Skip to main content
NCBI home page
Drug Metabolism and Disposition logoLink to Drug Metabolism and Disposition
. 2026 Feb 4;54(3):100250. doi: 10.1016/j.dmd.2026.100250

Differential gene regulation by SR12813 and rifampicin: Insights into PXR and PPARγ activation and metabolic pathway modulation in LS180 colon cancer cells

Dan Brobst 1, Jack Hemsath 1, Abbigail Niewchas 1, Chi Pham 1, Brendan Lamboglia 1, Yasmeen Sawalha 1, Cameron Ballard 1, Russell Bodily 2, Whitney Dye 2, Vi Nguyen 1, Adam Youssef 1, Catherine Elliott 1, Jeff L Staudinger 1, Bradley A Creamer 1,∗
PMCID: PMC13095616  PMID: 41734437

Abstract

SR12813 is an experimental cholesterol-lowering drug that reduces intracellular cholesterol through accelerated proteasomal degradation of 3-hydroxy-3-methylglutaryl-coenzyme A reductase and is also recognized as a prototypical activator of the pregnane X receptor (PXR, NR1I2). Rifampicin, a clinically used antibiotic, likewise functions as a human PXR agonist. Although PXR-mediated induction of drug metabolism genes has been extensively characterized in hepatocytes and humanized mouse liver, comparatively little is known about the transcriptional effects of these ligands in intestinal and colon cancer cells. Here, we used RNA-sequencing in LS180 colon adenocarcinoma cells to compare transcriptional responses elicited by SR12813 and rifampicin. Both compounds induced canonical PXR targets, including CYP3A4, UGT1A1, and MDR1 (P-glycoprotein), whereas SR12813 preferentially upregulated genes associated with ketone body metabolism, lipid storage, and glycolysis. Complementary nuclear receptor reporter assays demonstrated that, in addition to robust PXR activation, SR12813 also functions as a partial agonist of peroxisome proliferator–activated receptor gamma, a receptor with critical roles in lipid metabolism and colon cancer biology. These findings demonstrate that SR12813 elicits overlapping, yet distinct transcriptional profiles relative to rifampicin, extending beyond xenobiotic metabolism to include metabolic pathways relevant to tumor progression. Collectively, our results highlight SR12813 as a dual-acting modulator of PXR and peroxisome proliferator–activated receptor gamma, and underscore its utility as a pharmacological tool for investigating nuclear receptor crosstalk in intestinal models.

Significance Statement

SR12813 activates both pregnane X receptor and peroxisome proliferator–activated receptor gamma, demonstrating dual nuclear receptor modulation in colon cancer cells. By linking xenobiotic metabolism with lipid and mitochondrial pathways, this work uncovers previously unreported receptor crosstalk and provides a mechanistic framework for how diverse ligands can differentially shape transcriptional programs relevant to drug metabolism and tumor biology.

Key words: PXR, PPARγ, SR12813, Xenobiotic metabolism, Lipid metabolism, Nuclear receptor crosstalk

1. Introduction

Nuclear receptors (NRs) are ligand-activated transcription factors that coordinate gene expression pathways central to xenobiotic metabolism, lipid storage, glucose utilization, and inflammatory signaling. The pregnane X receptor (PXR, NR1I2) is a key xenobiotic sensor that regulates cytochrome P450 enzymes, UDP-glucuronosyltransferases, and ATP-binding cassette transporters.1, 2, 3, 4, 5, 6 Although historically studied in the liver, PXR influences a broader spectrum of physiological processes, including bile acid detoxification, glucose and lipid homeostasis, and inflammatory responses, in a context- and tissue-dependent manner.7, 8, 9, 10, 11 More recently, PXR activity has been shown to also play various roles in cancer cells, including a part in regulating the cell cycle, apoptosis, and xenoprotection.12, 13, 14

Peroxisome proliferator–activated receptor gamma (PPARγ, NR1C3) is a master regulator of adipogenesis and insulin sensitivity.15,16 Through transcriptional control of lipid uptake and mitochondrial metabolism, PPARγ also influences epithelial cell differentiation, angiogenesis, and various aspects of immune responses and inflammatory signaling.17, 18, 19, 20 In the colon, PPARγ activation generally promotes differentiation and suppresses proliferation, though context-specific signaling has been shown to produce tumor-promoting outcomes.17, 18, 19, 20, 21

Importantly, PXR and PPARγ, like most NRs, do not function in isolation. Both use retinoid X receptor (RXR) as a heterodimeric partner and share an overlapping pool of transcription coactivators or corepressors such as steroid receptor coactivator-1 (SRC-1), peroxisome proliferator–activated receptor gamma coactivator 1-alpha (PGC-1α), and nuclear receptor corepressor.14,22,23 These interactions create opportunities for competition or synergy; activation of one receptor can alter the availability of cofactors or RXR for the other, thereby modulating gene expression outcomes.14,22,23 These interactions help in part to explain why NR activity is highly tissue specific, being shaped by the local cofactor landscape, as well as chromatin accessibility.22,24,25

The roles of PXR and PPARγ in colorectal cancer illustrate their opposing effects on tumor biology, with PXR expression linked to poor prognosis and chemoresistance, driven by the induction of UGTs and efflux transporters that inactivate or export chemotherapeutic drugs.26,27 In contrast, PPARγ expression often declines during tumor progression, and its activation has been shown to suppress proliferation, promote apoptosis, and lead to tumor microenvironment remodeling.21,28 These findings underscore the importance of receptor crosstalk and cellular context in determining NR function.

SR12813, initially developed as a cholesterol-lowering compound via 3-hydroxy-3-methylglutaryl-CoA reductase degradation, is also known to be a prototypical PXR agonist.29,30 Although its hepatic effects are well-established, its impact on NR signaling in other tissues, particularly colon cancer, remains poorly understood. Here, we investigated the transcriptional regulation of SR12813 compared with rifampicin in LS180 colon cancer cells. RNA-sequencing revealed induction of several canonical PXR target genes (CYP3A4, UGT1A1, and ABCB1) as well as the upregulation of several genes associated with lipid and ketone body metabolism, typically associated with PPARγ. Functional reporter assays confirmed that SR12813 directly activates both PXR and PPARγ, revealing dual agonism that couples xenobiotic and metabolic pathways. These findings establish SR12813 as a dual-acting ligand of PXR and PPARγ, offering a mechanistic framework for understanding how xenobiotic and metabolic signaling are coordinated in colon cancer cells.

2. Materials and methods

2.1. Cell lines and treatments

The LS180 human colon cancer cell line, HepG2 human hepatocellular carcinoma, T47D (estrogen receptor-positive, progesterone receptor-positive, human epidermal growth factor receptor 2-negative) breast cancer, MDA-MB-231 (triple negative) breast cancer, and CV-1 (African green monkey kidney fibroblast) cell lines were obtained from American Type Culture Collection (Manassas, VA). Cells were maintained in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum at 37 °C in a humidified incubator with 5% CO2.

For ligand treatments, cells were exposed to rifampicin (10 μM; Fisher Bioreagents), SR12813 (2 μM; Tocris Bioscience), rosiglitazone (concentration as indicated; MilliporeSigma), or vehicle control (0.1% DMSO; Fisher Bioreagents) for 24 hours unless otherwise specified. The concentration of rifampicin was selected based on its established use as a protypical human PXR agonist in LS180 cells. SR12813 was used at 2 μM, a concentration that produced consistent induction of canonical PXR target genes while avoiding nonspecific cellular effects observed at higher concentrations.

2.2. Transient transfection and luciferase reporter assays

Transient transfection assays were performed as previously described.31 CV-1 cells were seeded in 96-well plates and allowed to adhere overnight before transfection. Cells were transfected with galactose-responsive transcription factor 4 (GAL4) DNA-binding domain fusion constructs containing ligand-binding domains (LBDs) of human PXR, murine PPARγ, PPARα, RXRα, glucocorticoid receptor, or liver X receptor alpha, together with a GAL4-responsive luciferase reporter plasmid containing the peroxisome proliferate response element (×3-TK-luc; Addgene). Where indicated, the transcriptional coactivators SRC-1, SRC-2, and PGC-1α were cotransfected at a 1:1:1 ratio.

For full-length PPARγ activation studies, CV-1 cells were transfected with a human PPARγ expression plasmid and a PPAR-responsive luciferase reporter. After transfection, cells were treated with vehicle (0.1% DMSO), SR12813, rifampicin, or rosiglitazone at the indicated concentrations for 24 hours.

Luciferase activity was quantified using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. Firefly luciferase activity was normalized to Renilla luciferase to control for transfection efficiency. For concentration-response experiments, replicate wells were analyzed at each ligand concentration within a single experiment. EC50 values and 95% CIs were calculated by nonlinear regression using a 4-parameter logistic model in GraphPad Prism.

2.3. RNA isolation and quantitative real-time polymerase chain reaction

Total RNA was extracted using RNeasy kits (Qiagen) with on-column DNase treatment, according to the manufacturer protocol. RNA concentration and purity were determined using a Nanodrop spectrophotometer (Thermo Fisher Scientific). Reverse transcription and quantitative polymerase chain reaction (qPCR) were performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). Relative gene expression levels were calculated using the ΔΔCt method using β-actin as the internal reference gene. The sequence for primer sequences are listed in Table 1.

Table 1.

Primer sequences used for quantitative real-time polymerase chain reaction (PCR) validation of gene expression

Primer sequences for target genes were designed based on human reference sequences and used to validate RNA-sequencing results by quantitative PCR. Sense and antisense oligonucleotides were synthesized for each gene, including canonical PXR target genes (CYP3A4, UGT1A1), genes associated with lipid metabolism (PLIN4, HMGCS2, and PDK4), and additional differentially expressed genes identified in RNA-sequencing analysis (TP53, PFKB3, and RFP123).

Gene Sense (5′→3′) Antisense (5′→3′)
PXR CGAGCTCCGCAGCATCA TGTATGTCCTGGATGCGCA
CYP3A4 GTGGGGCTTTTATGATGGTCA ACATCTCCATACTGGGGCAATGA
UGT1A1 TGCTCATTGCCTTTTCACAG GGGCCTAGGGTAATCCTTCA
TP53 GAGGTTGGCTCTGACTGTACC TCCGTCCCAGTAGATTACCAC
PLIN4 GGCACCAAGAACACTGTCTG TCGTACCCATGACCATAGACTT
PFKB3 ATTGCGGTTTTCGATGCCAC GCCACAACTGTAGGGTCGT
RFP123 TCTTTCTCCCGCAAGAGCTAT AACTGGTCCAAATGTTCTGGC
HMGCS2 GCCCAATATGTGGACCAAACT GAAGCCCATACGGGTCTGG
PDK4 GGAAGCATTGATCCTAACTGTGA GGTGAGAAGGAACATACACGATG
Open in a new tab

PCR, polymerase chain reaction; PXR, pregnane X receptor.

2.4. RNA-sequencing

RNA integrity was assessed using the Agilent 4150 Tapestation with the RNA ScreenTape Assay (Agilent). RNA concentration was quantified by the Qubit 4 Fluorometer (Invitrogen). Libraries were prepared using the Illumina Stranded mRNA Prep kit (Illumina) according to manufacturer’s instructions and sequenced on an Illumina NextSeq 1000 platform. Base calling, demultiplexing, and alignment to the human reference genome (GRCh38) were preformed using the onboard Illumina DRAGEN (Dynamic Read Analysis for GENomics pipeline). Transcript-level quantification files were generated, and gene-level counts were imported into R (v4.5.0) via the tximport package for downstream analysis. Differential expression was carried out using DESeq2, with significance thresholds set at adjusted P < .05 (Benjamini-Hochberg). Pathway enrichment was assessed using Kyoto Encyclopedia of Genes and Genomes analysis, and functional annotation was preformed through gene ontology (GO) term over-representation analysis. Additional differential expression analyses, including pairwise comparisons of rifampicin versus vehicle (Supplemental Fig. 1) and rifampicin versus SR12813 (Supplemental Fig. 2), are provided in the Supplemental Material. RNA-Seq data generated for this study are accessible through ArrayExpress under accession number E-MTAB-16299.

2.5. Statistical analysis

Data are presented as mean ± SEM unless otherwise indicated. For concentration-response experiments, EC50 values and corresponding 95% CIs were derived from nonlinear regression analysis. Replicate wells were analyzed at each ligand concentration; EC50 values were not subjected to inferential statistical comparison between ligands.

For gene expression and reporter assay data, experiments were performed with at least 3 biological replicates unless otherwise specified. Statistical significance was determined using 1-way or 2-way ANOVA with Dunnett’s or Tukey’s post hoc tests, as appropriate, using GraphPad Prism (GraphPad Software). A P value of <.05 was considered statistically significant.

3. Results

3.1. Detection of PXR expression and activity across cell lines

Because NR signaling is often cell type dependent, we began by assessing basal PXR expression and inducible activity across several commonly used human cancer cell lines to identify a physiologically relevant model for downstream experiments. HepG2 hepatocellular carcinoma cells were used as a reference (set to 100%). LS180 colon adenocarcinoma cells exhibited approximately 75% of HepG2 PXR mRNA expression, whereas T47D (ER/PR+) breast cancer cells expressed roughly 40%, and MDA-MB-231 (triple negative) breast cancer cells expressed less than 5% (Fig. 1A).

Fig. 1.

Fig. 1

Open in a new tab

PXR expression and CYP3A4 inducibility in different cell lines. (A) Relative PXR mRNA expression levels in HepG2, LS180, T47D, and MDA-MB-231 cells were quantified by real-time quantitative polymerase chain reaction. Expression was normalized to β-actin and is presented relative to HepG2. Data represent mean ± SEM from 3 independent experiments. P < .05 compared with HepG2. (B) Induction of CYP3A4 mRNA after 24-hour treatment with vehicle (0.1% DMSO, white), rifampicin (10 μM, gray), or SR12813 (2 μM, black). Data are shown as mean ± SEM. P < .05 compared with vehicle. PXR, pregnane X receptor.

We next evaluated functional PXR activity by measuring CYP3A4 mRNA levels after 24-hour treatment with rifampicin (10 μM) or SR12813 (2 μM).HepG2 and LS180 cells both displayed induction (∼2.5- to 3.2-fold), T47D cells showed modest but significant induction (∼1.8- to 2.0-fold), and MDA-MB-231 cells were unresponsive (Fig. 1B). LS180 cells were selected for subsequent transcriptomic analyses because they exhibit robust, ligand-responsive PXR expression and are a well-established intestinal model for studying xenobiotic and metabolic gene regulation. Although additional colorectal cancer cell lines may exhibit distinct NR expression profiles, LS180 cells provide a reproducible and mechanistically informative system for interrogating PXR-dependent transcriptional programs.

3.2. Transcriptomic profiling and validation of SR12813-induced gene expression

To define the global transcriptional response to SR12813, we performed RNA-sequencing of LS180 cells treated with SR12813 (2 μM, 24 hours) or vehicle control. Quality control analyses demonstrated appropriate dispersion modeling and variance stabilization (Fig. 2, A and B), whereas principal component analysis revealed clear separation between SR12813 and vehicle groups (Fig. 2C). Unsupervised hierarchical clustering of the top 30 differentially expressed genes showed distinct expression signatures between the treatment groups (Fig. 2D), underscoring the strong and reproducible transcriptional response elicited by SR12813.

Fig. 2.

Fig. 2

Open in a new tab

RNA-sequencing quality control and exploratory data analysis. (A) Mean-variance relationship of normalized read counts for all genes. The fitted dispersion estimates (red) closely follow the gene-wise estimates (black), indicating the appropriate model fit. (B) MA plot showing log2 fold change vs mean expression values for all genes in SR12813-treated vs vehicle-treated LS180 cells. Significantly upregulated (blue, upper) and downregulated (blue, lower) genes were defined using an FDR-adjusted P < .05. (C) Principal component analysis plot of all expressed genes shows clear separation between SR12813-treated (blue) and vehicle-treated (red) samples, accounting for 27% of the variance along PC1. (D) Heatmap of the top 30 differentially expressed genes (ranked by the adjusted P value) after SR12813 treatment. Gene expression values are row-scaled (z-scores). Unsupervised hierarchical clustering reveals distinct transcriptional profiles between SR12813-treated and control groups. FDR, false discovery rate; SR, SR12813; Veh, vehicle.

Differential expression analysis identified 588 genes uniquely upregulated by SR12813, 116 genes uniquely upregulated by rifampicin, and 53 genes commonly induced by both compounds (Fig. 3). Shared targets included classical PXR-regulated genes such as MDR1, CYP3A4, and UGT1A1, confirming engagement of xenobiotic metabolism pathways by both ligands. In contrast, SR12813 induced a broader set of transcripts linked to lipid metabolism, energy regulation, and mitochondrial pathways, suggesting additional modes of NR signaling beyond canonical PXR activation.

Fig. 3.

Fig. 3

Open in a new tab

Overlap of SR12813- and rifampicin-induced transcriptional responses in LS180 cells. Venn diagram showing the number of significantly upregulated genes (|log2FC| ≥ 1, FDR < 0.05) after 24-hour treatment with SR12813 (2 μM) or rifampicin (10 μM) compared with vehicle (0.1% DMSO). A total of 53 genes were commonly induced by both compounds, including canonical pregnane X receptor targets (eg, CYP3A4, UGT1A1, and MDR1), which are indicated by asterisks in the gene list (left). SR12813 uniquely upregulated 588 genes, whereas rifampicin uniquely upregulated 116 genes, indicating both overlapping and compound-specific transcriptional programs. FDR, false discovery rate; MDR1, multidrug resistance gene 1.

Pathway enrichment analysis of SR12813-upregulated genes revealed strong over-representation of GO biological processes related to xenobiotic metabolism, lipid catabolism, steroid and fatty acid metabolic processes, and ketone body metabolism (Fig. 4). These results further support that SR12813 coordinately regulates xenobiotic and metabolic gene networks in LS180 cells, producing a transcriptional signature distinct from rifampicin.

Fig. 4.

Fig. 4

Open in a new tab

Gene ontology (GO) enrichment of SR12813-upregulated genes in LS180 cells. GO biological process enrichment analysis was performed on genes significantly upregulated by SR12813 (adjusted P < .05) relative to vehicle-treated LS180 colon adenocarcinoma cells. The top enriched terms included xenobiotic metabolism, lipid catabolism, and ketone body metabolism, reflecting coordinated regulation of detoxification and metabolic pathways. The x-axis represents the GeneRatio (number of significant genes per total annotated genes in each pathway). Circle size corresponds to gene count within each category, and color indicates the adjusted P value, with deeper red tones denoting greater statistical significance.

To validate and extend the transcriptomic findings, we selected a subset of canonical PXR targets and SR12813-responsive metabolic genes for qPCR analysis. LS180 cells were treated for 24 hours with SR12813 (2 μM), rifampicin (10 μM), or vehicle control, and mRNA expression was quantified relative to vehicle-treated cells. As expected, both ligands significantly induced CYP3A4 and UGT1A1 expression, confirming activation of canonical PXR signaling (Fig. 5). Consistent with the enrichment of metabolic processes identified in the GO analysis (Fig. 4), SR12813 also produced robust induction of genes involved in lipid and mitochondrial energy metabolism, including HMGCS2 and PDK4 (>6-fold), as well as lipid droplet–associated perilipins PLIN2 and PLIN4. In contrast, PFKFB3 and RNF123—identified in the transcriptomic screen—did not show significant changes by qPCR, suggesting possible context-dependent or false-positive effects. Together, these results confirm that SR12813 drives a transcriptional program that integrates xenobiotic metabolism with lipid and mitochondrial energy pathways. All additional pairwise RNA-seq comparisons, DESeq2 output tables, and heatmaps are available in the Supplemental Material.

Fig. 5.

Fig. 5

Open in a new tab

Validation of RNA-sequencing results by quantitative polymerase chain reaction (qPCR). Expression of selected genes was measured by qPCR after 24-hour treatment with SR12813 (2 μM), rifampicin (10 μM), or vehicle control (0.1% DMSO) in LS180 cells. Data are presented as mean fold induction ± standard error relative to vehicle-treated cells. Asterisks indicate statistically significant differences compared with vehicle (P < .05). SR12813 robustly induced classical PXR target genes (CYP3A4, UGT1A1) as well as genes involved in lipid metabolism and energy homeostasis (PLIN2, PLIN4, HMGCS2, and PDK4), consistent with RNA-sequencing findings.

3.3. SR12813 activates xenobiotic and metabolic pathways through dual PXR and PPARγ activation

The transcriptomic and qPCR analyses revealed that several genes induced by SR12813, including HMGCS2, PDK4, and PLIN2, are well-established PPARγ targets. This raised the possibility that SR12813 might act as a dual agonist for both PXR and PPARγ. To test this hypothesis, we used a modified mammalian one-hybrid luciferase reporter assay in CV-1 cells (Fig. 6A). Cells were transfected with GAL4-LBD fusion constructs for multiple NRs and treated with SR12813 in the presence or absence of coactivators (SRC1, SRC2, and PGC-1α).

Fig. 6.

Fig. 6

Open in a new tab

SR12813 activates PXR and PPARγ in reporter-based transactivation assays. (A) Schematic of the modified GAL4-based mammalian one-hybrid assay used to assess ligand-dependent nuclear receptor activation. CV-1 cells were transfected with GAL4 DNA-binding domain (DBD) fusion constructs containing nuclear receptor ligand-binding domains (LBDs), together with a GAL4-responsive luciferase reporter and, where indicated, coactivators (SRC-1, SRC-2, and PGC-1α; 1:1:1 ratio). (B) SR12813 (2 μM) induced transactivation of human PXR-LBD and full-length human PXR, which was further enhanced by coactivator expression. In contrast, SR12813 showed minimal activity toward RXRα, LXRα, GR, and PPARα under the same conditions. Data are presented as mean ± SEM; P < .05 vs vehicle. (C) Concentration-response analysis using the GAL4-murine PPARγ-LBD reporter demonstrated dose-dependent activation by SR12813 and rosiglitazone. SR12813 activated mPPARγ with an EC50 of 2.5 μM (95% CI: [2.36–2.54 μM]), whereas rosiglitazone exhibited an EC50 of 1.4 μM (95% CI: [1.29–1.46 μM]). (D) Using a full-length human PPARγ expression construct and a PPAR-responsive reporter, SR12813 elicited concentration-dependent activation with an EC50 of 370 nM (95% CI: [280–495 nM]), compared with an EC50 of 59 nM (95% CI: [46–75 nM]) for rosiglitazone. For (C) and (D), replicate wells were used at each ligand concentration. EC50 values and CIs were determined by nonlinear regression and were not subjected to inferential statistical comparison between ligands. GAL4, galactose-responsive transcription factor 4: GR, glucocorticoid receptor; LXRα, liver X receptor alpha; PGC-1α, peroxisome proliferator–activated receptor gamma coactivator 1-alpha; PPARγ, peroxisome proliferator–activated receptor gamma; PXR, pregnane X receptor; SRC1, steroid receptor coactivator-1.

Consistent with its known activity, SR12813 robustly activated both full-length human PXR and GAL4-hPXR-LBD constructs (Fig. 6B). Cotransfection with coactivators further enhanced reporter activity, confirming the coactivator sensitivity of SR12813-mediated transactivation. Rifampicin produced a comparable response, validating assay performance.

Interestingly, SR12813 also activated GAL4-PPARγ-LBD constructs, with the strongest response observed in murine PPARγ. Murine PPARγ-LBD was used in this assay due to its robust performance and established sensitivity in GAL4-based reporter systems, which facilitates detection of ligand-dependent activation. To ensure translational relevance, activation of full-length human PPARγ was subsequently assessed using a PPAR-responsive reporter (see below). Dose-response experiments revealed concentration-dependent activation, with SR12813 exhibiting an EC50 of approximately 2.5 μM (95% CI: 2.36–2.54 μM) compared with 1.4 μM (95% CI: 1.29–1.46 μM) for rosiglitazone, a prototypical PPARγ agonist (Fig. 6C). Although less potent, SR12813 achieved a similar maximal response, indicating partial but effective agonism.

To extend these findings, we tested full-length human PPARγ using a PPAR-responsive reporter. SR12813 activated PPARγ in a concentration-dependent manner with an EC50 of ∼370 nM (95% CI: 280–495 nM), compared with ∼59 nM (95% CI: 46–75 nM) for rosiglitazone (Fig. 6D). These results establish SR12813 as a dual-acting NR ligand: it activates PXR with coactivator-enhanced transactivation and functions as a moderate but efficacious PPARγ agonist. This dual activity provides a mechanistic explanation for the distinct induction of lipid metabolic and mitochondrial genes observed in LS180 cells and underscores SR12813’s utility as a probe for NR crosstalk in cancer models.

4. Discussion

The PXR and PPARγ are ligand-activated transcription factors that regulate distinct but intersecting pathways governing xenobiotic metabolism, lipid and glucose homeostasis, and inflammatory responses.2,9,15,17 Crosstalk between these receptors shapes how cells respond to environmental chemicals, dietary lipids, and therapeutic agents, often in a cell type–specific and context-specific manner.8,17,23 Importantly, NR signaling is highly tissue-dependent. PXR is most abundantly expressed in the liver, where it plays a central role in xenobiotic clearance, whereas intestinal epithelial cells exhibit comparatively lower PXR expression but relatively higher expression of metabolic regulators such as PPARγ. As a result, the balance between PXR- and PPARγ-driven transcriptional programs—and their competition for shared coactivators—may differ substantially between hepatic and intestinal contexts. Here, we show that the PXR agonist SR12813 elicits a transcriptional response in LS180 colon adenocarcinoma cells that extends beyond canonical xenobiotic metabolism, encompassing lipid metabolic and mitochondrial pathways typically regulated by PPARγ. Functional reporter assays confirm that SR12813 is a dual PXR–PPARγ agonist, providing a mechanistic explanation for its broadened transcriptional effects.

4.1. Nuclear receptor crosstalk and shared coactivators

PXR and PPARγ traditionally occupy separate regulatory domains: PXR serves as a xenobiotic sensor, inducing genes involved in drug metabolism and clearance, whereas PPARγ regulates lipid storage, adipogenesis, and insulin sensitivity.32 However, increasing evidence shows that their signaling pathways intersect at multiple levels. Both receptors use common transcriptional coactivators, including SRC-1, SRC-2, and PGC-1α, and can compete for or cooperatively engage these factors depending on ligand context and cellular environment.14,22, 23, 24 This shared cofactor usage creates the potential for ligands such as SR12813 to modulate both pathways simultaneously. In our mammalian one-hybrid system, SR12813 activated hPXR and mPPARγ in a coactivator-sensitive manner, consistent with convergence on these transcriptional regulators.

4.2. Dual PXR-PPARγ activation explains metabolic gene induction

The coordinated induction of xenobiotic and metabolic gene networks by SR12813 highlights how dual NR engagement can reshape transcriptional programs beyond classical PXR signaling. Although several of the upregulated genes are known PPARγ targets15, 16, 17, 18,21,28 suggesting receptor crosstalk, it is important to note that PXR activation alone has also been reported to influence lipid and energy metabolism in certain contexts. Thus, the observed induction of metabolic genes by SR12813 likely reflects a combination of direct PPARγ activation and indirect or cooperative effects mediated by PXR, rather than exclusive regulation by a single receptor. Together with reporter assay data demonstrating direct activation of both GAL4-PPARγ-LBD and full-length human PPARγ, these findings support a model in which SR12813 engages overlapping PXR- and PPARγ-dependent transcriptional programs, resulting in coordinated regulation of xenobiotic and metabolic gene networks. This dual activity provides a plausible mechanistic basis for the expanded metabolic transcriptional program observed in LS180 cells after SR12813 treatment. Although initial ligand screening used a murine PPARγ-LBD reporter, confirmation of SR12813 activity using full-length human PPARγ supports the relevance of these findings to human NR signaling.

4.3. Pharmacological implications of partial dual agonism

SR12813’s dual activity has notable implications for pharmacology and toxicology. Its partial agonist profile at PPARγ may reduce the adverse effects associated with full agonists like rosiglitazone, such as fluid retention and weight gain,16,17 while still engaging key metabolic pathways. Similarly, SR12813’s induction of PXR targets is robust but not excessive compared to rifampicin, suggesting the potential for receptor-selective modulation rather than blanket activation. Such properties may be advantageous in settings where balanced modulation of xenobiotic and metabolic pathways is desirable—for example, in patients with metabolic syndrome receiving multiple medications.

4.4. Relevance for nuclear receptor biology and drug development

The ability of a single ligand to simultaneously modulate multiple NRs underscores the complexity of transcriptional regulation in metabolic tissues and tumors. SR12813 provides a useful tool compound for dissecting PXR-PPARγ crosstalk and may serve as a starting point for developing selective dual modulators. Because PXR and PPARγ influence overlapping metabolic, inflammatory, and drug disposition pathways,7,9,14,17,25, 26, 27 dual modulators could have unique applications in endocrine and hepatic disorders, or in mitigating drug-drug interactions through finely tuned receptor activation.

5. Conclusions

Our findings demonstrate that SR12813 acts as a dual agonist for PXR and PPARγ, inducing both xenobiotic metabolism and lipid metabolic programs in LS180 colon cancer cells. These results highlight the importance of considering NR crosstalk in interpreting ligand-dependent transcriptional responses and suggest opportunities to exploit this interplay for therapeutic benefit. Future studies will be needed to define the structural basis of SR12813’s dual activity, its tissue selectivity in vivo, and its impact on metabolic homeostasis under physiological and pathological conditions.

Conflict of interest

The authors declare no conflicts of interest.

Acknowledgments

The authors gratefully acknowledge Steven Kliewer (University of Texas Southwestern Medical Center) for providing the plasmid construct containing full-length human PPARγ. They acknowledge Missouri Southern State University for providing laboratory space in which portions of this work were conducted.

Financial support

This work was supported in part by funds provided by the National Cancer Institute at the National Institutes of Health [Grant 1R15CA287338], and by internal research support from Kansas City University.

Data availability

The RNA-sequencing data that support the findings of this study are openly available in ArrayExpress under accession number E-MTAB-16299 (https://www.ebi.ac.uk/biostudies/arrayexpress/studies/E-MTAB-16299). All other data presented are contained within the article and Supplemental Material.

CRediT authorship contribution statement

Dan Brobst: Funding acquisition, Conceptualization, Data curation, Formal analysis, Investigation, Writing – Original draft, Writing – Review and Editing. Jack Hemsath: Data curation, Formal analysis, Writing. Abigail Niewchas: Data curation, Formal analysis, Writing. Chi Pham: Data curation, Formal analysis, Writing. Brendan Lamboglia: Data curation, Formal analysis, Writing. Yasmeen Sawalha: Data curation, Formal analysis, Writing. Cameron Ballard: Data analysis, Investigation, Writing. Russell Bodily: Data analysis, Investigation, Writing. Whitney Dye: Data analysis, Investigation, Writing. Vi Nguyen: Data analysis, Investigation, Writing. Adam Youseff: Data analysis, Investigation, Writing. Catherine Elliott: Data analysis, Investigation, Writing. Jeff L. Staudinger: Funding acquisition, Conceptualization, Data curation, formal analysis, Investigation, Writing – Original draft, Writing – Review and Editing. Bradley A. Creamer: Funding acquisition, Conceptualization, Data curation, Formal analysis, Investigation, Writing – Original draft, Writing Review – Editing.

Declaration of AI and AI-assisted technologies in the writing process

During the preparation of this article, the authors used ChatGPT (OpenAI, GPT-5 model) in order to assist with language refinement and editorial tightening to improve clarity and conciseness. After using this tool, the authors reviewed and edited the content as needed and takes full responsibility for the content of the publication.

Footnotes

This article has supplemental material available at dmd.aspetjournals.org.

Supplemental material

Supplementary Figures 1-2
mmc1.docx (2MB, docx)

References

  • 1.Watkins R.E., Wisely G.B., Moore L.B., et al. The human nuclear xenobiotic receptor PXR: structural determinants of directed promiscuity. Science. 2001;292(5525):2329–2333. doi: 10.1126/science.1060762. [DOI] [PubMed] [Google Scholar]
  • 2.Kliewer S.A., Goodwin B., Willson T.M. The nuclear pregnane X receptor: a key regulator of xenobiotic metabolism. Endocr Rev. 2002;23(5):687–702. doi: 10.1210/er.2001-0038. [DOI] [PubMed] [Google Scholar]
  • 3.Goodwin B., Hodgson E., Liddle C. The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol Pharmacol. 1999;56(6):1329–1339. doi: 10.1124/mol.56.6.1329. [DOI] [PubMed] [Google Scholar]
  • 4.Schuetz E.G., Brimer C., Schuetz J.D. Environmental xenobiotics and the antihormones cyproterone acetate and spironolactone use the nuclear hormone pregnenolone X receptor to activate the CYP3A23 hormone response element. Mol Pharmacol. 1998;54(6):1113–1117. doi: 10.1124/mol.54.6.1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lehmann J.M., McKee D.D., Watson M.A., Willson T.M., Moore J.T., Kliewer S.A. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest. 1998;102(5):1016–1023. doi: 10.1172/jci3703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Blumberg B., Sabbagh W., Jr., Juguilon H., et al. SXR, a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 1998;12(20):3195–3205. doi: 10.1101/gad.12.20.3195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rogers R.S., Parker A., Vainer P.D., et al. The interface between cell signaling pathways and pregnane X receptor. Cells. 2021;10(11):3262. doi: 10.3390/cells10113262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Venkatesh M., Mukherjee S., Wang H., et al. Symbiotic bacterial metabolites regulate gastrointestinal barrier function via the xenobiotic sensor PXR and Toll-like receptor 4. Immunity. 2014;41(2):296–310. doi: 10.1016/j.immuni.2014.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Moreau A., Vilarem M.J., Maurel P., Pascussi J.M. Xenoreceptors CAR and PXR activation and consequences on lipid metabolism, glucose homeostasis, and inflammatory response. Mol Pharm. 2008;5(1):35–41. doi: 10.1021/mp700103m. [DOI] [PubMed] [Google Scholar]
  • 10.Gao J., Xie W. Pregnane X receptor and constitutive androstane receptor at the crossroads of drug metabolism and energy metabolism. Drug Metab Dispos. 2010;38(12):2091–2095. doi: 10.1124/dmd.110.035568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Tolson A.H., Wang H. Regulation of drug-metabolizing enzymes by xenobiotic receptors: PXR and CAR. Adv Drug Deliv Rev. 2010;62(13):1238–1249. doi: 10.1016/j.addr.2010.08.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Creamer B.A., Sloan S.N.B., Dennis J.F., et al. Associations between pregnane X receptor and breast cancer growth and progression. Cells. 2020;9(10):2295. doi: 10.3390/cells9102295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Staudinger J.L., Mahroke A., Patel G., Dattel C., Reddy S. Pregnane X receptor signaling pathway and vitamin K: molecular mechanisms and clinical relevance in human health. Cells. 2024;13(8):681. doi: 10.3390/cells13080681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Poudel S., Huber A.D., Chen T. Regulation of nuclear receptors PXR and CAR by small molecules and signal crosstalk: roles in drug metabolism and beyond. Drug Metab Dispos. 2023;51(2):228–236. doi: 10.1124/dmd.122.000858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Evans R.M., Barish G.D., Wang Y.X. PPARs and the complex journey to obesity. Nat Med. 2004;10(4):355–361. doi: 10.1038/nm1025. [DOI] [PubMed] [Google Scholar]
  • 16.Willson T.M., Brown P.J., Sternbach D.D., Henke B.R. The PPARs: from orphan receptors to drug discovery. J Med Chem. 2000;43(4):527–550. doi: 10.1021/jm990554g. [DOI] [PubMed] [Google Scholar]
  • 17.Wahli W. A gut feeling of the PXR, PPAR and NF-kappaB connection. J Intern Med. 2008;263(6):613–619. doi: 10.1111/j.1365-2796.2008.01951.x. [DOI] [PubMed] [Google Scholar]
  • 18.Bishop-Bailey D. PPARs and angiogenesis. Biochem Soc Trans. 2011;39(6):1601–1605. doi: 10.1042/bst20110643. [DOI] [PubMed] [Google Scholar]
  • 19.Chen M., Wang H., Cui Q., Shi J., Hou Y. Dual function of activated PPARγ by ligands on tumor growth and immunotherapy. Med Oncol. 2024;41(5):114. doi: 10.1007/s12032-024-02363-z. [DOI] [PubMed] [Google Scholar]
  • 20.Yuvaraj S., Kumar B.R.P. Peroxisome proliferator-activated receptor-γ as a novel and promising target for treating cancer via regulation of inflammation: a brief review. Mini Rev Med Chem. 2022;22(1):3–14. doi: 10.2174/1389557521666210422112740. [DOI] [PubMed] [Google Scholar]
  • 21.Villa A.L.P., Parra R.S., Feitosa M.R., et al. PPARG expression in colorectal cancer and its association with staging and clinical evolution. Acta Cir Bras. 2020;35(7) doi: 10.1590/s0102-865020200070000008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Smutny T., Mani S., Pavek P. Post-translational and post-transcriptional modifications of pregnane X receptor (PXR) in regulation of the cytochrome P450 superfamily. Curr Drug Metab. 2013;14(10):1059–1069. doi: 10.2174/1389200214666131211153307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Shulman A.I., Mangelsdorf D.J. Retinoid x receptor heterodimers in the metabolic syndrome. N Engl J Med. 2005;353(6):604–615. doi: 10.1056/NEJMra043590. [DOI] [PubMed] [Google Scholar]
  • 24.Cui W., Shen X., Agbas E., Tompkins B., Cameron-Carter H., Staudinger J.L. Phosphorylation modulates the coregulatory protein exchange of the nuclear receptor pregnane X receptor. J Pharmacol Exp Ther. 2020;373(3):370–380. doi: 10.1124/jpet.119.264762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang H., Venkatesh M., Li H., et al. Pregnane X receptor activation induces FGF19-dependent tumor aggressiveness in humans and mice. J Clin Invest. 2011;121(8):3220–3232. doi: 10.1172/jci41514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Raynal C., Pascussi J.M., Leguelinel G., et al. Pregnane X receptor (PXR) expression in colorectal cancer cells restricts irinotecan chemosensitivity through enhanced SN-38 glucuronidation. Mol Cancer. 2010;9:46. doi: 10.1186/1476-4598-9-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dong Y., Wang Z., Xie G.F., et al. Pregnane X receptor is associated with unfavorable survival and induces chemotherapeutic resistance by transcriptional activating multidrug resistance-related protein 3 in colorectal cancer. Mol Cancer. 2017;16(1):71. doi: 10.1186/s12943-017-0641-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Park J.I., Kwak J.Y. The role of peroxisome proliferator-activated receptors in colorectal cancer. PPAR Res. 2012;2012 doi: 10.1155/2012/876418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhou C., Tabb M.M., Nelson E.L., et al. Mutual repression between steroid and xenobiotic receptor and NF-kappaB signaling pathways links xenobiotic metabolism and inflammation. J Clin Invest. 2006;116(8):2280–2289. doi: 10.1172/jci26283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Staudinger J.L., Goodwin B., Jones S.A., et al. The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci U S A. 2001;98(6):3369–3374. doi: 10.1073/pnas.051551698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Brobst D.E., Ding X., Creech K.L., Goodwin B., Kelley B., Staudinger J.L. Guggulsterone activates multiple nuclear receptors and induces CYP3A gene expression through the pregnane X receptor. J Pharmacol Exp Ther. 2004;310(2):528–535. doi: 10.1124/jpet.103.064329. [DOI] [PubMed] [Google Scholar]
  • 32.Kim J.B., Wright H.M., Wright M., Spiegelman B.M. ADD1/SREBP1 activates PPARgamma through the production of endogenous ligand. Proc Natl Acad Sci U S A. 1998;95(8):4333–4337. doi: 10.1073/pnas.95.8.4333. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures 1-2
mmc1.docx (2MB, docx)

Data Availability Statement

The RNA-sequencing data that support the findings of this study are openly available in ArrayExpress under accession number E-MTAB-16299 (https://www.ebi.ac.uk/biostudies/arrayexpress/studies/E-MTAB-16299). All other data presented are contained within the article and Supplemental Material.

Articles from Drug Metabolism and Disposition are provided here courtesy of American Society for Pharmacology and Experimental Therapeutics

RESOURCES