Abstract
Escherichia coli (E. coli) is a facultative anaerobic Gram‐negative bacterium that is not only commensal, inhabiting the intestinal tract of humans and warm‐blooded animals, but also a major opportunistic pathogen causing several diseases, mainly foodborne. E. coli is also involved in a wide range of niches including plant surfaces and tissues. Some strains of E. coli produce extended‐spectrum β‐lactamases (ESBL), which reduces the efficacy of β‐lactam antibiotics which is one of the most commonly used antibiotics. Therefore, contamination of fresh produce with E. coli, potentially carrying ESBL, can pose a significant health risk. This study aims to detect ESBL genes in E. coli isolated from raw vegetables, using in‐house designed primers for polymerase chain reaction (PCR). A total of 117 fresh produce and environmental samples was obtained from selected urban gardens, along with 348 fresh produce from selected wet markets in Metro Manila, Philippines. Using culture in mTEC agar and confirmation by uidA gene detection using conventional PCR, a total of 74 samples tested positive for E. coli. These were subjected to phenotypic and molecular detection of ESBL genes, using primer pairs for three ESBL genes blaCTX-M, blaTEM, and blaSHV designed in this study. Overall, the prevalence of ESBL‐producing E. coli in this study was 5.41%. The primers designed successfully amplified the desired amplicon sizes, demonstrating potential utility in PCR‐based detection of ESBL genes in E. coli isolates. The results of the research may be used to improve the current detection methods of ESBL‐producing bacteria thereby contributing to the current knowledge on antimicrobial resistance in foodborne pathogens.
1. Introduction
Escherichia coli (E. coli) is a facultative, anaerobic Gram‐negative bacterium that inhabits the intestinal tracts of humans and warm‐blooded animals. While most E. coli strains are commensals, they retain remarkable genetic flexibility that enables them to adapt to a diverse niche and acquire certain virulence traits. As a result, E. coli is not only a natural resident of the gut but also a major opportunistic pathogen associated with diarrheal diseases, urinary tract infections, septicemia, neonatal meningitis, and other clinical infections in both humans and animals [1, 2]. Indeed, it is recognized as one of the most significant foodborne pathogens alongside Salmonella spp. and Campylobacter [2]. E. coli is a common contaminant in food production systems, particularly in fresh produce. Vegetables can become contaminated at multiple points along the farm‐to‐fork chain, including through irrigation water, soil, fertilizers, animal intrusion, handling by farm workers, and postharvest processing [3, 4]. Vegetable contamination by organisms, such as E. coli, can happen through various mechanisms. E. coli has been shown to attach to root surfaces whereby it can be internalized into the plant shoots and other tissues. Contamination of stems and vegetables also happens via the stomata, necrotic lesions, or through the damaged tissues of the vegetables and further proliferates through biofilm formation [4]. Numerous foodborne outbreaks linked to leafy greens and other fresh produce highlight the public health concern surrounding this organism [5].
E. coli also plays a critical role in the global antimicrobial resistance (AMR) crisis. Lacking intrinsic resistance to most antimicrobials, E. coli is highly receptive to selective pressures imposed by antimicrobial use in humans and food‐producing animals [6]. The presence of antimicrobial‐resistant E. coli in fresh produce, especially the extended‐spectrum β‐lactamase (ESBL)‐producing strains, additionally represents a food safety issue that can potentially cause both agricultural and clinical risks [5, 7].
ESBLs are a diverse group of β‐lactamases that are characteristically able to hydrolyze third‐generation cephalosporins as well as aztreonam but can be inhibited by β‐lactamase inhibitors, such as clavulanic acid [8, 9]. ESBL‐producing microorganisms not only complicate treatment with the use of β‐lactam antibiotics but they can also potentially complicate the treatments with other drugs as reports show that the presence of ESBLs can co‐occur with other antibiotic resistance genes conferring resistance to antibiotics, such as colistin, carbapenem, aminoglycosides, and fluoroquinolones [10–12]. Additionally, this concerns both the healthcare industry and the agricultural sector due to transmissibility [13]. ESBL‐producing E. coli (ESBL‐E. coli) had been observed to be transmitted between humans, livestock, and food crops, as well as through the environment [13–19]. Several reports from the Philippines highlight the presence of ESBL‐E. coli from both agricultural and clinical settings. Vital et al. [19] and Gundran et al. [20] demonstrated the presence of ESBLs found in irrigation water and broiler farms, respectively. This highlights the risk of cross‐contamination between animal hosts and fresh produce. However, ESBL‐E. coli have been demonstrated in hospital isolates by Cruz et al. [21] and Lota and Latorre [22] wherein both studies show the alarming increase in the presence of ESBL‐producing bacteria isolated from humans.
ESBLs are a significant factor that affects the effectiveness of antibiotic treatment [8–12]. There is a significant amount of literature showing the presence of ESBL‐E. coli in fresh produce [7, 23–25]. In recent years, there has been an increase in the preference for the consumption of raw or minimally processed fresh produce due to nutritional advantages [26, 27]. Thus, surveillance of ESBLs is needed to help prevent the further spread of antibiotic resistance and ensure food safety.
Currently, conventional phenotypic methods, such as the combination disk test, double disk synergism test, and ESBL brilliance agar screening [28], have been the cornerstone in the surveillance of antibiotic resistance. However, the main disadvantage of the phenotypic method is the long turnaround time which can delay the decision‐making process for the proper course of antibiotic treatment. Fortunately, with the advancement of technology, detection of AMR genes, such as ESBL, can now be carried out using nucleic acid amplification assays targeting ESBL‐associated genes, such as blaSHV, blaTEM, and blaCTX‐M [29]. Molecular methods, such as the polymerase chain reaction (PCR), provide a faster way of detecting and identifying pathogenic species, virulence determinants, and AMR genes, therefore overcoming the disadvantages brought about by the phenotypic methods.
This study aims to apply the PCR‐based method in the detection of ESBL genes present in E. coli isolates obtained from selected urban farms and wet markets in Metro Manila, Philippines. Specifically, the researchers aim to develop new primer sets to be used in the detection of ESBL genes.
2. Materials and Methods
2.1. Sample Collection and Isolation of E. coli
Three urban farms and four wet markets in Metro Manila, Philippines, were selected as sampling sites for this study. Vegetable species and environmental samples (i.e., soil, irrigation water, and domestic animal feces) were randomly collected based on their availability at each location. These samples were collected and processed immediately in the laboratory for E. coli isolation using mTEC agar (Millipore, USA), a medium used to selectively grow thermotolerant E. coli, directly from wash samples without the need for prior enrichment steps. Then, confirmation of E. coli was performed molecularly, through the detection of the uidA gene in the isolates by conventional PCR. A more detailed description of the sampling, E. coli isolation, and E. coli confirmation was discussed in [30]. Confirmed E. coli isolates were maintained in a microcentrifuge tube of 1‐mL trypticase soy broth (TSB) (BD, Germany) with 30% glycerol for long‐term storage.
2.2. ESBL Screening and Confirmation (Phenotypic)
E. coli isolates in glycerol stocks were first revived before ESBL screening. Briefly, the glycerol stocks were centrifuged at 10,000 rpm, and the supernatant was discarded. The pellet was resuspended using 200 μL of fresh TSB, and using a sterile loop, it was streaked onto nutrient agar plate and incubated at 37°C for 24 h. To ensure that the isolates were free of contaminants, they were restreaked to Eosin Methylene Blue (EMB) (BD, Germany) agar plates and incubated at 37°C for 24 h for the observation of the typical E. coli colonies (green to black colonies with or without the presence of green metallic sheen). The cultures were then screened phenotypically for ESBL production. Colonies from the EMBA plates were picked and transferred to 0.85% NaCl solution until a turbidity equivalent to that of 0.5 McFarland solution was achieved. A sterile cotton swab was dipped in the solution and used to make a lawn on Mueller–Hinton Agar (BD BBL) plates containing the following 30 μg antibiotic disks: ceftazidime, cefotaxime, ceftriaxone, and aztreonam (Oxoid). The plates were incubated at 35°C for 18 h. The zones of inhibition were measured, and samples that showed a diameter of less than 22 mm for ceftazidime, 27 mm for aztreonam, 25 mm for ceftriaxone, and 27 mm for cefotaxime were suspected to be ESBL producers (Table 1).
TABLE 1.
Zone diameter interpretative as potential ESBL‐producing E. coli based on CLSI M100 performance standards for antimicrobial susceptibility testing, 34th edition [31].
| Antibiotic | Zone of inhibition (mm) |
|---|---|
| Ceftazidime (CAZ) | ≤ 22 |
| Aztreonam (ATM) | ≤ 27 |
| Ceftriaxone (CRO) | ≤ 25 |
| Cefotaxime (CTX) | ≤ 27 |
Presumptive ESBL producers were then subjected to phenotypic confirmation of ESBL according to the methods of Kumar et al. [32], done using the double disk synergy test (DDST). Disks containing 30 μg of ceftazidime, cefotaxime, ceftriaxone, and aztreonam were placed on an MHA plate with amoxicillin/clavulanate disk placed on the center of the plate. If the zone of inhibition was observed to be pointing toward the direction of the amoxicillin–clavulanate antibiotic disk, it was considered an ESBL producer (Figure 1). E. coli 25,922 and Klebsiella pneumoniae 700,603 were used for the negative and positive controls, respectively.
FIGURE 1.

DDST showing the characteristic zone of inhibition that is enhanced toward the clavulanic acid–containing disk, also called the “keyhole” zone of inhibition pattern.
2.3. ESBL Gene Primer Design
The National Center for Biotechnology Information (NCBI) database was queried for three ESBL genes (blaCTX-M, blaTEM, and blaSHV), and the first returned sequences for each gene were used (accession numbers: MT636767.1 for blaCTX-M, KU664682.1 for blaTEM, and NG_148673.1 for blaSHV). Using the sequences obtained, primers were designed using NCBI Primer Blast where default parameters were used except as follows: (1) minimum, optimum, and maximum primer melting temperatures were 55, 58, and 60, respectively; (2) database was set to “nr,” and (3) primers must have at least 3 total mismatches to unintended targets and at least 3 mismatches within the last 5 bps at the 3′ end. Then, using Primer Stat (bioinformatics.org), GC clamp, hairpin, and self‐annealing were analyzed to check for primer stability. The primer sequence was sent to Macrogen Asia Pacific Pte Ltd for synthesis.
2.4. Molecular Confirmation of ESBL Genes
Overnight cultures in tryptic soy broth (Merck) were subjected to DNA extraction using NEB Monarch Genomic Extraction Kit, following instructions. PCR amplification of ESBL genes was done using (1) the primers from published literature using the PCR settings described in each reference and (2) using the newly designed primer in this study (Table 2) and the PCR settings described in Table 3. The PCR amplicons were visualized using gel electrophoresis using the following settings: For amplicons below 200 bp, gel electrophoresis was run using 2% agarose gel for 35 min at 100 V. The 50 bp DNA ladder (Cleaver) was used for checking the size of bands. For amplicons 200 bp and larger, gel electrophoresis was run using 1% gel for 35 min at 100 V and using a 1 kb ladder (Meridian Bioscience 1 kb HyperLadder).
TABLE 2.
Primers used in this study.
| Primer name | Sequence (5′‐3′ direction) | Reference |
|---|---|---|
| CTX‐M‐U1 | 5′‐ATGTGCAGYACCAGTAARGTKATGGC‐3′ | [33] |
| CTX‐M‐U2 | 5′‐TGGGTRAARTARGTSACCAGAAYCAGCGG‐3′ | [33] |
| TEM‐F | 5′‐GCGGAACCCCTATTTG‐3′ | [34] |
| TEM‐R | 5′‐ACCAATGCTTAATCAGTGAG‐3′ | [34] |
| blaSHVF | 5′‐ATGCGTTATATTCGCCTGTG‐3′ | [35] |
| blaSHVR | 5′‐TGCTTTGTTATTCGGGCCAA‐3′ | [35] |
| CTX‐M750F | 5′‐GGGTAAAGCATTGGGTGACA‐3′ | this study |
| CTX‐M154R | 5′‐GATATCGTTGGTGGTGCCAT‐3′ | this study |
| TEM870F | 5′‐TAACTCGCCTTGATCGTTGG‐3′ | this study |
| TEM324R | 5′‐GACTCCCCGTCGTGTAGATA‐3′ | this study |
| SHV861F | 5′‐CGCCATTACCATGAGCGATA‐3′ | this study |
| SHV419R | 5′‐CCCGCAGATAAATCACCACA‐3′ | this study |
TABLE 3.
Polymerase chain reaction conditions used for amplification of ESBL genes.
| Steps | Temperature (°C) | Duration (seconds) | ||||
|---|---|---|---|---|---|---|
| CTX‐M750F/CTX‐M154R | TEM870F/TEM324R | SHV861F/SHV419R | CTX‐M750F/CTX‐M154R | TEM870F/TEM324R | SHV861F/SHV419R | |
| Initial denaturation | 95 | 95 | 95 | 180 | 180 | 180 |
| Denaturation | 95 | 95 | 95 | 60 | 60 | 60 |
| Annealing | 59 | 59 | 58 | 30 | 30 | 30 |
| Extension | 72 | 72 | 72 | 20 | 30 | 30 |
| Final extension | 72 | 72 | 72 | 300 | 300 | 300 |
| Number of cycles | 20 | |||||
3. Results
A total of 117 fresh produce and environmental samples from selected urban gardens and 348 fresh produce from selected wet markets were obtained, with a total of 74 isolates molecularly confirmed to be E. coli (Table 4). On the 74 E. coli isolates, phenotypic detection of ESBL was performed using the DDST, which showed that 4 of 74 isolates were positive for the presence of ESBL (5.41%) (Table 5). Using the primers published by earlier authors, ESBL genes blaCTX-M and blaTEM were detected in all the 4 positive samples, while blaSHV was not detected. The same results were obtained using the primers developed in this study (Figures 2, 3, and 4). Appropriate results were also obtained when tested against E. coli ATCC 25922, 2 nontarget bacteria, 3 phenotypically negative E. coli isolates from this study, and the recommended positive controls for the ESBL genes (Klebsiella quasipneumoniae ATCC 700603 and Salmonella spp.). This suggests that the developed primers are sensitive only to the intended targets, although more study must be done on this to include more samples (Table 6).
TABLE 4.
Prevalence of E. coli in various sample matrices collected from urban gardens and wet markets in Metro Manila.
| Sample matrix | Prevalence of E. coli | |
|---|---|---|
| Wet market | Urban farms | |
| Soil | — | 2/18 (11.11%) |
| Fecal samples from domestic animals | — | 10/11 (90.91%) |
| Fresh produce | 42/348 (12.07%) | 15/71 (21.13%) |
| Irrigation water | — | 5/17 (29.41) |
TABLE 5.
Confirmation of ESBL in E. coli isolates from vegetables through DDST and PCR (N = 75).
| Isolate ID | DDST result | PCR result | |||||
|---|---|---|---|---|---|---|---|
| AZT | CTX | CAZ | CRO | blaCTX-M | blaTEM | blaSHV | |
| 36WM3 | + | + | − | − | + | + | − |
| 1UG2W | + | + | + | + | + | + | − |
| F2UG2W | + | + | + | − | + | + | − |
| F2UG1W | + | + | + | + | + | + | − |
FIGURE 2.
Detection of blaCTX-M gene using primers CTX‐M‐U1/CTX‐M‐U2 (a) and CTX‐M750F/CTX‐M154R (b). The primers successfully amplified the target blaCTX-M gene of around 593 and 154 bp. (samples from lane 2: positive control, negative control, phenotypically ESBL‐positive E. coli isolates).

(a)

(b)
FIGURE 3.
Detection of blaTEM gene using primers TEM‐F/TEM‐R (a) and TEM870F/TEM324R (b). The primers successfully amplified the target blaTEM gene of around 964 and 324 bp. (samples from lane 2: positive control, negative control, phenotypically ESBL‐positive E. coli isolates).

(a)

(b)
FIGURE 4.
Detection of blaSHV gene using primers blaSHVF/blaSHVR (a) and SHV861F/SHV419R (b). The primers successfully amplified the target blaSHV gene of around 745 and 419 bp. (samples from lane 2: positive control, negative control, phenotypically ESBL‐positive E. coli isolates).

(a)

(b)
TABLE 6.
Characteristics of the primers designed in this study.
| Primer name | Product length | tm | %GC | GC clamp | Self‐annealing | Hairpin formation |
|---|---|---|---|---|---|---|
| CTX‐M750F | 154 | 60.50 | 50 | Pass | Pass | Pass |
| CTX‐M154R | 59.50 | 50 | Pass | Pass | Pass | |
| TEM870F | 324 | 59.50 | 50 | Pass | Pass | Pass |
| TEM324R | 61.00 | 55 | Pass | Pass | Pass | |
| SHV861F | 419 | 58.6 | 50 | Pass | Pass | Pass |
| SHV419R | 59.9 | 50 | Pass | Pass | Pass | |
4. Discussion
Our results demonstrated a low prevalence of ESBL‐E. coli (5.33%), similar to reports from South Korea (0.83%, N = 1324) and Thailand (4.6%, N = 305) [24, 25]. Additionally, the ESBL‐E. coli from the South Korean study was also found to be multidrug resistant (MDR), notably to ampicillin, nalidixic acid, piperacillin, cefazoline, and cefotaxime [24, 25]. However, a relatively higher prevalence has been reported in the region. In a study conducted in Malaysia, more than half of the samples of lettuce (N = 95) and bean sprouts (N = 85) were found to harbor ESBL‐E. coli [7]. In the study done in Pakistan, nearly half of E. coli isolates were phenotypically ESBL‐positive [36]. These findings highlight the widespread contamination of vegetables with E. coli and the presence of ESBL‐producing strains, indicating potential health risks associated with the consumption of raw or minimally cooked vegetables, despite the low prevalence observed. However, direct comparisons should be interpreted with caution due to methodological and contextual differences. This includes variations in sample size, samples analyzed, sampling strategies, and season, as well as detection techniques used. These factors can substantially influence the reported prevalence. For instance, leafy vegetables with larger surface areas may be prone to contamination (Murtaza et al., 2023), while differences in cultivation, irrigation, and postharvest practices may further contribute to variability. These considerations highlight the need for standardized methodologies in assessing E. coli as well as the presence of antibiotic‐resistant strains in fresh produce.
The presence of ESBL genes confers resistance to antibiotics, such as penicillin, cephalosporins (first to third generation), and aztreonam [37]. These antibiotics are important to both human health and agriculture, as they are the most prescribed antibiotics to treat infections caused by Listeria, Neisseria, Proteus mirabilis, Salmonella, Shigella, and E. coli, among others [38]. ESBL resistance leads to the compromised or prolonged treatment of these infections, resulting in significant medical and agricultural loss. Additionally, resistance to ESBLs is often associated with resistance to other common antimicrobial agents used clinically, such as sulfamethoxazole, gentamicin, trimethoprim, and fluoroquinolones [39]. Furthermore, bacterial plasmids of ESBL‐producing Enterobacteriaceae (ESBL‐E) may also harbor plasmids that carry a few other antibiotic resistance genes [40, 41]. For example, a study demonstrated the cotransfer of fluoroquinolone resistance determinant with ESBL‐carrying plasmids [42, 43]. This further extends resistance to multiple classes of antibiotics, making treatment more challenging. Additionally, this leads to even heavier usage of a variety of antibiotics which is also another risk factor in further acquisition of antibiotic resistance determinants. In fact, through the years, there has been an increased trend in antibiotic resistance to the preferred antibiotics including third‐generation cephalosporins, ampicillin, gentamicin, and tetracycline [44]. Therefore, ESBL producers pose a significant challenge in the clinical setting.
Despite the low occurrence observed in this study, the detection of ESBL genes in both vegetable and environmental samples is noteworthy. Environmental matrices, such as soil, irrigation water, and domestic animal feces, are important reservoirs of AMR. Contaminated irrigation water particularly sourced from untreated surface waters can introduce ESBL‐ and other antibiotic‐resistant bacteria directly onto crops (Igbinosa et al., 2023). Similarly, soil may serve as a long‐term reservoir for resistant organisms, especially when exposed to runoff or untreated manure. The detection of ESBL‐E in this study supports the hypothesis that fresh produce contamination may occur preharvest through environmental pathways. In addition, the presence of domestic animals in or near urban farming systems may further contribute to fecal contamination, facilitating the transfer for resistant bacteria to soil, and therefore, crops (Devarajan et al., 2023).
While phenotypic detection of bacteria via culture is very important in its surveillance and, therefore, control, this method is laborious and time‐consuming which warrants a need to develop and optimize methods for fast detection. Detection of pathogens via PCR has been explored in the literature and applied in the field. For example, when the uidA gene has been established to be present in about 94%–96% of E. coli strains, it has been the focus of primer design and application for its molecular detection [45, 46]. However, the uidA primer has its shortcomings, such as producing false‐positive results involving Hafnia alvei and Serratia spp. instead of E. coli. In addition, another primer called the lacZ, only correctly identified 70% of the 324 coliform isolates [47]. Primers for various other gene targets for E. coli were designed and are widely used in the literature, such as the yaiO [48], the ECO [49], and uspA [50].
Aside from the identification of pathogenic bacteria, primer design studies have also focused on the detection of antibiotic resistance genes in bacteria, and these proved advantageous as well for understanding the dissemination of these genes to other organisms as well as the environment. However, there are a few studies that conducted primer design and validation for the detection of ESBL genes in E. coli. A key contribution of this study is the design and preliminary validation of primers targeting three clinically relevant ESBL genes (blaCTX-M, blaTEM, and blaSHV). Analysis using PrimerStat showed that the primers passed primer stability parameters, such as the percent GC content, self‐complementarity in the 5′ and 4′ ends, GC clamp formation, self‐annealing, and hairpin formation. The performance of these primer pairs was compared with the previous ESBL gene primers described in the literature (Figures 2, 3, and 4) using in vitro PCR amplification. Although the new set of primers targeted different regions of the selected genes and thus resulted in different amplicon sizes, they showed parallel results with the previous primers used. There were amplifications on the expected band size for both blaCTX-M and blaTEM, while the desired bands for blaSHV were not detected for the E. coli isolates in this study. Unlike conventional phenotypic methods, this gene‐targeted PCR approach enables direct detection of resistance determinants, allowing for more specific and sensitive identification of ESBL‐producing organisms. This is particularly valuable for detecting low‐abundance or nonculturable bacteria and for understanding the genetic basis of resistance dissemination in environmental and food matrices. Furthermore, the primers demonstrated stable amplification and similar melting temperatures, supporting their potential application in a multiplex PCR format. To further validate the utility of these newly developed primers, a wider scale field application must be done to generate results based on a larger sample size. The next step is also to develop a multiplex PCR using these primers as their melting temperatures are almost identical.
This study demonstrated the presence of ESBL genes from E. coli isolated from raw vegetables from selected supermarkets and urban gardens in Metro Manila, Philippines. As there is an increasing popularity of eating minimally processed vegetables due to nutritional benefits, this indicates a potential threat of consumption of ESBL‐E. coli‐contaminated raw vegetables. Further, aside from the immediate health consequences, ESBL‐E. coli can also colonize the gastrointestinal tract, and over the last 3 years, the human gastrointestinal carriage of ESBL‐E. coli was seen to be uprising, as shown in a meta‐analysis by Bezabih et al. [51]. This can potentially lead to shedding and dissemination of ESBL‐E. coli to the environment through domestic waste drainage onto receiving rivers or other surface waters [52].
Future research should focus on several key areas. First, quantitative risk assessments are needed to better estimate the public health impact of ESBL contamination in fresh produce. Second, further validation of the designed primers using a broader range of isolates and sequencing confirmation is necessary to establish their robustness and specificity. Third, the development and optimization of a multiplex PCR assay based on these primers would enhance their applicability in routine surveillance and outbreak investigations. Additionally, future studies should investigate the relative contribution of different environmental sources to contamination pathways through source‐tracking approaches. Longitudinal monitoring of urban farming systems would also provide insights into temporal trends and the effectiveness of intervention strategies. Finally, integrating molecular tools with environmental and epidemiological data will be critical for developing targeted control measures to mitigate the spread of ESBL‐producing bacteria along the farm‐to‐fork continuum.
5. Conclusions
This study showed ESBL genes in the E. coli isolates from selected urban gardens and wet markets in Metro Manila and provided data on the possible utility of newly designed primers for the molecular detection of ESBL genes. However, this is just a preliminary study, and further study must be done to ensure the efficiency of these primers. It is also highly recommended to use these primers for a wider scale survey of ESBL‐E. coli using a larger number of samples as well as on sample types other than raw vegetables (i.e., environmental samples, clinical samples, or meat and dairy products). Furthermore, application of these primers on a multiplex PCR can also be tried in the future for a faster detection of ESBL genes.
Funding
This work was supported by the University of the Philippines Diliman Office of the Vice Chancellor for Research and Development (OVCRD) through Outright Research Grant under grant number 232327 ORG.
Conflicts of Interest
The authors declare no conflicts of interest.
Sena, Donnabel C. , Sabio, Ma. Christine Jasmine F. , Vital, Pierangeli G. , Molecular Detection of Extended‐Spectrum Beta‐Lactamase (ESBL) Genes in Escherichia coli Isolated From Vegetables and Environmental Samples in Selected Urban Farms and Wet Markets in Metro Manila, Philippines, International Journal of Food Science, 2026, 6681719, 9 pages, 2026. 10.1155/ijfo/6681719
Guest Editor: Poulami Jha
Contributor Information
Pierangeli G. Vital, Email: pgvital@up.edu.ph.
Poulami Jha, Email: pojha@wiley.com.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1. Awosile B., Fritzler J., Levent G. et al., Genomic Characterization of Fecal Escherichia coli Isolates With Reduced Susceptibility to Beta-Lactam Antimicrobials From Wild Hogs and Coyotes, Pathogens. (2023) 12, no. 7, 10.3390/pathogens12070929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Ramos S., Silva V., Dapkevicius M. D. L. E. et al., Escherichia coli as Commensal and Pathogenic Bacteria Among Food-Producing Animals: Health Implications of Extended Spectrum β-Lactamase (ESBL) Production, Animals. (2020) 10, no. 12, 10.3390/ani10122239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Perera L. N., Mafiz A. I., Amarasekara N. R., Chang E., Krishnoji Rao V. B., and Zhang Y., Antimicrobial-Resistant E. coli and Enterococcus spp. Recovered From Urban Community Gardens, Food Control. (2020) 108, 10.1016/j.foodcont.2019.106857. [DOI] [Google Scholar]
- 4. Zhao X., Sun Y., Ma Y., Xu Y., Guan H., and Wang D., Research Advances on the Contamination of Vegetables by Enterohemorrhagic Escherichia Coli: Pathways, Processes and Interaction, Critical Reviews in Food Science and Nutrition. (2024) 64, no. 14, 4833–4847, 10.1080/10408398.2022.2146045. [DOI] [PubMed] [Google Scholar]
- 5. Vital P. and Rivera W., Microbiological Quality of Fresh Produce in Southeast Asia: An Assessment of Risks, Challenges, and Opportunities, SciEnggJ. (2024) 16, no. 2, 377–389, 10.54645/2023162AMV-16. [DOI] [Google Scholar]
- 6. Nyirabahizi E., Tyson G. H., Dessai U. et al., Evaluation of Escherichia coli as an Indicator for Antimicrobial Resistance in Salmonella Recovered From the Same Food or Animal Ceca Samples, Food Control. (2020) 115, 10.1016/j.foodcont.2020.107280. [DOI] [Google Scholar]
- 7. Lee E., Radu S., Jambari N. N., and Abdul-Mutalib N. A., Prevalence and Antibiogram Profiling of Extended-Spectrum Beta-Lactamase (ESBL) Producing Escherichia coli in Raw Vegetables, in Malaysia, Biology and Life Sciences Forum, 2021, 6, no. 1, MDPI, 10.3390/Foods2021-10960. [DOI] [Google Scholar]
- 8. Rawat D. and Nair D., Extended-Spectrum β-Lactamases in Gram Negative Bacteria, Journal of Global Infectious Diseases. (2010) 2, no. 3, 263–274, 10.4103/0974-777X.68531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Bush K. and Jacoby G. A., Updated Functional Classification of β-Lactamases, Antimicrobial Agents and Chemotherapy. (2010) 54, no. 3, 969–976, 10.1128/aac.01009-09, 2-s2.0-77149165713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Olaniyan T. O., Martínez-Vázquez A. V., Escobedo-Bonilla C. M. et al., The Prevalence of ESKAPE Pathogens and Their Drug Resistance Profiles in Aquatic Environments Around the World, Microbiology Research. (2025) 16, no. 9, 10.3390/microbiolres16090201. [DOI] [Google Scholar]
- 11. Fang L., Chen R., Li C. et al., The Association Between the Genetic Structures of Commonly Incompatible Plasmids in Gram-Negative Bacteria, Their Distribution and the Resistance Genes, Frontiers in Cellular and Infection Microbiology. (2024) 14, 10.3389/fcimb.2024.1472876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Mondal A. H., Khare K., Saxena P., Debnath P., Mukhopadhyay K., and Yadav D., A Review on Colistin Resistance: An Antibiotic of Last Resort, Microorganisms. (2024) 12, no. 4, 10.3390/microorganisms12040772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Alyamani E. J., Khiyami A. M., Booq R. Y., Majrashi M. A., Bahwerth F. S., and Rechkina E., The Occurrence of ESBL-Producing Escherichia coli Carrying Aminoglycoside Resistance Genes in Urinary Tract Infections in Saudi Arabia, Annals of Clinical Microbiology and Antimicrobials. (2017) 16, 1–13, 10.1186/s12941-016-0177-6, 2-s2.0-85008498558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Huijbers P. M. C., Graat E. A. M., Haenen A. P. J. et al., Extended-Spectrum and Ampc β-Lactamase-Producing Escherichia coli in Broilers and People Living and/or Working on Broiler Farms: Prevalence, Risk Factors and Molecular Characteristics, Journal of Antimicrobial Chemotherapy. (2014) 69, no. 10, 2669–2675, 10.1093/jac/dku178, 2-s2.0-84922931782. [DOI] [PubMed] [Google Scholar]
- 15. Falgenhauer L., Imirzalioglu C., Oppong K. et al., Detection and Characterization of ESBL-Producing Escherichia coli From Humans and Poultry in Ghana, Frontiers in Microbiology. (2019) 9, 10.3389/fmicb.2018.03358, 2-s2.0-85064380532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Dahms C., Hübner N., Kossow A., Mellmann A., Dittmann K., and Kramer A., Occurrence of ESBL-Producing Escherichia coli in Livestock and Farm Workers in Mecklenburg-Western Pomerania, Germany, PLoS One. (2015) 10, no. 11, 10.1371/journal.pone.0143326, 2-s2.0-84960158757. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Hassen B., Jouini A., Elbour M., Hamrouni S., and Maaroufi A., Detection of Extended‐Spectrum β‐Lactamases (ESBL) Producing Enterobacteriaceae From Fish Trapped in the Lagoon Area of Bizerte, Tunisia, BioMed Research International. (2020) 1, no. 2020, 10.1155/2020/7132812. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Gekenidis M., Kläui A., Smalla K., and Drissner D., Transferable Extended-Spectrum β-Lactamase (ESBL) Plasmids in Enterobacteriaceae From Irrigation Water, Microorganisms. (2020) 8, no. 7, 10.3390/microorganisms8070978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Vital P. G., Zara E. S., Paraoan C. E. M. et al., Antibiotic Resistance and Extended-Spectrum Beta-Lactamase Production of Escherichia coli Isolated From Irrigation Waters in Selected Urban Farms in Metro Manila, Philippines, Water. (2018) 10, no. 5, 10.3390/w10050548, 2-s2.0-85046642753. [DOI] [Google Scholar]
- 20. Gundran R. S., Cardenio P. A., Villanueva M. A. et al., Prevalence and Distribution of bla CTX-M, blaSHV, blaTEM Genes in Extended-Spectrum β-Lactamase-Producing E. coli Isolates From Broiler Farms in the Philippines, BMC Veterinary Research. (2019) 15, 1–8, 10.1186/s12917-019-1975-9, 2-s2.0-85069268475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Cruz M. C., Bacani C. S., Mendoza A. B., and Hedreyda C. T., Evaluation of Extended-Spectrum Beta-Lactamase Production in Escherichia coli Clinical Isolates From Three Hospitals in Luzon, Philippines, Philippine Science Letters. (2014) 7, no. 2, 438–444. [Google Scholar]
- 22. Lota M. M. M. and Latorre A. A. E., A Retrospective Study on Extended Spectrum Beta-Lactamase Bacteria in the Philippines From 1999–2013, Acta Medica Philippina. (2014) 48, no. 1, 10.47895/amp.v48i1.1186. [DOI] [Google Scholar]
- 23. Araújo S., Silva I. A. T., Tacão M., Patinha C., Alves A., and Henriques I., Characterization of Antibiotic Resistant and Pathogenic Escherichia coli in Irrigation Water and Vegetables in Household Farms, International Journal of Food Microbiology. (2017) 257, 192–200, 10.1016/j.ijfoodmicro.2017.06.020, 2-s2.0-85021402680. [DOI] [PubMed] [Google Scholar]
- 24. Song J., Oh S.-S., Kim J., and Shin J., Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolated From Raw Vegetables in South Korea, Scientific Reports. (2020) 10, no. 1, 10.1038/s41598-020-76890-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Datta S., Ishikawa M., Chudhakorn S., and Charaslertrangsi T., Prevalence and Antimicrobial Characteristics of Escherichia coli in Selected Vegetables and Herbs in Bangkok, Thailand, Journal of Food Protection. (2024) 87, no. 3, 10.1016/j.jfp.2024.100229. [DOI] [PubMed] [Google Scholar]
- 26. Ilyas S., Qamar M. U., Rasool M. H., Abdulhaq N., and Nawaz Z., Multidrug-Resistant Pathogens Isolated From Ready-to-Eat Salads Available at a Local Market in Pakistan, British Food Journal. (2016) 118, no. 8, 2068–2075, 10.1108/BFJ-02-2016-0058, 2-s2.0-84979282985. [DOI] [Google Scholar]
- 27. Balali G. I., Yar D. D., Afua Dela V. G., and Adjei-Kusi P., Microbial Contamination, an Increasing Threat to the Consumption of Fresh Fruits and Vegetables in Today’s World, International journal of microbiology. (2020) 2020, no. 1, 3029295–13, 10.1155/2020/3029295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Olowe O. A., Adewumi O., Odewale G., Ojurongbe O., and Adefioye O. J., Phenotypic and Molecular Characterisation of Extended‐Spectrum Beta‐Lactamase Producing Escherichia coli Obtained From Animal Fecal Samples in Ado Ekiti, Nigeria, Journal of Environmental and Public Health. (2015) 2015, no. 1, 497980–7, 10.1155/2015/497980, 2-s2.0-84941712186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Saka H. K., García-Soto S., Dabo N. T. et al., Molecular Detection of Extended Spectrum β-Lactamase Genes in Escherichia coli Clinical Isolates From Diarrhoeic Children in Kano, Nigeria, PLoS One. (2020) 15, no. 12, 10.1371/journal.pone.0243130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Vital P. G., Rivera W. L., Sena D. C., Catapat C. J. C., and Sabio C. J. F., Thermotolerant Escherichia coli Contamination in Vegetables From Selected Urban Farms and Wet Markets in Metro Manila, Philippines at the Height of COVID-19 Pandemic, Asia-Pacific Journal of Science and Technology. (2024) 29, no. 3, 10.14456/apst.2024.44. [DOI] [Google Scholar]
- 31. CLSI, Performance Standards for Antimicrobial Susceptibility Testing, 2024, 34th edition, Clinical and Laboratory Standards Institute. [Google Scholar]
- 32. Kumar D., Singh A. K., Ali M. R., and Chander Y., Antimicrobial Susceptibility Profile of Extended Spectrum β-Lactamase (ESBL) Producing Escherichia coli From Various Clinical Samples, Infectious Diseases: Research and Treatment. (2014) 7, 10.4137/IDRT.S13820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Boyd D. A., Tyler S., Christianson S. et al., Complete Nucleotide Sequence of a 92-Kilobase Plasmid Harboring the CTX-M-15 Extended-Spectrum Beta-Lactamase Involved in an Outbreak in Long-Term-care Facilities in Toronto, Canada, Antimicrobial Agents and Chemotherapy. (2004) 48, no. 10, 3758–3764, 10.1128/aac.48.10.3758-3764.2004, 2-s2.0-4644249680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Olesen I., Hasman H., and Aarestrup F. M., Prevalence of β-Lactamases Among Ampicillin-Resistant Escherichia coli and Salmonella Isolated From Food Animals in Denmark, Microbial Drug Resistance. (2004) 10, no. 4, 334–340, 10.1089/mdr.2004.10.334, 2-s2.0-11844299639. [DOI] [PubMed] [Google Scholar]
- 35. Paterson D. L., Hujer K. M., Hujer A. M. et al., Extended-Spectrum β-Lactamases in Klebsiella pneumoniae Bloodstream Isolates From Seven Countries: Dominance and Widespread Prevalence of SHV-and CTX-M-Type β-Lactamases, Antimicrobial Agents and Chemotherapy. (2003) 47, no. 11, 3554–3560, 10.1128/aac.47.11.3554-3560.2003, 2-s2.0-0242322614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Nawaz Z., Aslam B., Zahoor M. A. et al., Frequency of Extended Spectrum Beta Lactamase Producing Escherichia coli in Fresh and Frozen Meat, 2021, 102–106, 10.29261/pakvetj/2020.059. [DOI] [Google Scholar]
- 37. Nagshetty K., Shilpa B. M., Patil S. A., Shivannavar C. T., and Manjula N. G., An Overview of Extended Spectrum Beta Lactamases and Metallo Beta Lactamases, Advances in Microbiology. (2021) 11, no. 01, 37–62, 10.4236/aim.2021.111004. [DOI] [Google Scholar]
- 38. Yip D. W. and Gerriets V., Penicillin, StatPearls, 2024, StatPearls Publishing, St. Petersburg, FL. [PubMed] [Google Scholar]
- 39. Rodríguez-Baño J., Alcalá J. C., Cisneros J. M. et al., Community Infections Caused by Extended-Spectrum β-Lactamase–Producing Escherichia coli , Archives of Internal Medicine. (2008) 168, no. 17, 1897–1902, 10.1001/archinte.168.17.1897, 2-s2.0-52649112236. [DOI] [PubMed] [Google Scholar]
- 40. Rottier W. C., Ammerlaan H. S. M., and Bonten M. J. M., Effects of Confounders and Intermediates on the Association of Bacteraemia Caused by Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae and Patient Outcome: A Meta-Analysis, Journal of Antimicrobial Chemotherapy. (2012) 67, no. 6, 1311–1320, 10.1093/jac/dks065, 2-s2.0-84861109391. [DOI] [PubMed] [Google Scholar]
- 41. Paterson D. L. and Bonomo R. A., Extended-Spectrum β-Lactamases: A Clinical Update, Clinical Microbiology Reviews. (2005) 18, no. 4, 657–686, 10.1128/cmr.18.4.657-686.2005, 2-s2.0-27144490073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Mammeri H., De Loo M. V., Poirel L., Martinez-Martinez L., and Nordmann P., Emergence of Plasmid-Mediated Quinolone Resistance in Escherichia coli in Europe, Antimicrobial Agents and Chemotherapy. (2005) 49, no. 1, 71–76, 10.1128/aac.49.1.71-76.2005, 2-s2.0-11244277410. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Wang M., Sahm D. F., Jacoby G. A., and Hooper D. C., Emerging Plasmid-Mediated Quinolone Resistance Associated With the Qnr Gene in Klebsiella pneumoniae Clinical Isolates in the United States, Antimicrobial Agents and Chemotherapy. (2004) 48, no. 4, 1295–1299, 10.1128/aac.48.4.1295-1299.2004, 2-s2.0-1642543131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Mshana S. E., Matee M., and Rweyemamu M., Antimicrobial Resistance in Human and Animal Pathogens in Zambia, Democratic Republic of Congo, Mozambique and Tanzania: An Urgent Need of a Sustainable Surveillance System, Annals of Clinical Microbiology and Antimicrobials. (2013) 12, 1–10, 10.1186/1476-0711-12-28, 2-s2.0-84885355046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Bej A. K., Dicesare J. L., Haff L., and Atlas R. M., Detection of Escherichia coli and Shigella spp. in Water by Using the Polymerase Chain Reaction and Gene Probes for uid, Applied and Environmental Microbiology. (1991) 57, no. 4, 1013–1017, 10.1128/aem.57.4.1013-1017.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Takahashi H., Kimura B., Tanaka Y., Shinozaki J., Suda T., and Fujii T., Real-Time PCR and Enrichment Culture for Sensitive Detection and Enumeration of Escherichia coli , Journal of Microbiological Methods. (2009) 79, no. 1, 124–127, 10.1016/j.mimet.2009.08.002, 2-s2.0-70349200591. [DOI] [PubMed] [Google Scholar]
- 47. Fricker E. J. and Fricker C. R., Application of the Polymerase Chain Reaction to the Identification of Escherichia coli and Coliforms in Water, Letters in Applied Microbiology. (1994) 19, no. 1, 44–46, 10.1111/j.1472-765X.1994.tb00900.x, 2-s2.0-0028200434. [DOI] [PubMed] [Google Scholar]
- 48. Molina F., López-Acedo E., Tabla R., Roa I., Gómez A., and Rebollo J. E., Improved Detection of Escherichia coli and Coliform Bacteria by Multiplex PCR, BMC Biotechnology. (2015) 15, 1–9, 10.1186/s12896-015-0168-2, 2-s2.0-84930669187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Azim K. F., Somana S. R., Hasan M. K. et al., Molecular Detection and Analysis of Virulence Genes in Multi-Drug-Resistant Escherichia coli From Infected Broilers, Veterinary Research Forum. (2021) 12, no. 4, 505–510, 10.30466/vrf.2020.115921.2762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Godambe L. P., Bandekar J., and Shashidhar R., Species Specific PCR Based Detection of Escherichia coli From Indian Foods, 3 Biotech. (2017) 7, no. 2, 1–5, 10.1007/s13205-017-0784-8, 2-s2.0-85020037686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Bezabih Y. M., Sabiiti W., Alamneh E. et al., The Global Prevalence and Trend of Human Intestinal Carriage of ESBL-Producing Escherichia coli in the Community, Journal of Antimicrobial Chemotherapy. (2021) 76, no. 1, 22–29, 10.1093/jac/dkaa399. [DOI] [PubMed] [Google Scholar]
- 52. Tiwari A., Kurittu P., Al-Mustapha A. I. et al., Wastewater Surveillance of Antibiotic-Resistant Bacterial Pathogens: A Systematic Review, Frontiers in Microbiology. (2022) 13, 10.3389/fmicb.2022.977106. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
