50 ng/mL internal standard). After centrifugation, the supernatant was collected.

2.6.2. Ultra-high performance liquid chromatography (UHPLC) analysis

Extracts were analyzed using a Waters ACQUITY UPLC I-Class system (Waters Corporation, Milford, MA, USA). An ACQUITY UPLC BEH C18 column (1.7 μm, 2.1 mm × 100 mm; Waters Corporation, Milford, MA, USA) was used (column temperature 40 °C, flow rate 300 μL/min, injection volume 6 μL). Solvent A: 0.05% formic acid in water (Fisher Scientific, Fair Lawn, NJ, USA); solvent B: 0.05% formic acid in acetonitrile (Fisher Scientific, Fair Lawn, NJ, USA). Linear gradient for B: 10% (0–1 min), 10% to 40% (1–2 min), 40% to 45% (2–5 min), 45% to 60% (5–7.5 min), 60% to 65% (7.5–9.5 min), 65% to 80% (9.5–11.5 min), 80% (11.5–13.5 min), 80% to 10% (13.5–14 min), 10% (14–16 min). Quality control samples were run regularly.

2.6.3. Mass spectrometry (MS) analysis

Mass spectrometry was performed on an AB Sciex triple quadrupole 5500 system (AB Sciex LCC, Framingham, MA, USA). Electrospray ionization (ESI) source parameters: polarity ESI, curtain gas 35 arb, collision gas 9 arb, temperature 450 °C, ion spray voltage −4500 V. Bile acids were analyzed in multiple reaction monitoring (MRM) mode, a targeted tandem mass spectrometry (MS/MS) technique. Identification was based on monitoring unique precursor-to-product ion transitions for each compound, combined with their chromatographic retention times. The identities of all analytes were unequivocally confirmed by comparison with their corresponding pure analytical standards. Data acquired with Analyst 1.6.3, peak areas and retention times extracted with MultiQuant (AB Sciex LLC, Framingham, MA, USA).

2.7. RNA extraction and gene expression analysis

Total RNA was extracted from the hepatopancreas, using TRIzol reagent (Glpbio, Inc., Montclair, CA, USA) following the manufacturer’s protocol, and its purity and concentration were determined by measuring the OD 260/280. RNA integrity was further verified by 1.5% agarose gel electrophoresis, and only samples exhibiting distinct 28S and 18S ribosomal RNA bands were used for subsequent analysis. For cDNA synthesis, 1 μg of total RNA from each sample was reverse transcribed into cDNA using the HiScript IV RT SuperMix for qPCR (+gDNA wiper) (Cat. No. R423–01; Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China) according to the manufacturer’s instructions. The resulting cDNA was stored at −20 °C for analysis. The specific primer sequences for the genes used are listed in Table 2 and were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). Prior to gene expression analysis, the stability of the candidate reference gene (β-actin) across all experimental treatments was rigorously validated. The cycle threshold (Ct) values for β-actin showed no significant variation among the different dietary groups (P > 0.05). Gene expression was analyzed via a previously described method (Livak and Schmittgen, 2001) using a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The gene symbols mentioned in the text were defined in Table S1.

Table 2.

Primer pair sequences of the genes used for real-time PCR.

Genes Sequences (5′ to 3′) GenBank accession No. or Reference
Lipogenesis
△9fad F: TGGCACAACTACCACCACGTCT Bu et al., (2020)
R: TCCTCTTCTCGATCATCTCCGG
srebp1 F: TCTTCACACCCTCTGGACGC Bu et al., (2020)
R: CCAAGGTTGTAATGGCACGC
fas F: GTCCCTTCTTCTACGCCATCC Bu et al., (2020)
R: CGCTCTCCAGGTCAATCTTCAC
Lipid catabolism and transport
cpt1a F: CATCTGGACACCCACCTCCA (Lin et al., 2021)
R: ATCTCCTCACCCGGCACTCT
cpt2 F: AGCAGGCAGTGGCTCAGTTTA (Bu et al., 2020)
R: AAGGCAAGGAAGGGGTTGTAG
mttp F: AAGCATACACCTGCGCTCAT XM_050832977.1
R: GGCCCACGATAGCTTCAAGT
Cholesterol metabolism
abca1 F: ACCTCAAGTACAGGCTCGGA XM_050842293.1
R: CCGGAACACCACGTAAGTCA
abcg8 F: CCTTCTGGACGGTATCTCGC XM_050879266.1
R: CACATAGACATAATCAACCCCGC
npc2 F: TTCTGGATGAGGAGGCGGTA MZ966501.1
R: AGGTCCGGATGTTGAAGCAG
scarb1 F: AACACGAATGGAGGCGCTTA XM_050837541.1
R: TAGAGATCCGGGTGCCAGAA
hdlbp F: GAACTCCGAGAAGAGCTCCG XM_050857737.1
R: GCATCTGCTTGGCCTTATGC
ldlr F: ACACAGACACGGACACCATC XM_050830142.1
R: GCGTCTCTCGCATATTCCCA
Bile acid metabolism
cyp27a1 F: CCGTTCAGCATCGCCTTTTT XM_050832579.1
R: GCCATAGCGTTCGATCCAGA
slc22a7 F: AGATGCTGACGTGGTAGCTC XP_027207541.1
R: GCCCGAGGATGAGGTAAAGG
mTOR signaling pathway
mtorc1 F: AGAAGCTGCATGACTGGGAC c148249_g1
R: CGGTCACACGACACACTGTA
s6k1 F: GCACCAGGCTTATTCGACCT c74214_g1
R: GGGTTGACTGTGCTGTCTGA
s6 F: TTCCGAGGGTGAACAAGACG c141087_g1
R: CTGGCCCATACGCTTCTCAT
4ebp1 F: CAAGGCTGAGCAGGACTTCA c114480_g1
R: AGCTGATCCAGGTCACAAGC
β-Actin F: TCGTGCGAGACATCAAGGAAA KM244725.1
R: AGGAAGGAAGGCTGGAAGAGTG

2.8. Statistical analysis

All data are presented as the mean and standard error of the mean (SEM). Statistical analysis was conducted using SPSS 23.0 software. A two-way analysis of variance (ANOVA) was initially performed to test the main effects of dietary cholesterol (factor A), taurine (factor B), and their interaction (A × B). The statistical model used for the two-way ANOVA was as follows:

Yijk= μ + Ai + Bj+ (A × B)ij+ ϵijk,

where Yijk represents the response variable; μ is the overall mean; Ai represents the fixed effect of dietary cholesterol levels; Bj represents the fixed effect of taurine levels, (A × B)ij represents the interaction effect between dietary cholesterol and taurine levels, and ϵijk is the random error term. The subscripts are defined as follows: i represents the level of dietary cholesterol (ranging from 1 to 3), j represents the level of dietary taurine (ranging from 1 to 2), and k represents the replicate number (ranging from 1 to 8). In the results tables, data are presented as treatment means with a single pooled SEM for each parameter. The pooled SEM was calculated from the mean square error (MSE) derived from the two-way ANOVA. Prior to ANOVA, the normality of data and homogeneity of variances were evaluated by the Shapiro–Wilk test and Levene’s test, respectively. When a significant interaction between cholesterol and taurine was detected (P < 0.05), the main effect was not interpreted separately. In this case, the six experimental treatment groups were treated as independent groups and compared using a one-way ANOVA. If the one-way ANOVA result was significant, Duncan’s multiple range test was used to determine the specific differences between group means. If the interaction effect was not significant (P ≥ 0.05), the main effects of cholesterol and taurine are evaluated. The significance level for all statistical tests was set at P < 0.05.

3. Results

3.1. Growth and molting

Cholesterol showed significant main effects on final body weight, weight gain, specific growth rate, FCR, and protein efficiency ratio (P < 0.05), and the supplementation of 0.64% cholesterol showed better effects (Table 3). Taurine reduced FCR in the C0-T0.65 group (P = 0.016), whereas it significantly decreased feed intake (P = 0.016). The C0.64-T0.65 group showed synergistic effects, outperforming all others in final body weight, weight gain, specific growth rate, protein efficiency ratio, and FCR (P < 0.05). The CHO-TAU interaction also significantly influenced condition factor (P = 0.013), with the C0.64-T0.65 group being the highest, significantly exceeding the C0-T0 and C0-T0.65 groups.

Table 3.

Effects of dietary cholesterol and taurine on growth performance, survival, and molting of juvenile Eriocheir sinensis.

Items Cholesterol, % Taurine, % Initial body weight, g Final body weight, g Weight gain, % Specific growth rate, %/d FCR Feed intake, g/d Condition factor Protein efficiency ratio Survival, % Molting rate, %
C0-T0 0 0 3.08 6.93ab 124.63ab 1.44b 1.65c 0.13 0.63a 1.45ab 89.29 78.45
C0.64-T0 0.64 0 3.08 8.39de 172.12d 1.79de 1.35ab 0.14 0.76b 1.77c 89.29 97.24
C1.00-T0 1.00 0 3.09 8.10cd 162.22cd 1.72cd 1.44bc 0.14 0.69ab 1.64bc 86.43 79.49
C0-T0.65 0 0.65 3.08 7.70bc 150.18bc 1.64c 1.33ab 0.13 0.63a 1.86c 86.43 71.64
C0.64-T0.65 0.64 0.65 3.08 8.85e 187.10e 1.88e 1.06a 0.13 0.84c 2.26d 88.57 77.72
C1.00-T0.65 1.00 0.65 3.10 6.45a 107.75a 1.30a 1.88d 0.13 0.69ab 1.28a 84.29 92.90
Pooled SEM 0.006 0.185 5.974 0.045 0.080 0.005 0.041 0.101 3.063 10.679
Means of the main effect
Cholesterol,%
0 3.08 7.32A 137.41A 1.54A 1.49AB 0.13 0.63A 1.65AB 87.86 75.04
0.64 3.08 8.62B 179.61B 1.83B 1.21A 0.13 0.80B 2.01B 88.93 87.48
1.00 3.09 7.27A 134.99A 1.51A 1.66B 0.14 0.69A 1.46A 85.36 91.19
Pooled SEM 0.005 0.131 4.224 0.032 0.056 0.003 0.029 0.072 2.166 7.551
Taurine, %
0 3.08 7.67 152.99 1.65 1.48 0.14 0.70 1.62 88.33 85.06
0.65 3.09 6.45∗ 148.46 1.61 1.42∗ 0.13∗ 0.72 1.80∗ 86.43 84.09
Pooled SEM 0.004 0.107 3.449 0.026 0.046 0.003 0.023 0.059 1.768 6.165
Two-way ANOVA (P-value)
Cholesterol 0.101 <0.001 <0.001 <0.001 0.003 0.079 <0.001 <0.001 0.683 0.309
Taurine 0.683 0.012 0.221 0.670 0.037 0.016 0.132 0.048 0.581 0.882
Interaction 0.214 0.001 <0.001 <0.001 <0.001 0.252 0.013 <0.001 0.966 0.141

FCR = feed conversion ratio.

Values are mean and standard error of the mean (SEM) of 4 replicates.

Different lowercase superscript letters within a column denote significant differences (P < 0.05) among the treatments by Duncan’s comparison test.

Different uppercase superscript letters within a column denote significant differences (P < 0.05) among the treatments with cholesterol by Duncan’s comparison test.

The significance levels of taurine are marked as ∗ (P < 0.05).

3.2. Whole-body proximate composition

Dry matter was influenced by their interaction (P = 0.045), with the highest value in the C0.64-T0.65 group (Table 4). Crude protein content was affected by cholesterol, taurine, and their interaction (P < 0.05). The C0.64-T0.65 group exhibited a crude protein content of 12.39%, compared to 9.82%–11.86% in the other experimental groups. For crude lipid, the main effect of cholesterol and its interaction with taurine were significant (P < 0.05). The C0.64-T0.65 group had the highest crude lipid content, significantly higher than in the single-supplement groups. The C1.00-T0.65 group had a relatively lower crude lipid content. Ash content did not differ significantly (P = 0.616).

Table 4.

Effects of dietary cholesterol and taurine on whole-body proximate composition (%, wet weight basis) of juvenile Eriocheir sinensis.

Items Cholesterol, % Taurine, % Dry matter Crude protein Crude lipid Ash
C0-T0 0 0 30.51a 9.82a 3.65a 12.83
C0.64-T0 0.64 0 30.48a 11.86ab 4.90b 11.67
C1.00-T0 1.00 0 31.05ab 11.72ab 4.63ab 12.62
C0-T0.65 0 0.65 31.69ab 11.18ab 4.30b 12.07
C0.64-T0.65 0.64 0.65 34.16b 12.39b 6.29c 12.22
C1.00-T0.65 1.00 0.65 29.14a 11.78ab 4.10ab 13.12
Pooled SEM 0.962 0.265 0.337 0.522
Means of the main effect
Cholesterol, %
0 31.10 10.50a 3.97a 12.45
0.64 32.32 12.13b 5.60b 11.95
1.00 30.10 11.75b 4.36a 12.87
Pooled SEM 0.680 0.188 0.238 0.369
Taurine, %
0 30.68 11.14 4.39 12.38
0.65 31.66 11.72∗ 4.89 12.47
Pooled SEM 0.555 0.153 0.195 0.301
Two-way ANOVA (P-value)
Cholesterol 0.110 <0.001 <0.001 0.296
Taurine 0.225 0.015 0.085 0.679
Interaction 0.045 0.048 0.034 0.616

Values are mean and standard error of the mean (SEM) of 4 replicates.

Different lowercase superscript letters within a column denote significant differences (P < 0.05) among the treatments by Duncan’s comparison test.

Different uppercase superscript letters within a column denote significant differences (P < 0.05) among the treatments with cholesterol by Duncan’s comparison test.

The significance levels of taurine are marked as ∗ (P < 0.05).

3.3. Antioxidant capacity and hepatopancreatic health

Serum ALT and AST activities showed no significant difference among groups (P > 0.05, Table 5). For hepatopancreatic antioxidant capacity, cholesterol and taurine had highly significant effects on MDA concentrations (P < 0.05), with a significant interaction (P < 0.001). The C1.00-T0 group had the highest MDA concentration, whereas the C0.64-T0.65 had the lowest. Cholesterol significantly decreased SOD activity (P < 0.001) and had a significant interaction with taurine (P = 0.017).

Table 5.

Effects of dietary cholesterol and taurine on serum ALT and AST activities and hepatopancreatic MDA concentration and SOD activities in Eriocheir sinensis.

Item Cholesterol, % Taurine, % ALT, U/L AST, U/L MDA, nmol/mg prot SOD, U/mg prot
C0-T0 0 0 57.43 35.40 8.12b 14.00bc
C0.64-T0 0.64 0 58.28 39.01 6.55ab 14.00b
C1.00-T0 1.00 0 69.78 38.88 15.13c 10.30a
C0-T0.65 0 0.65 72.43 62.34 7.32b 16.29c
C0.64-T0.65 0.64 0.65 50.21 54.87 4.36a 12.05b
C1.00-T0.65 1.00 0.65 51.28 46.69 6.48ab 12.94b
Pooled SEM 7.402 6.649 0.875 0.691
Means of main effect
Cholesterol, %
0 64.93 48.87 7.72B 15.14C
0.64 54.24 46.94 5.46A 13.02B
1.00 60.53 42.78 10.81C 11.62A
Pooled SEM 55.234 4.702 0.619 0.489
Taurine, %
0 61.83 37.76 9.27 12.77
0.65 57.97 54.63 6.05∗ 13.76
Pooled SEM 4.274 3.839 0.505 0.399
Two-way ANOVA (P-value)
Cholesterol 0.352 0.820 <0.001 <0.001
Taurine 0.552 0.076 <0.001 0.155
Interaction 0.084 0.597 <0.001 0.017

ALT = alanine aminotransferase; AST = aspartate aminotransferase; MDA = malondialdehyde; SOD = superoxide dismutase.

Values are mean and standard error of the mean (SEM) of 4 replicates.

Different lowercase superscript letters within a column denote significant differences (P < 0.05) among the treatments by Duncan’s comparison test.

Different uppercase superscript letters within a column denote significant differences (P < 0.05) among the treatments with cholesterol by Duncan’s comparison test.

The significance levels of taurine are marked as ∗ (P < 0.05).

3.4. Cholesterol metabolism-related gene expression

Expression of cholesterol transport, efflux, and recognition genes varied (Fig. 1). abca1 expression was upregulated by cholesterol (P = 0.001, Fig. 1A). abcg8 was significantly regulated by cholesterol (P < 0.001), and by the interaction (P = 0.006, Fig. 1B), with a significant upregulation in the C1.00-T0.65 group. npc2 and scarb1 were upregulated by cholesterol and taurine (P < 0.05, Fig. 1C and D), peaking in the C1.00-T0.65 group. hdlbp was affected by cholesterol (P = 0.002, Fig. 1E), with the highest expression in the C1.00-T0 group. ldlr was downregulated by cholesterol (P = 0.041, Fig. 1F).

Fig. 1.

Fig. 1

Effects of dietary cholesterol and taurine levels on the expression of cholesterol metabolism-related genes in the hepatopancreas of Eriocheir sinensis. Relative mRNA expression levels of (A) abca1, (B) abcg8, (C) npc2, (D) scarb1, (E) hdlbp, and (F) ldlr were analyzed (n = 8). CHO = cholesterol. Data are presented as mean ± standard error of the mean (SEM). Two-way ANOVA was performed to assess the main effects of dietary cholesterol, taurine, and their interaction. When a significant interaction was detected (P < 0.05), one-way ANOVA followed by Duncan’s multiple range test was conducted to compare all treatment groups. If no significant interaction was observed (P ≥ 0.05), one-way ANOVA followed by Duncan’s test was applied within each taurine level to assess the effect of cholesterol. Different lowercase letters indicate significant differences among cholesterol levels at 0% taurine, while uppercase letters denote differences at 0.65% taurine (P < 0.05). Asterisks (∗) indicate significant differences between taurine levels within the same cholesterol level (P < 0.05).

3.5. Lipid metabolism-related biochemical indices and gene expression

Serum TCHO was significantly lower in the C1.00-T0 group than in the other treatments (P < 0.001, Table 6). Taurine alone did not affect serum TCHO (P = 0.525). Hepatopancreas TCHO was increased by cholesterol (P < 0.001), with the highest concentration in the C1.00-T0 group. Taurine significantly decreased hepatopancreas TCHO (P < 0.001). Serum TG was significantly increased by the main effect of cholesterol (P < 0.001), and there was a significant interaction with taurine (P < 0.001). Hepatopancreas TG content was significantly decreased by 1.00% cholesterol (P < 0.001), and significantly increased by the main effect of taurine (P < 0.001). Serum LDL-C concentrations were significantly affected by cholesterol, taurine, and their interaction (P < 0.05), with the lowest observed in the C0-T0.65 group. Serum HDL-C concentrations were also affected by the main effect of cholesterol (P < 0.001), and 1.00% cholesterol significantly reduced HDL-C concentrations (P < 0.001), and a significant CHO-TAU interaction was observed (P = 0.001).

Table 6.

Effects of dietary cholesterol and taurine levels on serum and hepatopancreatic biological parameters in Eriocheir sinensis.

Items Cholesterol, % Taurine, % TCHO (serum), mmol/L TCHO (hepa), mmol/g prot TG (serum), mmol/L TG (hepa), mmol/g prot LDL-C (serum), mmol/L HDL-C (serum), mmol/L Total bile acid (hepa), μmol/g prot
C0-T0 0 0 0.36c 0.08a 0.37a 0.62c 0.17c 0.07bc 0.005
C0.64-T0 0.64 0 0.34c 0.09a 0.39a 0.69bc 0.14bc 0.10c 0.006
C1.00-T0 1.00 0 0.09a 0.40b 0.73c 0.07a 0.07a 0.02a 0.007
C0-T0.65 0 0.65 0.18b 0.09a 0.43ab 0.82a 0.03a 0.08bc 0.007
C0.64-T0.65 0.64 0.65 0.35c 0.09a 0.47b 0.81b 0.12b 0.07bc 0.125
C1.00-T0.65 1.00 0.65 0.31c 0.07a 0.47b 0.63b 0.11b 0.06b 0.008
Pooled SEM 0.026 0.009 0.026 0.039 0.013 0.009 0.002
Means of the main effect
Cholesterol, %
0 0.27A 0.09A 0.40A 0.72B 0.10A 0.07B 0.006
0.64 0.34B 0.09A 0.43A 0.75B 0.13B 0.09C 0.066
1.00 0.20A 0.24B 0.60B 0.35A 0.09A 0.04A 0.008
Pooled SEM 0.019 0.006 0.018 0.028 0.009 0.006 0.001
Taurine, %
0 0.26 0.19 0.50 0.46 0.13 0.06 0.006
0.65 0.28 0.08∗ 0.46 0.75∗ 0.08∗ 0.07 0.046
Pooled SEM 0.015 0.005 0.015 0.023 0.007 0.005 0.001
Two-way ANOVA (P-value)
Cholesterol <0.001 <0.001 <0.001 <0.001 0.007 <0.001 <0.001
Taurine 0.525 <0.001 0.074 <0.001 <0.001 0.190 0.012
Interaction <0.001 <0.001 <0.001 <0.001 <0.001 0.001 0.227

TCHO = total cholesterol; TG = triglyceride; LDL-C = low-density lipoprotein cholesterol; HDL-C = high-density lipoprotein cholesterol.

Values are mean and standard error of the mean (SEM) of 4 replicates.

Different lowercase superscript letters within a column denote significant differences (P < 0.05) among the treatments by Duncan’s comparison test.

Different uppercase superscript letters within a column denote significant differences (P < 0.05) among the treatments with cholesterol by Duncan’s comparison test.

The significance levels of taurine are marked as ∗ (P < 0.05).

In lipid metabolism gene expression (Fig. 2), fas expression was affected by cholesterol, taurine, as well as by their interaction (P < 0.05), peaking in the C0.64-T0 group. Δ9fad was upregulated and then downregulated by the main effect of cholesterol, reaching its highest level in the C0.64-T0 group, and at 0.00 and 0.64% cholesterol (Fig. 2B). srebp1 was upregulated by cholesterol (P = 0.007), with higher expression in 0.64% and 1.00% cholesterol groups (Fig. 2C). cpt1a was significantly affected by cholesterol and its interaction with taurine (P = 0.002), peaking in the C0.64-T0.65 group (Fig. 2D). cpt2 was significantly affected by cholesterol and taurine (P < 0.05), but there was no interaction (P = 0.051, Fig. 2E). mttp was significantly affected by the CHO-TAU interaction (P < 0.001), with highest expression in the C1.00-T0.65 group (Fig. 2F).

Fig. 2.

Fig. 2

Effects of dietary cholesterol and taurine levels on lipid metabolism-related gene expression in the hepatopancreas of Eriocheir sinensis. Relative mRNA expression levels of (A) fas, (B) Δ9fad, (C) srebp1, (D) cpt1a, (E) cpt2, and (F) mttp were analyzed (n = 8). CHO = cholesterol. Data are presented as mean ± standard error of the mean (SEM). Two-way ANOVA was used to evaluate the effects of dietary cholesterol, taurine, and their interaction. When significant interaction effects were detected (P < 0.05), one-way ANOVA followed by Duncan’s multiple range test was conducted to identify differences among all groups. If no significant interaction was observed (P ≥ 0.05), one-way ANOVA and Duncan’s test were applied within each taurine level separately. Different lowercase and uppercase letters indicate significant differences among cholesterol levels at 0% and 0.65% taurine, respectively (P < 0.05). Asterisks indicate significant differences between taurine levels within the same cholesterol level (∗P < 0.05, ∗∗P < 0.01).

3.6. Bile acid profile

In the hepatopancreas, total bile acid content (Table 6), profiles (Fig. 3A–C), and related gene expression (Fig. 3D and E) were assessed. Cholesterol (P < 0.001) and taurine (P = 0.012) significantly increased hepatopancreas total bile acid contents, with no significant interaction (P = 0.227). The highest total bile acid content was observed in the C0.64-T0.65 group, whereas the lowest occurred in the C0-T0 group. Epiallolithocholic acid (EALCA) was predominant, especially in the C0.64-T0.65 group, followed by cholic acid (CA). Taurohyodeoxycholic acid (THDCA) and taurocholic acid (TCA) were the principal taurine-conjugated bile acids. Principal component analysis (PCA) showed clear group separations (PC1, 84.8%; PC2, 7.19%), with C0-T0 distinct. The heatmap showed that CA increased in C0-T0.65 and C0.64-T0.65 groups (P < 0.05). Taurohyodeoxycholic acid and EALCA significantly increased under the main effect of cholesterol (P < 0.05). Expression of the bile acid synthesis enzyme cyp27a1 significantly increased with cholesterol (P < 0.001). Taurine and the interaction effects were not significant (P > 0.05). The bile acid transporter slc22a7 showed no significant changes (P > 0.05), although a slight upward trend was observed with increasing cholesterol levels.

Fig. 3.

Fig. 3

Effects of dietary cholesterol and taurine on bile acid metabolism in hepatopancreas of Eriocheir sinensis. (A) Total bile acid content in hepatopancreas; (B) composition of bile acid profiles; (C) Principal component analysis (PCA) of bile acid composition among treatment groups; (D) heatmap illustrating abundance changes and statistical significance of individual bile acids; relative mRNA expression levels of (E) cyp27a1 and (F) slc22a7. CHO = cholesterol. Data are presented as means ± standard error of the mean (SEM) (n = 8 per group). Two-way ANOVA was performed to analyze the main effects of dietary cholesterol, taurine, and their interaction. When significant interactions were observed (P < 0.05), differences among all groups were analyzed by one-way ANOVA followed by Duncan’s multiple-range test. If no significant interactions were detected (P ≥ 0.05), differences within each taurine level were analyzed separately. Different lowercase and uppercase letters represent significant differences at 0% and 0.65% taurine levels, respectively (P < 0.05). Principal component analysis and heatmap analyses were conducted using normalized bile acid abundance data. Statistical significance in the heatmap was determined by two-way ANOVA, and significant P-values (P < 0.05) are highlighted in bold boxes.

3.7. Mammalian target of rapamycin (mTOR) signaling pathway

mtorc1 expression was significantly influenced by taurine and by the CHO-TAU interaction (P < 0.05, Fig. 4A), and was showed the highest in the C0.64-T0.65 group. s6 expression was significantly affectedby cholesterol and taurine (P < 0.05), although no significant interaction was found (P = 0.166). Taurine elevated s6 at 0.64% and 1.00% cholesterol (P = 0.004, Fig. 4B). s6k1 expression was not affected by individual factors (P > 0.05), but their interaction was significant (P = 0.036), with the most pronounced increase in the C0.64-T0.65 group (Fig. 4C). Expression of 4ebp1 was mainly influenced by CHO-TAU interaction (P = 0.001), and was highest in the C1.00-T0.65 group (Fig. 4D).

Fig. 4.

Fig. 4

Effects of cholesterol and taurine on the expression levels of key genes in the mTOR signaling pathway in the hepatopancreas of Eriocheir sinensis. Relative mRNA expression levels of (A) mtorc1, (B) s6, (C) s6k1, and (D) 4ebp1 were analyzed (n = 8). CHO = cholesterol. Data are presented as mean ± standard error of the mean (SEM). Two-way ANOVA was used to evaluate the effects of dietary cholesterol, taurine, and their interaction. When significant interaction effects were detected (P < 0.05), one-way ANOVA followed by Duncan’s multiple range test was conducted to identify differences among all groups. If no significant interaction was observed (P ≥ 0.05), one-way ANOVA and Duncan’s test were applied within each taurine level separately. Different lowercase and uppercase letters indicate significant differences among cholesterol levels at 0% and 0.65% taurine, respectively (P < 0.05). Asterisks indicate significant differences between taurine levels within the same cholesterol level (∗ P < 0.05, ∗∗ P < 0.01).

4. Discussion

This study demonstrates that dietary cholesterol and taurine exert both individual and interactive effects on the growth performance, lipid metabolism, and antioxidant capacity of juvenile E. sinensis. Dietary cholesterol is essential for crustaceans, which lacks the capacity for de novo sterol synthesis (Kumar et al., 2018). This study confirms that 0.64% dietary cholesterol supplementation significantly enhanced growth performance compared to a cholesterol-deficient diet. However, the most profound improvements in final body weight, weight gain, and feed conversion ratio were observed in the C0.64-T0.65 group, which received both cholesterol and taurine. This synergistic effect aligns with findings in P. vannamei and S. maximus L., where co-supplementation enhanced these parameters and cholesterol metabolism (Thiruvasagam et al., 2024; Yun et al., 2012). This superior growth resulted from better nutrient distribution in the body. The C0.64-T0.65 group not only excelled in growth rate and feed conversion, but its highest PER value also directly demonstrates that this dietary combination significantly enhanced the crab’s efficiency in utilizing and converting dietary protein for somatic growth. The C0.64-T0.65 diet resulted in the highest deposition of crude protein and crude lipid, indicating that the synergy between cholesterol and taurine promotes efficient conversion of dietary nutrients into somatic tissue. Furthermore, this metabolic efficiency was coupled with improved physiological health. The C1.00-T0 group exhibited the highest concentration of MDA, a marker of lipid peroxidation, while the C0.64-T0.65 group showed the lowest MDA concentration. This suggests that taurine plays a crucial protective role, counteracting the potential oxidative stress associated with increased cholesterol metabolism (Guertin et al., 1993). This reduction in oxidative stress likely creates a more favorable intracellular environment, preserving metabolic function and contributing to the observed growth enhancement. Furthermore, the study found that the C1.00-T0.65 group exhibited a high molting rate, yet its final body weight was the lowest among all groups. Cholesterol is an indispensable precursor for the synthesis of ecdysteroids in crustaceans, and its excess may act as a potent endocrine signal that frequently initiates the molting process. However, molting itself is an extremely energy-intensive process (Zhu et al., 2022). In this study, the highest FCR value in the C1.00-T0.65 group indicates that most of the ingested energy was used to support frequent molting behavior rather than for effective nutrient accumulation. Overall, these findings are highly relevant for formulating modern high-lipid aquafeeds, which are often also rich in cholesterol. These results demonstrate that high dietary cholesterol induces oxidative stress, whereas taurine plays a critical role in enabling its safe utilization. By enhancing the conversion of cholesterol into bile acids and mitigating associated oxidative damage, taurine supplementation becomes a targeted solution to manage the cholesterol burden in energy-dense feeds, allowing for higher energy inclusion without compromising animal health.

A central mechanism underlying this synergy appears to be the modulation of the bile acid pool. In this study, both dietary cholesterol and taurine independently contributed to the increase in total hepatopancreatic bile acid content, and this effect was significantly amplified by taurine supplementation. This suggests that cholesterol provides the substrate, while taurine, via conjugation, expands the bile acid pool and accelerates turnover (Aragão et al., 2023; Miyazaki et al., 2020), consistent with findings in shrimp (Thiruvasagam et al., 2024). The upregulation of cyp27al expression in response to dietary cholesterol provides a potential molecular link for this synergy. In vertebrates, CYP27A1 is a key mitochondrial enzyme in the alternative pathway of bile acid synthesis (National Cancer Institute, 2020). While a complete de novo synthesis pathway in crustaceans remains to be fully clarified, the observed upregulation of a cyp27a1 suggests that E. sinensis possesses enzymes to metabolize cholesterol into bile acid precursors. The amplification of the total bile acid pool by taurine co-supplementation indicates that taurine facilitates the efficient processing of these precursors, a role consistent with its function in vertebrates. Therefore, while results hint at some endogenous metabolic capacity, confirming a true de novo synthesis pathway and disentangling it from the significant contributions of the gut microbiome requires further extensive investigation. Similar to the grass carp (Cyprinus carpio L.), shrimp exhibit enterohepatic circulation of bile acids (Li et al., 2023, Li et al., 2023). In this process, the organic anion transporter (solute carrier family 22 member 7 [SLC22A7]), which is involved in bile acid metabolism, showed no significant changes in expression, possibly indicating a stable enterohepatic circulation capacity (Engelhart et al., 2020). Co-supplementation significantly increased CA, THDCA, and EALCA. Cholic acid promotes lipid digestion and absorption (Chiang and Ferrell, 2019; Su et al., 2023). Taurohyodeoxycholic acid enhances lipid metabolism, immunity, and digestion in aquatic species (Xu et al., 2022). Epiallolithocholic acid is a secondary bile acid produced by the microbial metabolism of lithocholic acid (LCA) (Kelsey and Sexton, 1977). The significant increase observed in the co-supplemented groups provides evidence of a host–microbiome interaction mediating the observed synergy. This demonstrates that the enhanced primary bile acid pool, driven by cholesterol and taurine, provides more substrate for microbial biotransformation. These secondary bile acids are potent signaling molecules known to influence host metabolism, including activation of receptors such as the vitamin D receptor (Pols et al., 2017), which provides negative feedback on bile acid synthesis (Parks et al., 1999). Thus, the CHO-TAU synergy creates a more diverse and bioactive bile acid profile that contributes to the physiological benefits. Appropriate dietary levels of cholesterol and taurineoptimize bile acid profiles.

The interaction between cholesterol and taurine extends to directly regulating lipid homeostasis. Increased dietary cholesterol prompted an adaptive response, upregulating hepatopancreatic genes involved in cholesterol transport and uptake, such as abca1, npc2, scarb1, hdlbp, and ldlr. ATP-binding cassette transporter A1 (ABCA1) and ATP-binding cassette transporter G8 (ABCG8) facilitate reverse cholesterol transport and sterol excretion (Brewer and Santamarina-Fojo, 2003; Yu and Tang, 2022); SCARB1 enhances hepatopancreatic uptake of high-density lipoprotein (HDL) and low-density lipoprotein (LDL) bound cholesterol (Von Eckardstein, 2020; Wijers et al., 2019); Niemann-Pick type C2 (NPC2) improves intracellular trafficking; and high-density lipoprotein-binding protein (HDLBP) supports HDL-mediated clearance (Cánovas et al., 2009; Storch and Xu, 2009). This coordinated gene activation suggests enhanced reverse cholesterol transport, hepatic cholesterol uptake, and intracellular cholesterol mobilization, collectively providing substrates for bile acid synthesis. Notably, dietary taurine further amplified the expression of several of these genes, particularly npc2 and scarb1, underscoring its role in promoting cholesterol utilization and transport. This effect of taurine is likely linked to its role in increasing total bile acids to improve lipid emulsification and can influence cholesterol transport gene expression (Miyazaki et al., 2019). The synergistic effect of co-supplementing cholesterol and taurine was particularly evident in the marked elevation of abcg8, a key sterol exporter. While high cholesterol alone might lead to bottlenecks in its conversion to bile acids, taurine facilitates efficient conjugation and excretion. This expands the bile acid pool, improves lipid emulsification, and activates bile acid-responsive efflux pathways. Consequently, cholesterol is effectively absorbed, mobilized, and utilized for essential processes such as membrane biosynthesis and ecdysteroid production, without leading to detrimental accumulation. Dietary cholesterol and taurine interactively regulate cholesterol metabolism-related genes in E. sinensis. Taurine optimizes cholesterol handling by enhancing its conversion into bile acids and promoting a high metabolic turnover, especially under increased cholesterol availability. This coordinated action optimizes cholesterol handling and lipid digestion, ultimately improving growth performance.

This efficiency is also reflected in fatty acid metabolism. Dietary cholesterol supplementation significantly affected lipid metabolism in E. sinensis. Specifically, it upregulated hepatopancreatic lipogenic genes, including srebp1 and its downstream targets fas and Δ9fad, indicating stimulated de novo fatty acid synthesis (Li et al., 2023, Li et al., 2023). This profile suggests a metabolic shift towards lipid synthesis and export rather than catabolism, potentially leading to lipid accumulation (Tontonoz, 2011). Taurine supplementation, particularly when combined with cholesterol, effectively counteracted these cholesterol-induced effects. Crabs receiving both cholesterol and taurine exhibited lower expression of fas, and Δ9fad compared to those fed cholesterol alone, signifying reduced fatty acid synthesis. Crucially, taurine co-supplementation markedly increased the expression of cpt1a, a key gene in fatty acid β-oxidation. This ability of taurine to modulate lipogenesis and promote fatty acid oxidation has been noted in other aquatic species (Bonfleur et al., 2015; Zhou et al., 2024). The synergistic interaction between dietary cholesterol and taurine resulted in a more balanced lipid metabolic profile. The combined supplementation moderated cholesterol-induced lipogenesis, promoted fatty acid oxidation, and interactively modulated systemic lipid parameters, such as serum LDL-C and HDL-C concentrations, thereby contributing to overall lipid homeostasis. Furthermore, taurine-conjugated bile acids can upregulate key genes involved in fatty acid β-oxidation, such as CPT1A, thereby enhancing fatty acid oxidation in the liver and peripheral tissues and increasing energy expenditure. This mechanism further supports improvements in blood lipid profiles and lipid homeostasis (Wang et al., 2023). Taurine-conjugated bile acids also enhance HDL-mediated reverse cholesterol transport and manage LDL and very low-density lipoprotein (VLDL) levels (Murakami et al., 1998). Overall, this finding indicates that the synergistic supplementation of cholesterol and taurine is crucial for maintaining lipid homeostasis in E. sinensis, promoting efficient nutrient utilization and optimal growth.

The improvements in cholesterol and lipid metabolism, particularly in the C0.64-T0.65 group, likely created a favorable nutritional environment, activating the mTOR signaling pathway, a central growth regulator (Jewell and Guan, 2013). mTORC1 integrates nutrient and growth factor signals to stimulate protein synthesis and cell growth (Department of Health, Human Performance, and Recreation, Waco and Willoughby, 2015). In this study, Co-supplementation upregulated key mTOR components (mtorc1, s6, and s6k1). Several mechanisms could link dietary intervention to mTOR activation. Firstly, improved digestion and absorption of nutrients, facilitated by an optimized bile acid profile, could lead to greater availability of amino acids and energy substrates, which are known activators of mTOR. For example, a study in grass carp found that dietary bile acids could activate the mTOR pathway (Peng et al., 2019). In Pacific white shrimp (P. vannamei), bile acids and their metabolites can regulate intestinal health, nutrient absorption, and immune responses, thereby indirectly influencing growth-related signaling pathways, including the mTOR pathway (Su et al., 2021). Secondly, specific bile acids themselves may act as signaling molecules. For instance, LCA (an isomer of EALCA) has been reported to activate mTOR signaling in vertebrate models (Chao et al., 2019). The increased EALCA in the C0.64-T0.65 group could therefore directly contribute to mTOR activation. Notably, the transcript for the translational inhibitor 4ebp1 was highest in the C1.00-T0.65 group, which exhibited the poorest growth. This is likely explained by the fact that the inhibitory activity of eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) is controlled by phosphorylation, and upregulation of its gene is a recognized response to cellular stress from excess dietary cholesterol. While precise upstream links in crustaceans need further study, these findings suggest that CHO-TAU synergy on nutrient processing and bile acid metabolism converges on mTOR to promote anabolism and growth. This aligns with the general benefits of bile acids on crustacean growth and gut health.

5. Conclusion

This study elucidates the complex synergistic mechanism through which dietary cholesterol and taurine enhance the growth performance and metabolic health of E. sinensis. The efficacy of the optimal dietary combination (0.64% cholesterol and 0.65% taurine) is attributed to a multifaceted metabolic network. In this network, cholesterol serves as a fundamental substrate, while taurine facilitates the conversion of cholesterol into a more diverse bile acid pool, enhances antioxidant defenses, and directly modulates lipid transport and utilization. The resulting bile acids not only aid in digestion but also act as critical signaling molecules. All these factors converge to activate the mTOR signaling pathway, thereby promoting protein synthesis and nutrient assimilation, ultimately leading to superior growth performance. These results provide essential guidelines for formulating practical aquafeeds, demonstrating that a balanced CHO-TAU ratio is vital for efficiency. Future investigations are warranted to fully understand the endogenous bile acid synthesis pathways in crustaceans, to quantify the metabolic contribution of the gut microbiome, and to decipher the specific signaling functions of key bile acid molecules.

Credit Author Statement

Qiuran Yu: Writing – original draft, Visualization, Software. Xiaodan Wang: Writing – review & editing, Visualization, Resources, Data curation. Song Wang: Validation, Data curation. Han Wang: Visualization, Supervision, Software, Conceptualization. Chuanjie Qin: Funding acquisition. Jianguang Qin: Writing – review & editing, Validation. Erchao Li: Writing – review & editing, Validation, Formal analysis. Liqiao Chen: Writing – review & editing, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgments

This work was supported by grants from the National Key R & D Program of China (2023YFD2402000); China Agriculture Research System of MOF and MARA; the Agriculture Research System of Shanghai, China (202504); Shanghai Agriculture Applied Technology Development Program, China (Grant No. T2024213, No. T2023326).

Footnotes

Peer review under the responsibility of Chinese Association of Animal Science and Veterinary Medicine

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.aninu.2025.09.019.

Contributor Information

Xiaodan Wang, Email: xdwang@bio.ecnu.edu.cn.

Liqiao Chen, Email: lqchen@bio.ecnu.edu.cn.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.docx (18.7KB, docx)

References

  1. Aragão C., Teodósio R., Colen R., Richard N., Rønnestad I., Dias J., Conceição L.E.C., Ribeiro L. Taurine supplementation to plant-based diets improves lipid metabolism in Senegalese Sole. Animals. 2023;13:1501. doi: 10.3390/ani13091501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bonfleur M.L., Borck P.C., Ribeiro R.A., Caetano L.C., Soares G.M., Carneiro E.M., Balbo S.L. Improvement in the expression of hepatic genes involved in fatty acid metabolism in obese rats supplemented with taurine. Life Sci. 2015;135:15–21. doi: 10.1016/j.lfs.2015.05.019. [DOI] [PubMed] [Google Scholar]
  3. Brewer H.B., Santamarina-Fojo S. New insights into the role of the adenosine triphosphate–binding cassette transporters in high-density lipoprotein metabolism and reverse cholesterol transport. Am J Cardiol. 2003;91:3–11. doi: 10.1016/S0002-9149(02)03382-9. [DOI] [PubMed] [Google Scholar]
  4. Bu X., Lin Z., Liu S., et al. Effects of myo-inositol on growth performance, body composition, antioxidant status, non-specific immunity and lipid metabolism of juvenile Chinese mitten crab (Eriocheir sinensis) Aquacult Nutr. 2020;26:1623–1635. doi: 10.1111/anu.13107. [DOI] [Google Scholar]
  5. Cánovas E., Quintanilla R., Badaoui B., Porredón C., Gallardo D., Pena R.N., Díaz I., Amills M. Pig HDL-binding protein (HDLBP) genotype is associated with intramuscular fat percentage. Livest Sci. 2009;126:298–301. doi: 10.1016/j.livsci.2009.06.005. [DOI] [Google Scholar]
  6. Chao S., Xiaojun L., Haizhen W., Ludi F., Shaozhen L., Zhiwen S., Weiliang H., Chunhong J., Ying W., Fan W., Yunfei G. Lithocholic acid activates mTOR signaling inducing endoplasmic reticulum stress in placenta during intrahepatic cholestasis of pregnancy. Life Sci. 2019;218:300–307. doi: 10.1016/j.lfs.2018.12.050. [DOI] [PubMed] [Google Scholar]
  7. Chiang J.Y.L., Ferrell J.M. Bile acids as metabolic regulators and nutrient sensors. Annu Rev Nutr. 2019;39:175–200. doi: 10.1146/annurev-nutr-082018-124344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. De Luca A., Pierno S., Camerino D.C. Taurine: the appeal of a safe amino acid for skeletal muscle disorders. J Transl Med. 2015;13:243. doi: 10.1186/s12967-015-0610-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Department of Health, Human Performance, and Recreation. Waco S., Willoughby D. Mtorc1 signaling-activated increases in muscle protein synthesis induced by leucine and phosphatidic acid: a brief review. IJFNS. 2015;2:1–6. doi: 10.15436/2377-0619.15.011. [DOI] [Google Scholar]
  10. Drach P., Tchernigovtzeff C. Sur la méthode de détermination des stades d’intermue et son application générale aux crustacés. Vie Milieu. 1967:595–610. [Google Scholar]
  11. Engelhart D.C., Granados J.C., Shi D., Saier Jr., M.H., Baker M.E., Abagyan R., Nigam S.K. Systems biology analysis reveals eight SLC22 transporter subgroups, including OATs, OCTs, and OCTNs. IJMS. 2020;21:1791. doi: 10.3390/ijms21051791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fleishman J.S., Kumar S. Bile acid metabolism and signaling in health and disease: molecular mechanisms and therapeutic targets. Sig Transduct Target Ther. 2024;9:97. doi: 10.1038/s41392-024-01811-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Guertin F., Roy C.C., Lepage G., Yousef I., Tuchweber B. Liver membrane composition after short-term parenteral nutrition with and without taurine in Guinea pigs: the effect to taurine. Exp Biol Med. 1993;203:418–423. doi: 10.3181/00379727-203-43617. [DOI] [PubMed] [Google Scholar]
  14. Jewell J.L., Guan K.-L. Nutrient signaling to mTOR and cell growth. Trends Biochem Sci. 2013;38:233–242. doi: 10.1016/j.tibs.2013.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kelsey M.I., Sexton S.A. Isolation and purification of lithocholic acid metabolites produced by the intestinal microflora. J Chromatogr A. 1977;133:327–334. doi: 10.1016/S0021-9673(00)83490-1. [DOI] [PubMed] [Google Scholar]
  16. Kim S.-K., Kim K.-G., Kim K.-D., Kim K.-W., Son M.-H., Rust M., Johnson R. Effect of dietary taurine levels on the conjugated bile acid composition and growth of juvenile Korean rockfish Sebastes schlegeli (Hilgendorf) Aquac Res. 2015;46:2768–2775. doi: 10.1111/are.12431. [DOI] [Google Scholar]
  17. Kumar V., Sinha A.K., Romano N., Allen K.M., Bowman B.A., Thompson K.R., Tidwell J.H. Metabolism and nutritive role of cholesterol in the growth, gonadal development, and reproduction of crustaceans. Rev Fisher Sci Aquacult. 2018;26(2):254–273. doi: 10.1080/23308249.2018.1429384. [DOI] [Google Scholar]
  18. Li M., Wang J., Deng H., Li L., Huang X., Chen D., Ouyang P., Geng Y., Yang S., Yin L., Luo W., Jiang J. The damage of the crayfish (Procambarus Clarkii) digestive organs caused by Citrobacter Freundii is associated with the disturbance of intestinal microbiota and disruption of intestinal-liver axis homeostasis. Front Cell Infect Microbiol. 2022;12 doi: 10.3389/fcimb.2022.940576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Li R.-X., Chen L.-Y., Limbu S.M., Qian Y.-C., Zhou W.-H., Chen L.-Q., Luo Y., Qiao F., Zhang M.-L., Du Z.-Y. High cholesterol intake remodels cholesterol turnover and energy homeostasis in Nile tilapia (Oreochromis niloticus) Mar Life Sci Technol. 2023;5:56–74. doi: 10.1007/s42995-022-00158-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Li X., Li H., Qu K., Liu Y., Chi S., Yang Q., Tan B., Zhang S., Xie S. Dietary bile acids promote sterol metabolism, bile acids enterohepatic circulation, and apoptosis in juvenile Pacific white shrimp (Litopenaeus vannamei) Anim Feed Sci Technol. 2023;303:115710. doi: 10.1016/j.anifeedsci.2023.115710. [DOI] [Google Scholar]
  21. Liu H., Gao W., Wen W., Zhang Y. Taurine modulates calcium influx through L-type voltage-gated calcium channels in isolated cochlear outer hair cells in Guinea pigs. Neurosci Lett. 2006;399:23–26. doi: 10.1016/j.neulet.2006.01.070. [DOI] [PubMed] [Google Scholar]
  22. Lin Z., Bu X., Wang N., Lei Y., Liu S., Wang X., et al. Dietary phospholipid alleviates the adverse effects of high-lipid diet in Chinese mitten crab (Eriocheir sinensis) Aquaculture. 2021;531:735899. doi: 10.1016/j.aquaculture.2020.735899. [DOI] [Google Scholar]
  23. Liu D., Mi J., Yan X., Qin C., Wang J., Nie G. Taurine alleviated the negative effects of an oxidized lipid diet on growth performance, antioxidant properties, and muscle quality of the common carp (Cyprinus carpio L.) Aquac Nutr. 2024;2024 doi: 10.1155/2024/5205506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the $2^{-∖Delta∖Delta C_T}$ method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  25. Miyazaki T., Sasaki S.-I., Toyoda A., Wei F.-Y., Shirai M., Morishita Y., Ikegami T., Tomizawa K., Honda A. Impaired bile acid metabolism with defectives of mitochondrial-tRNA taurine modification and bile acid taurine conjugation in the taurine depleted cats. Sci Rep. 2020;10:4915. doi: 10.1038/s41598-020-61821-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Miyazaki T., Sasaki S., Toyoda A., Shirai M., Ikegami T., Matsuzaki Y., Honda A. The effects of taurine depletion on bile acid composition and its amino acid-conjugation in the bile of cats. FASEB J. 2019;33 doi: 10.1096/fasebj.2019.33.1_supplement.765.1. [DOI] [Google Scholar]
  27. Murakami S., Kondo-Ohta Y., Tomisawa K. Improvement in cholesterol metabolism in mice given chronic treatment of taurine and fed a high-fat diet. Life Sci. 1998;64:83–91. doi: 10.1016/S0024-3205(98)00536-0. [DOI] [PubMed] [Google Scholar]
  28. National Cancer Institute CYP27A1 gene. Definition Qeios. 2020 doi: 10.32388/I83U0P. [DOI] [Google Scholar]
  29. Niu J., Chen P.-F., Tian L.-X., Liu Y.-J., Lin H.-Z., Yang H.-J., Liang G.-Y. Excess dietary cholesterol may have an adverse effect on growth performance of early post-larval Litopenaeus vannamei. J Anim Sci Biotechnol. 2012;3:19. doi: 10.1186/2049-1891-3-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Official methods of analysis of AOAC INTERNATIONAL. 22nd ed. Oxford University Press; New York: 2023. [DOI] [Google Scholar]
  31. Official Methods of Analysis of AOAC INTERNATIONAL. 22nd ed. Oxford University Press; Oxford: 2023. [DOI] [Google Scholar]
  32. Official Methods of Analysis of AOAC INTERNATIONAL. 17th ed. AOAC International; Gaithersburg, MD: 2000. [Google Scholar]
  33. Parks D.J., Blanchard S.G., Bledsoe R.K., Chandra G., Consler T.G., Kliewer S.A., Stimmel J.B., Willson T.M., Zavacki A.M., Moore D.D., Lehmann J.M. Bile acids: natural ligands for an orphan nuclear receptor. Science. 1999;284:1365–1368. doi: 10.1126/science.284.5418.1365. [DOI] [PubMed] [Google Scholar]
  34. Peng X.-R., Feng L., Jiang W.-D., Wu P., Liu Y., Jiang J., Kuang S.-Y., Tang L., Zhou X.-Q. Supplementation of exogenous bile acid improved growth and intestinal immune function associated with NF-κB and TOR signalling pathways in on-growing grass carp (Ctenopharyngodon idella): enhancement the effect of protein-sparing by dietary lipid. Fish Shellfish Immunol. 2019;92:552–569. doi: 10.1016/j.fsi.2019.06.047. [DOI] [PubMed] [Google Scholar]
  35. Pols T.W.H., Puchner T., Korkmaz H.I., Vos M., Soeters M.R., De Vries C.J.M. Lithocholic acid controls adaptive immune responses by inhibition of Th1 activation through the Vitamin D receptor. PLoS One. 2017;12 doi: 10.1371/journal.pone.0176715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shi Y., Hu Y., Wang Z., Zhou J., Zhang J., Zhong H., Fu G., Zhong L. The protective effect of taurine on oxidized fish-oil-induced liver oxidative stress and intestinal barrier-function impairment in juvenile Ictalurus punctatus. Antioxidants. 2021;10:1690. doi: 10.3390/antiox10111690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Storch J., Xu Z. Niemann–Pick C2 (NPC2) and intracellular cholesterol trafficking. Biochim Biophys Acta Mol Cell Biol Lipids. 2009;1791:671–678. doi: 10.1016/j.bbalip.2009.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Su C., Liu X., Li J., Zhang M., Pan L., Lu Y., Wang Y., Ding Y. Effects of bile acids on the growth performance, lipid metabolism, non-specific immunity and intestinal microbiota of Pacific white shrimp (Litopenaeus vannamei) Aquac Nutr. 2021;27:2029–2041. doi: 10.1111/anu.13338. [DOI] [Google Scholar]
  39. Su X., Gao Y., Yang R. Gut microbiota derived bile acid metabolites maintain the homeostasis of gut and systemic immunity. Front Immunol. 2023;14 doi: 10.3389/fimmu.2023.1127743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sun Y., Du X., Yang Y., Wang A., Gu Z., Liu C. Dietary taurine intake affects the growth performance, lipid composition, and antioxidant defense of juvenile Ivory Shell (Babylonia areolata) Animals. 2023;13:2592. doi: 10.3390/ani13162592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Thiruvasagam T., Felix N., Nazir M.I., Ranjan A., Prabu E. Enhanced cholesterol utilization and impact on growth through taurine supplementation in high plant-based diets of Pacific white shrimp, Penaeus vannamei in biofloc system. Anim Feed Sci Technol. 2024;316:116057. doi: 10.1016/j.anifeedsci.2024.116057. [DOI] [Google Scholar]
  42. Tontonoz P. Transcriptional and posttranscriptional control of cholesterol homeostasis by liver X receptors. Cold Spring Harbor Symp Quant Biol. 2011;76:129–137. doi: 10.1101/sqb.2011.76.010702. [DOI] [PubMed] [Google Scholar]
  43. Von Eckardstein A. LDL contributes to reverse cholesterol transport. Circ Res. 2020;127:793–795. doi: 10.1161/CIRCRESAHA.120.317721. [DOI] [PubMed] [Google Scholar]
  44. Wang L., Sagada G., Wang C., Liu R., Li Q., Zhang C., Yan Y. Exogenous bile acids regulate energy metabolism and improve the health condition of farmed fish. Aquaculture. 2023;562 doi: 10.1016/j.aquaculture.2022.738852. [DOI] [Google Scholar]
  45. Wang L., Xie Z., Wu M., Chen Y., Wang X., Li X., Liu F. The role of taurine through endoplasmic reticulum in physiology and pathology. Biochem Pharmacol. 2024;226:116386. doi: 10.1016/j.bcp.2024.116386. [DOI] [PubMed] [Google Scholar]
  46. Wijers M., Zanoni P., Liv N., Vos D.Y., Jäckstein M.Y., Smit M., Wilbrink S., Wolters J.C., Van Der Veen Y.T., Huijkman N., Dekker D., Kloosterhuis N., Van Dijk T.H., Billadeau D.D., Kuipers F., Klumperman J., Von Eckardstein A., Kuivenhoven J.A., Van De Sluis B. The hepatic WASH complex is required for efficient plasma LDL and HDL cholesterol clearance. JCI Insight. 2019;4 doi: 10.1172/jci.insight.126462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xu H., Zhang Q., Kim S.-K., Liao Z., Wei Y., Sun B., Jia L., Chi S., Liang M. Dietary taurine stimulates the hepatic biosynthesis of both bile acids and cholesterol in the marine teleost, tiger puffer (Takifugu rubripes) Br J Nutr. 2020;123:1345–1356. doi: 10.1017/S0007114520000161. [DOI] [PubMed] [Google Scholar]
  48. Xu J., Xie S., Chi S., Zhang S., Cao J., Tan B. Protective effects of taurocholic acid on excessive hepatic lipid accumulation via regulation of bile acid metabolism in grouper. Food Funct. 2022;13:3050–3062. doi: 10.1039/D1FO04085E. [DOI] [PubMed] [Google Scholar]
  49. Yu X.-H., Tang C.-K. In: HDL metabolism and diseases, advances in experimental medicine and biology. Zheng L., editor. Springer Nature Singapore; Singapore: 2022. ABCA1, ABCG1, and cholesterol homeostasis; pp. 95–107. [DOI] [PubMed] [Google Scholar]
  50. Yu Q., Liu J., Li E., Huang Y., Song M., He L., Shi Q., Wang X., Qin J.G., Chen L. Exploring the effects of dietary cholesterol on growth, immunity, and lipid metabolism of juvenile Chinese mitten crabs (Eriocheir sinensis) Aquac Rep. 2024;38:102297. doi: 10.1016/j.aqrep.2024.102297. [DOI] [Google Scholar]
  51. Yun B., Ai Q., Mai K., Xu W., Qi G., Luo Y. Synergistic effects of dietary cholesterol and taurine on growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed high plant protein diets. Aquaculture. 2012;324–325:85–91. doi: 10.1016/j.aquaculture.2011.10.012. [DOI] [Google Scholar]
  52. Zhang J., Hao P., Han L., Xie J., Gao C., Li Y., Zhang X., Liu P., Guo C., Hao Z., Ding J., Chang Y., Wang L. UHPLC-MS/MS metabolomics analysis of sea cucumber (Apostichopus japonicus) processed using different methods. Heliyon. 2023;9 doi: 10.1016/j.heliyon.2023.e21854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhao Z., Jiang J., Pan Y., Dong Y., Wang B., Gao S., Chen Z., Guan X., Wang X., Zhou Z. Sea cucumber body vesicular syndrome is driven by the pond water microbiome via an altered gut Microbiota. mSystems. 2022;7 doi: 10.1128/msystems.01357-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhou Y., Bai F., Xiao R., Chen M., Sun Y., Ye J. Proteomics and its combined analysis with transcriptomics: liver fat-lowering effect of taurine in high-fat Fed grouper (Epinephelus coioides) Animals. 2024;14:2039. doi: 10.3390/ani14142039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zhu T., Zhou Q., Yang Z., Zhang Y., Luo J., Zhang X., Shen Y., Jiao L., Tocher D.R., Jin M. Dietary cholesterol promotes growth and ecdysone signalling pathway by modulating cholesterol transport in swimming crabs (Portunus trituberculatus) Anim Nutr. 2022;10:249–260. doi: 10.1016/j.aninu.2022.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (18.7KB, docx)

Articles from Animal Nutrition are provided here courtesy of KeAi Publishing

RESOURCES