Gestational Trichloroacetic Acid Exposure Induces Miscarriage by Disrupting Iron Homeostasis in Trophoblasts via the KEAP1-NRF2 Pathway

Abstract

Trichloroacetic acid (TCAA) is one of the most commonly detected non-volatile disinfection byproducts (DBPs) in public water supplies. Previous epidemiological studies have established associations between TCAA exposure and elevated risks of adverse pregnancy outcomes, yet its impacts on pregnancy maintenance remain poorly understood. In this study, we found that gestational TCAA exposure induced pregnancy loss in mice by disrupting trophoblast invasion and impairing the placental structure. Mechanistically, TCAA inhibited the Kelch-like ECH-associated protein 1 (KEAP1)-nuclear factor erythroid 2-related factor 2 (NRF2) interaction, which drove placental iron dyshomeostasis marked by an expanded labile iron pool (LIP) and subsequent reactive oxygen species (ROS) overaccumulation. The iron chelator deferoxamine (DFO) significantly alleviated TCAA-induced pregnancy loss by restoring iron metabolism, reducing oxidative stress, and enhancing trophoblast invasion. Taken together, our findings provided critical insights into the reproductive toxicity of TCAA and underscored the potential of targeting iron homeostasis as a therapeutic strategy.

Introduction

Disinfection byproducts (DBPs) are unintentionally yet inevitably generated during water disinfection using chlorine-based chemicals. To date, more than 700 DBPs have been identified, among which trichloroacetic acid (TCAA) ranks the most prevalent species that is abundant in public water supplies. The World Health Organization’s drinking water quality guidelines establish a maximal concentration level (MCL) of 200 μg/L for TCAA in tap water. Human exposure to TCAA mainly occurs through daily water consumption, and its frequent detection in urine samples reflects its ubiquitous exposure among the general population. ,

TCAA has been recognized as an endocrine-disrupting chemical, , which is linked to diverse adverse health outcomes, including carcinogenicity, teratogenicity, and genotoxicity. − Emerging evidence has further suggested its detrimental effects on female reproductive health. Prenatal exposure to TCAA has been associated with increased risk of adverse pregnancy outcomes such as fetal growth restriction, − premature birth, and stillbirth. However, evidence regarding its potential adverse effects on pregnancy maintenance remains limited.

Miscarriage, defined as pregnancy loss before fetal viability, is one of the most common complications during early pregnancy, affecting approximately 15% of clinically recognized pregnancies. Impaired placental development during early gestation is a key contributing factor to miscarriage. The placenta plays a critical role in supporting fetal growth by mediating nutrient and oxygen exchange and facilitating the removal of metabolic waste. , Trophoblasts, the predominant placental cell type, are essential for pregnancy maintenance. They invade the maternal decidua and myometrium, remodel uterine spiral arteries, and ensure adequate fetal blood supply. Growing evidence indicates that insufficient trophoblast invasion is associated with miscarriages. , Nevertheless, whether TCAA exposure disrupts trophoblast invasion and impairs placental development remains unexplored.

Iron is a key element involved in fundamental biological processes such as oxygen transport, energy production, and DNA synthesis. Typically, extracellular iron is internalized predominantly as ferric iron (Fe³⁺). Once inside the cell, iron is either transported to sites of utilization or sequestered in a nontoxic form by storage proteins such as ferritin. Nevertheless, under pathological conditions, iron is more likely to exist in the active ferrous form (Fe²⁺), which contributes to the intracellular labile iron pool (LIP). The LIP is a dynamic and redox-active fraction that plays a crucial role in cellular signaling. Moreover, dysregulated iron levels can also trigger ferroptosis or oxidative damage, , thereby impairing trophoblast function and contributing to placental pathologies.

The Kelch-like ECH-associated protein 1 (KEAP1) and nuclear factor erythroid 2-related factor 2 (NRF2) axis is a key regulator of cellular redox balance and iron metabolism. , Under physiological conditions, KEAP1 promotes NRF2 ubiquitination and degradation, maintaining relatively stable antioxidant activity. Under cellular stress, NRF2 is stabilized, translocated to the nucleus, and drives the transcription of antioxidant genes. Notably, NRF2 also regulates iron-related proteins like ferritin and transferrin receptor. However, the potential involvement of KEAP1-NRF2 signaling-mediated iron homeostasis in TCAA-induced trophoblast invasion disorders remains unreported.

In this study, we demonstrate that gestational TCAA exposure induces miscarriage by disrupting iron homeostasis in trophoblasts. Our findings not only provide novel insights into TCAA’s reproductive toxicity but also suggest that iron accumulation is a potential therapeutic target for preventing TCAA-induced miscarriages.

Material and Methods

Chemicals and Reagents

Trichloroacetic acid (CAS No. 76–03–9) was purchased from Sigma-Aldrich (Cat. #91228, purity >99.5%) and dissolved in sterilized ddH₂O. Deferoxamine mesylate (DFO, Cat. #HY-B0988), Deferasirox (DFX, Cat. #HY-17359), and ML385 (Cat. #HY-100523) were obtained from MedChemExpress (MCE) and prepared following the manufacturer’s recommended dissolution protocols.

Animal Experiments

The 6–8 week old male and female C57BL/6 mice were purchased from the Shanghai Laboratory of Animal Research Center. All mice were housed in a specific pathogen-free environment with controlled light, humidity, and temperature conditions. All animals had ad libitum access to food and distilled water throughout the experiments. The study was approved by the Institutional Animal Care and Use Committee of Tongji University (TJBG10225101).

To establish a TCAA-exposed mouse model, 8-week-old female mice (weighing 18–20g) were mated overnight with male mice. The detection of a vaginal plug was designated as gestation day 0 (GD0), which was further confirmed by daily weight monitoring. Subsequently, pregnant mice were randomly divided into 4 groups and exposed to 0,10-, 10²-, and 10³-fold maximal concentration level (MCL) of TCAA via oral gavage. The estimated MCL of TCAA for mice was 52.7 μg/kg/day, which was reported by the study of Chen et al. On GD14, the mice were sacrificed and the embryo absorption rate was recorded. The embryo absorption rate was calculated using the formula R/(R + V), where R is the number of fetal losses and V is the number of viable fetuses. The fetal placentas were collected and either fixed in 4% paraformaldehyde (PFA) for sectioning or snap-frozen in liquid nitrogen for protein or RNA extraction.

For the rescue experiment, pregnant mice were divided into 4 groups: control group, 10³-fold MCL of TCAA exposure group, DFO-treated group, and TCAA+DFO-treated group. TCAA was administered via oral gavage, while DFO was given by a daily intraperitoneal injection at a dose of 100 mg/kg.

Fetal Sex Determination by PCR

Individual embryos were lysed using 50 mmol/L NaOH at 95 °C for 20 min. Genotyping was performed via PCR with PowerPol PCR Mix (Abclonal, Cat. #RK20729) under the following cycling protocol: initial denaturation at 94 °C for 2 min, followed by 30 cycles of 94 °C for 20 s, 60 °C for 20 s, and 72 °C for 30 s, with a final elongation at 72 °C for 5 min. The PCR products were separated on 1% (w/v) agarose gels. The primer sequences used are provided as follows (5′ - 3′):

Forward: CACCTTAAGAACAAGCCAATACA

Reverse: GGCTTGTCCTGAAAACATTTGG

Histological Evaluation

Mouse placentas were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned into 4 μm sections. Paraffin sections and hematoxylin-eosin (HE) staining were carried out following standard protocols, with technical support from Shanghai Weiao Biotechnology Co., Ltd. (Shanghai, China). Following antigen retrieval and blocking using 5% BSA, the sections were incubated with primary antibody against Cytokeratin 7 (CK7, Abclonal, Cat. #A4765) at a 1:200 dilution overnight. Subsequently, the sections were incubated with an HRP-conjugated secondary antibody (Gene Tech, Cat. #GK500705) at room temperature for 1 h and developed using diaminobenzidine (DAB). Finally, images were captured by using a digital microscope.

For trophoblast invasion depth quantification, CK7 immunohistochemistry was performed on full-thick longitudinal placental sections. CK7-positive area was defined by moderate to strong intensity of cytoplasmic staining in cells exhibiting typical trophoblast morphological features. Invasion depth was measured from the basal chorionic plate to the deepest CK7-positive area. For each placental section, 3 nonoverlapping fields were measured vertically along the invasion axis using ImageJ software, with the mean value recorded as the final invasion depth for statistical analysis. To ensure reliability, all measurements were performed by 2 independent observers.

Western Blotting Analysis

Protein extraction from mouse placentas was performed using RIPA lysis buffer (Epizyme, Cat. #PC101) with 100× protease and phosphatase inhibitor cocktail (NCM Biotech, Cat. #P002). Protein concentration was quantified via the BCA protein assay kit (Beyotime, Cat. #P0010). Proteins were denatured in 5× loading buffer (NCM Biotech, Cat. #WB2001) at 100 °C for 10 min. For electrophoresis, approximately 15 to 30 μg of protein sample were separated by a 10% sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel and transferred onto a 0.22 μm nitrocellulose membrane (Cytiva, Cat. #10600001). The membranes were blocked with 5% nonfat milk at room temperature for 1.5 h and then incubated with primary antibodies overnight at 4 °C. The primary antibodies used were β-ACTIN (Abclonal, Cat. #AC038, 1:10000), KEAP1 (Abclonal, Cat. #A25951, 1:1000), NRF2 (Abclonal, Cat. #A25327, 1:1000), LC3 (Abclonal, Cat. #A19665, 1:1000), and p62 (Abclonal, Cat. #A19700, 1:10000). Subsequently, the membranes were incubated with HRP-conjugated secondary antibodies (Epizyme, Cat. #LF102) at room temperature for 1 h. Bands were detected by using the Tanon 4600 Chemiluminescent Imaging System. The intensity of each band was quantified with ImageJ software and normalized to the β-ACTIN expression.

Real-Time Quantitative PCR

Total RNA from cells or tissues was extracted using RNAiso Plus (Takara, Cat. #C9109), and reverse transcription was carried out with PrimeScript RT Master Mix (Takara, Cat. #RR036). The RNA expression levels were quantified via SYBR green dye (Takara, Cat. #RR820A) on a QuantStudio real-time PCR system (Thermo Fisher & ABI). The mRNA expression levels of target genes were calculated using the 2^–ΔΔCt method and normalized to the housekeeping gene ACTB/Actb. All primers were synthesized by Biosune Biological Technology Co., Ltd. (Shanghai, China), and the primer sequences are provided in Supplementary Table 1.

Cellular Fe²⁺ and Reactive Oxygen Species (ROS) Measurements

To prepare single cell suspensions from mouse placentas, placentas were collected from pregnant mice, finely minced, and digested with 1 mg/mL type IV collagenase (Sigma, Cat. #C5138) and 0.1 mg/mL DNase I (Sigma, Cat. #DN25) at 37 °C, 220 r/min for 30 min in a constant-temperature shaker. The resulting cell suspension was filtered through a 70 μm cell strainer, treated with RBC lysis buffer for 3 min at room temperature, and centrifuged at 1500 r/min for 3 min to collect the cells. For cultured cells, HTR8 cells were seeded in 12-well plates, allowed to adhere, and treated with different reagents, as described. The cells were then digested, washed, and centrifuged to form a cell suspension.

After pre-treatment, cellular Fe²⁺ levels were detected using 1 μmol/L FerroOrange (Dojindo, Cat. #F374), and cellular ROS levels were measured using 10 μmol/L DCFH-DA (Beyotime, Cat. #S0033S) according to the manufacturer’s protocol. The mean fluorescence intensity (MFI) of the stained cells was measured by flow cytometry, and the data were processed using FlowJo software.

Cell Culture and Treatment

Human trophoblast HTR8/SVneo cell line was cultured in RPMI 1640 (VivaCell, Cat. #C3010–0500) supplemented with 10% fetal bovine serum (Dakewe, Cat. #6021021) and 1% penicillin/streptomycin (NCM biotech, Cat. #C100C5). The cells were maintained in an incubator at 37 °C with 5% CO2. Cells were authenticated by STR analysis and routinely tested for mycoplasma contamination every 3 months. In some experimental groups, cells were treated with 1 μmol/L ML385, 50 μmol/L DFO, or 50 μmol/L DFX for 24 h according to the experimental design. The negative control cells were treated with the corresponding vehicle of the reagent. All experiments were performed with at least 3 biological replicates.

Vectors Construction and Transfection

To overexpress NRF2 in HTR8 cells, we first constructed a transient expression plasmid by cloning the coding sequence of human NFE2L2/NRF2 and inserting it into vector pCMV6-AN-DDK. HTR8 cells were seeded in 6-well plates and grown to 50%–60% of confluence. For each well, 2.5 μg of NRF2-expressing plasmid or empty vector control was mixed with 5 μL of polyethylenimine in the medium according to the manufacturer’s protocol. The DNA-lipid complexes were added to cells and incubated for 48 h before harvesting for experiments. The effectiveness of NRF2 overexpression was confirmed by qPCR and Western blotting. All functional assays were performed within 48–72 h post-transfection to ensure optimal expression levels while minimizing potential cytotoxic effects of prolonged transfection.

To knock down NRF2 in HTR8 cells, targeted short hairpin RNA (shRNA) was cloned into the vector pLKO.1. For lentiviral particle production, HEK-293T cells were seeded in 6 cm dishes and cotransfected with 4 μg of pLKO.1, 3 μg of psPAX2, and 1 μg of pMD2.G using polyethylenimine. To generate stable knockdown cells, HTR8 cells were infected with the lentivirus in the presence of 8 μg/mL Polybrene (Solarbio, Cat. #H8761). Twenty-four h after the infection, cells underwent a 3-day selection with 1 μg/mL puromycin (MCE, Cat. #HY-B1743A) to eliminate uninfected cells. The effectiveness of gene knockdown was validated via Western blotting. Sequences of shRNA (5′ - 3′) are as follows:

shNRF2-F: CCGGC​CCTGT​TGATTT​AGACGG​TATCT​CGAGA​TACCG​TCTAA​ATCAA​CAGGG​TTTTTG,

shNRF2-R: AATTCA​AAAAC​CCTGT​TGATT​TAGACG​GTATCT​CGAGAT​ACCGTC​TAAAT​CAAC​AGGG

Cell Proliferation Assay

Cell proliferation was analyzed using Cell Counting Kit-8 (CCK-8, NCM Biotech, Cat. #C6005). A total of 5,000 cells per well were seeded into 96-well plates and incubated overnight. At 0, 24, and 48 h after cell treatment or culture, the culture medium was replaced with 100 μL of CCK-8 working solution per well. After incubation at 37 °C for 1 h, cell proliferation was determined by measuring the absorbance (OD) at 450 nm using a microplate reader. All experiments were performed in triplicate to ensure data reliability, and the results were averaged to provide a comprehensive assessment of cell proliferation rates across different time points.

Wound Healing Assay

The wound healing assay was conducted to determine the migration capacity of the HTR8 cells. Cells were seeded into 12-well plates and cultured to near confluency in a complete medium. A sterile pipet tip was used to create a uniform linear wound, after which serum-free basal medium was added. Images of the wound were captured at 0 and 24 h under an inverted microscope at 3 random fields. The wound width at each time point was measured by using ImageJ software to calculate the wound closure rate.

Statistical Analysis

Statistical analyses were conducted using GraphPad Prism 10 Software. Normally distributed data were presented as mean ± SD. Differences between two groups were analyzed via an unpaired, two-tailed Student’s t-test. One-way or two-way ANOVA was performed for multiple group comparison. For non-normally distributed data (assessed by the Shapiro-Wilk test), results were presented as median with interquartile range and analyzed with the Kruskal–Wallis test followed by Dunn’s post hoc test. In all analyses, P < 0.05 was considered statistically significant.

Results

Gestational Exposure to TCAA Induces Embryo Absorption in Pregnant Mice

We first investigated the effect of TCAA on pregnancy outcomes after gestational exposure. Throughout the gestational period, pregnant mice exhibited comparable weight gain in control and TCAA-exposed groups (Figure S1A), suggesting no obvious systemic maternal toxicity. On GD14, all pregnant mice were sacrificed. The embryo morphology was examined, and the embryo absorption rate was calculated. As shown in Figure , in the low-dose TCAA exposure group (10-fold MCL of TCAA), only one dam experienced embryo absorption, whereas in the middle-dose exposure group (10²-fold MCL of TCAA), four dams showed embryo absorption. The embryo absorption rate was significantly higher in the 10³-fold MCL of the TCAA exposure group than that in the control group. These results indicated that gestational exposure to TCAA induced miscarriages in pregnant mice.

1.

Gestational exposure to TCAA induces embryo absorption in pregnant mice. (A) Representative photographs of absorbed embryos (black arrow). (B) Rate of embryo absorption in each pregnant mouse exposed to vehicle or different doses of TCAA. Each mouse was presented as a single point. The rate of embryo absorption was calculated using the formula R/(R + V), where R is the number of absorbed fetuses and V is the number of viable fetuses in each mouse (n = 5). (C) Total embryo absorption rate in the vehicle or different doses of the TCAA-treated group. The total embryo absorption rate was calculated using the formula R/(R + V), where R is the number of absorbed fetuses and V is the number of viable fetuses in each group (n = 5). Data are presented as median with interquartile range and analyzed with Kruskal–Wallis test followed by Dunn’s post hoc test. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, no significance.

To evaluate potential sex-dependent effects of TCAA exposure, we analyzed the sex ratio of viable fetuses in the control and 10³-fold MCL of the TCAA exposure group. The proportion of male fetuses was 50.9% versus 52.8% in the control and 10³-fold MCL of TCAA exposure group, while the proportion of female fetuses was 49.1% and 47.2%, respectively (Figure S1B). Statistical analysis by chi-square test indicated no significant difference in sex ratio distribution (P = 0.671), suggesting that TCAA exposure did not induce sex-specific effects.

Gestational Exposure to TCAA Impairs Placental Structure and Inhibits Trophoblast Invasion

Histological analysis by HE staining showed a clear division of the decidual layer, placental junctional zone, and the placental labyrinth zone. In 10²-fold and 10³-fold MCL of TCAA exposure groups, we observed a marked reduction in sinusoidal space area accompanied by substantial thickening of the intervascular membranes (Figure A). To evaluate the trophoblast invasion, immunohistochemical staining for cytokeratin 7 (CK7) was performed using the established methodology described by Zhou et al. (Figure B). Notably, the 10³-fold MCL of the TCAA exposure group exhibited a significant reduction in invasion depth compared to the control group (Figure C). These results suggested that TCAA exposure damaged placental structure and inhibited trophoblast invasion.

2.

Gestational exposure to TCAA impairs placental structure and inhibits trophoblast invasion. (A) Hematoxylin-eosin (HE) staining of placentas from pregnant mice exposed to vehicle or different doses of TCAA. (B) Immunohistochemistry staining of cytokeratin 7 (CK7) in placentas from pregnant mice treated with vehicle or different doses of TCAA. (C) Depth of trophoblast invasion in placentas from pregnant mice treated with vehicle or different doses of TCAA (n = 5). Data are presented as mean ± standard deviation (SD) and analyzed with one-way analysis of variance (ANOVA). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, no significance.

Gestational Exposure to TCAA Inhibits the KEAP1-NRF2 Axis and Disrupts Placental Iron Homeostasis

NRF2 is a transcriptional factor that plays a crucial role in defending cells from oxidative stress. KEAP1, an E3 ubiquitin ligase, regulated the expression of NRF2 through ubiquitin-proteasome degradation. We examined whether TCAA exposure regulated the KEAP1-NRF2 axis by analyzing the expression levels of NRF2 and KEAP1 protein. As shown in Figure A, increasing the level of TCAA exposure led to the concomitant suppression of NRF2 and induction of KEAP1 expression, demonstrating a clear dose–response relationship. Given that multiple studies have identified autophagy as a key regulator of the KEAP1-NRF2 pathway, , we also examined the expression levels of classic autophagic markers, including microtubule-associated protein 1 light chain 3 (LC3) and p62 (also known as Sequestosome 1, SQSTM1). As shown in Figure A, TCAA exposure increased the expression of the active form of LC3 (denoted as LC3-II) and decreased the level of p62 expression in placental tissues, indicating enhanced autophagic flux. Together, these results suggested that TCAA exposure suppressed the KEAP1-NRF2 axis while activating autophagy.

3.

Gestational exposure to TCAA inhibits the KEAP1-NRF2 axis and disrupts placental iron homeostasis. (A) Western blots of nuclear factor erythroid 2-related factor 2 (NRF2), Kelch-like ECH-associated protein 1 (KEAP1), microtubule-associated protein 1 light chain 3 (LC3), and p62 (also known as Sequestosome 1, SQSTM1) in placentas from pregnant mice exposed to vehicle or different doses of TCAA. The activation of LC3 was quantified by the LC3-II/LC3-I ratio. The expression levels of other proteins were normalized to β-ACTIN (n = 3). (B) mRNA expression level of ferroportin (Fpn), ferritin heavy chain (Fth1), transferrin receptor 1 (Tfr1), divalent metal transporter 1 (Dmt1), and nuclear receptor coactivator 4 (Ncoa4) in placentas from pregnant mice exposed to vehicle or different doses of TCAA (n = 3). (C) Mean fluorescence intensity (MFI) of cellular labile iron (Fe²⁺) and reactive oxygen species (ROS) in placentas from pregnant mice exposed to vehicle or different doses of TCAA (n = 3). In the histogram, the X-axis represents fluorescence intensity, while the Y-axis shows cell counts. The rightward shift of the peak indicates increased MFI, reflecting enhanced intracellular accumulation of Fe²⁺ or ROS. Data were presented as mean ± SD and analyzed with one-way ANOVA. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, no significance.

Given NRF2’s established role in maintaining iron homeostasis, we next evaluated mRNA expression of iron metabolism-related genes. As shown in Figure B, treatment with TCAA significantly upregulated the expression of iron importer transferrin receptor 1 (Tfr1) and decreased the expression levels of iron exporter ferroportin (Fpn) and iron storage protein ferritin (Fth1). However, the expression levels of divalent metal transporter 1 (Dmt1) and nuclear receptor coactivator 4 (Ncoa4), which mediates the release of iron from endosomes or autolysosomes, remained unaltered (Figure B). This coordinated expression profile, characterized by enhanced iron uptake, reduced iron export, and diminished iron storage capacity, suggests a mechanistic basis for placental iron accumulation. Consistently, we observed a significant expansion of the labile iron pool and elevated reactive oxygen species (ROS) levels in TCAA-exposed placentas (Figure C). These results collectively demonstrated that TCAA exposure inhibited the KEAP1-NRF2 axis, activated autophagy, and disrupted placental iron homeostasis, ultimately leading to iron overload.

Inhibition of NRF2 Suppresses Trophoblast Cell Proliferation, Migration, and Disrupts Iron Homeostasis

Given the observed correlation between NRF2 downregulation and impaired trophoblast invasion in TCAA-exposed models, we subsequently investigated the functional significance of NRF2 in trophoblast biology through an in vitro experiment. We employed both pharmacological inhibition (using the NRF2-specific inhibitor ML385) and genetic silencing approaches. Stable NRF2-knockdown HTR8 cells were generated using shRNA (designated as shNRF2), with successful NRF2 protein reduction verified by Western blot analysis (Figure A). NRF2 suppression significantly attenuated trophoblast proliferation, as demonstrated by reduced cellular growth in both ML385-treated and shNRF2 HTR8 cells (Figure B, C). Wound healing assays further showed a significant decrease in the cell migration rate in ML385-treated and shNRF2 HTR8 cells (Figure D, E).

4.

Inhibition of NRF2 suppresses trophoblast cell proliferation and migration, and disrupts iron homeostasis. (A) Expression of NRF2 protein in shNRF2-HTR8 cells. (B) Cell proliferation of dimethyl sulfoxide (DMSO) and ML385-treated HTR8 cells (n = 6). (C) The cell proliferation of DMSO and shNRF2-HTR8 cells (n = 6). (D) Cell migration of DMSO and ML385-treated HTR8 cells (n = 6). (E) The cell migration of shNC and shNRF2-HTR8 cells (n = 6). (F) mRNA expression levels of FPN, FTH1, TFRC, DMT1, and NCOA4 in DMSO and ML385-treated HTR8 cells (n = 3). (G) mRNA expression levels of FPN, FTH1, TFRC, DMT1, and NCOA4 in shNC and shNRF2-HTR8 cells (n = 3). (H) MFI of Fe²⁺ and ROS in DMSO and ML385-treated HTR8 cells (n = 3). (I) MFI of Fe²⁺ and ROS in shNC and shNRF2-HTR8 cells (n = 3). Data are presented as mean ± SD and analyzed two-tailed unpaired Student’s t-test or two-way ANOVA. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, no significance.

In addition to cell proliferation and migration, we also explored the impact of NRF2 suppression on iron homeostasis in HTR8 cells by measuring the mRNA levels of FPN, FTH1, TFRC, DMT1, and NCOA4. As shown in Figure F and 4G, FPN and FTH1 expression were downregulated in both ML385-treated and shNRF2 cells, while DMT1 and NCOA4 levels remained generally stable. TFRC expression showed a slight upward trend with statistical significance only observed in the shNRF2 group. Furthermore, both ML385-treated and shNRF2 cells exhibited elevated intracellular labile iron levels, which were accompanied by increased ROS accumulation (Figure H, I).

To further investigate the regulatory role of NRF2 in iron homeostasis, we established NRF2-overexpressing HTR8 cells (referred to as OE-NRF2). Successful overexpression was confirmed by increased NRF2 expression at both mRNA and protein levels (Figure S2A, B). As shown in Figure S2C, NRF2-OE cells demonstrated markedly upregulated expression of FPN and FTH1, while maintaining comparable levels of TFRC, DMT1, and NCOA4. Functional assays revealed that NRF2 overexpression enhanced the migration rate of HTR8 cells in the wound healing assay (Figure S2D). Moreover, NRF2-OE cells showed decreased accumulation of both intracellular labile iron and ROS (Figure S2E, F), which is opposite that observed in NRF2 knockdown experiments. Collectively, these findings demonstrate that NRF2 plays a pivotal role in regulating iron homeostasis and trophoblast function.

NRF2 Inhibition Disrupts Trophoblast Cell Proliferation and Migration via Increasing the Labile Iron Pool

To determine whether NRF2 inhibition-induced cellular dysfunction is mediated by labile iron accumulation, we treated NRF2-inhibited trophoblasts with deferoxamine (DFO), a clinically approved iron chelator. As shown in Figure A and B, DFO significantly rescued cell proliferation suppressed by either pharmacological (ML385) or genetic (shNRF2) NRF2 inhibition. Similarly, DFO effectively rescued the reduced cell migration rate caused by ML385 treatment or NRF2 knockdown (Figure C, D). Interestingly, DFO alone also adversely affected cell proliferation and migration compared with the DMSO or shNC group, highlighting that cellular iron levels must be maintained within an appropriate range, as iron can be a double-edged sword. Furthermore, DFO treatment reversed the ML385-induced elevation in ROS and labile iron levels (Figure E, F), and similar results were observed in shNRF2 HTR8 cells (Figure G, H). To further confirm the rescue effect of iron chelators, we also employed deferasirox (DFX) in our experiments, which is a clinically approved therapy for chronic iron overload. Similar to DFO, DFX also restored cell proliferation and migration, while reducing cellular ROS and labile iron accumulation induced by NRF2 inhibition (Figure S3). These results indicated that NRF2 inhibition disrupted trophoblast cell function by increasing the labile iron pool.

5.

NRF2 inhibition disrupts trophoblast cell proliferation and migration via increasing labile iron pool. (A) Difference in cell proliferation between DMSO, ML385, deferoxamine (DFO), and DFO+ML385 treated HTR8 cells (n = 6). (B) Difference in cell proliferation between shNC, shNRF2, shNC+DFO, and shNRF2+DFO treated HTR8 cells (n = 6). (C) Difference in cell migration between DMSO, ML385, DFO, and DFO+ML385 treated HTR8 cells (n = 6). (D) Difference in cell migration between shNC, shNRF2, shNC+DFO, and shNRF2+DFO treated HTR8 cells (n = 6). (E) Difference in Fe²⁺ levels between DMSO, ML385, DFO, and DFO+ML385 treated HTR8 cells (n = 3). (F) Difference in ROS levels between DMSO, ML385, DFO, and DFO+ML385 treated HTR8 cells (n = 3). (G) Difference in Fe²⁺ levels between shNC, shNRF2, shNC+DFO, and shNRF2+DFO treated HTR8 cells (n = 3). (H) Difference in ROS levels between shNC, shNRF2, shNC+DFO, and shNRF2+DFO treated HTR8 cells (n = 3). Data are presented as mean ± SD and analyzed with one-way ANOVA or two-way ANOVA. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, no significance.

DFO Rescues TCAA-Induced Reproductive Toxicity in Pregnant Mice

To evaluate the therapeutic potential of DFO against TCAA-induced reproductive toxicity, we performed comprehensive rescue experiments in murine models. Co-administration of DFO (100 mg/kg, ip) with TCAA significantly alleviated the elevated embryo absorption rate (Figure A, B). Histopathological assessment further demonstrated that DFO treatment ameliorated placental vascular architecture, as evidenced by partial recovery of blood sinusoid area reduction in TCAA-exposed placentas (Figure C), suggesting improved fetoplacental perfusion. Moreover, DFO intervention also effectively reversed TCAA-impaired trophoblast invasion, with quantitative immunohistochemical analysis revealing deeper CK7⁺ cell infiltration in placental tissues (Figure D, E). Iron quantification assays confirmed the chelation ability of DFO in vivo, as evidenced by reduced labile iron levels in the DFO monotherapy group compared with those in the controls. Flow cytometric analysis further revealed that DFO cotreatment abrogated TCAA-induced elevations in placental labile iron and ROS concurrently (Figure F, G). In summary, these results demonstrated that DFO effectively mitigated TCAA-induced reproductive toxicity by restoring iron homeostasis and reducing oxidative stress, thereby improving placental structure and function.

6.

DFO rescues TCAA-induced reproductive toxicity in pregnant mice. (A) Representative photographs of embryo absorption from pregnant mice treated with vehicle, 10³-fold MCL of TCAA, DFO, and TCAA+DFO (arrows indicated embryo absorption sites). (B) Embryo absorption rate in the vehicle, 10³-fold MCL of TCAA, DFO, and TCAA+DFO-treated groups (n = 5). (C) HE staining of placentas from pregnant mice treated with vehicle, 10³-fold MCL of TCAA, DFO, and TCAA+DFO. (D) Immunohistochemistry staining of CK7 in placentas from pregnant mice treated with vehicle, 10³-fold MCL of TCAA, DFO, and TCAA+DFO. (E) Depth of trophoblast invasion in vehicle, 10³-fold MCL of TCAA, DFO, and TCAA+DFO-treated groups (n = 5). (F) MFI of Fe²⁺ level in placentas from pregnant mice treated with vehicle, 10³-fold MCL of TCAA, DFO, and TCAA+DFO (n = 3). (G) MFI of ROS level in placentas from pregnant mice treated with vehicle, 10³-fold MCL of TCAA, DFO, and TCAA+DFO (n = 3). Data are presented as mean ± SD or median with interquartile range and analyzed with one-way ANOVA or Kruskal–Wallis test followed by Dunn’s post hoc test, respectively. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, no significance.

Discussion

The widespread implementation of chlorination-based water disinfection has led to the pervasive existence of DBPs in environmental matrices worldwide. Among these, trihalomethanes (THMs) and haloacetic acids (HAAs) represent the most prevalent classes. Human exposure to DBPs is inevitable, and high levels of DBPs detected in pregnant women have raised concerns regarding prenatal exposure. ,, Epidemiological studies have linked high THMs exposure to increased risk of spontaneous abortion. , Animal studies showed that oral administration of THMs caused pregnancy loss in F344 rats, suggesting the embryotoxicity of THMs. , However, the impacts of HAAs exposure on pregnancy maintenance remain unclear. In this study, we demonstrated that exposure to TCAA at environmentally relevant doses significantly increased the rate of embryo absorption in pregnant mice. To translate these findings to human health, future large-scale epidemiological or clinical studies are essential to establishing a direct link between TCAA exposure and human pregnancy loss.

The placenta serves as a vital link between the mother and fetus, and its dysfunction can lead to embryo maldevelopment. The placental labyrinth zone, where most substance exchange occurs, consists of highly branched fetal capillaries lined by trophoblasts surrounded by maternal blood sinuses. This structural complexity renders the region particularly vulnerable to circulating toxins. Previous reports indicate that environmental contaminants like perfluorohexyl sulfonate reduce labyrinthine thickness and blood sinusoid area. , Our observations extend these findings by demonstrating that TCAA exposure reduces the placental blood sinusoid area and causes intervascular membrane thickening. As proper placental perfusion is crucial for fetal oxygenation and nutrient supply, such structural damage could result in intrauterine hypoxia, fetal maldevelopment, or even fetal death. ,

Beyond its canonical role in mediating antioxidative responses, NRF2 has emerged as a key regulator of iron homeostasis. , It directly controls the expression of ferritin subunits (Fth1/Ftl), , and the sole cellular iron exporter, Fpn. Ferritinophagy, a newly identified process that mobilizes storage iron through NCOA4-mediated ferritin autophagic degradation, is another important pathway for maintaining iron homeostasis. Notably, NRF2 knockout could increase NCOA4 levels, promote ferritinophagy, and boost LIP. In our study, we observed reduced NRF2 expression in TCAA-exposed mouse placentas along with altered expressions of iron regulatory genes. Specifically, TCAA exposure upregulated the expression of Tfr1 and downregulated the expression of Fpn and Fth1 in mouse placentas. However, TCAA exposure had no impact on the expression of Dmt1 and Ncoa4. These findings confirmed NRF2’s roles in regulating iron storage and export, while the unaltered Ncoa4 and Dmt1 expression suggests that TCAA-induced iron imbalance primarily arises from disrupted storage and export systems rather than the ferritinophagy-mediated iron mobilization.

Although our data demonstrated that TCAA exposure caused placental iron accumulation via the KEAP1-NRF2 axis, the precise upstream mechanism by which TCAA inhibited this pathway remains to be elucidated. Upon exposure to external stressors or insults, cells can activate autophagy as an adaptive response. In our results, we observed that placental tissues from TCAA-treated mice exhibited increased levels of LC3 and decreased levels of p62 expression, consistent with the activation of autophagic flux. Since p62 and NRF2 compete for binding to KEAP1, a reduction in p62 may increase the availability of KEAP1 to bind NRF2, thereby promoting NRF2 degradation. Thus, we propose that TCAA-induced autophagy activation and the subsequent downregulation of p62 may represent one of the upstream mechanisms through which TCAA inhibits the KEAP1-NRF2 pathway.

Cellular iron predominantly exists in a protein-bound and redox-inert form, with only about 5% comprising the LIP, which remains chemically chelatable and exchangeable to drive metabolic processes. Our data revealed a pathological expansion of LIP in both TCAA-exposed placentas and NRF2-inhibited trophoblasts, which was correlated with structural and functional placental impairments. Mechanistically, elevated LIP drives ROS overproduction via the Fenton reaction, triggering oxidative damage to biomolecules (DNA/proteins/lipids) and compromising cell viability. This aligns with the evidence linking iron overload to impaired trophoblast migration and invasion, though the molecular mediators that may differ across experimental systems. − Notably, iron deficiency can also compromise trophoblast function, revealing the dual nature of iron as both an essential cofactor and a potential cytotoxic agent. These findings collectively underscore the necessity for precise control over placental iron metabolism, as deviations in either direction (excess or deficiency) can disrupt critical gestational processes.

In both humans and rodents, iron is transported across the placental syncytiotrophoblasts (STB) via ferroportin (FPN) expressed on the basal membrane. It has been established that moderate to severe gestational iron deficiency could lead to both immediate and long-term consequences for the offspring. Given iron’s essential role in neurodevelopment, brain structure alterations and cognitive impairments are the most frequently reported risks. Evidence from animal models and human observational studies has indicated that the hippocampus and myelination processes are particularly vulnerable to iron deficiency. , A plausible explanation is the imbalance between the high energy demand of these rapidly developing neural structures and the disruption in cellular energy metabolism resulting from insufficient iron availability. Based on our findings, we propose that TCAA-induced placental iron accumulation likely disrupts iron transfer to the fetus, potentially leading to fetal iron deficiency. In this study, we mainly focused on how placental iron accumulation impaired trophoblast function and fetal viability. Further studies are required to directly measure the fetal iron status and evaluate the long-term developmental outcomes of placental iron dyshomeostasis.

DFO, a well-known potent iron chelator, has been widely used as a ferroptosis inhibitor in recent research. , In our study, treating TCAA-exposed mice with DFO alleviated embryo absorption and improved the placental labyrinth structure. At the cellular level, the inhibitory effects of NRF2 suppression on trophoblast proliferation and migration were also reversed by DFO. This is consistent with other studies , showing that DFO can reduce LIP and ROS accumulation both in vivo and in vitro. Although DFO has been clinically used to treat iron overload in thalassemia patients, the potential reproductive risks of its systemic administration have not been fully understood. Based on previous studies, − we used DFO at the dose of 100 mg/kg/d and found no obvious adverse effects on fetal development or placental morphology. However, more experiments are needed to further optimize the dosage and administration frequency of DFO for potential therapeutic applications.

Drinking water represents a primary route of human exposure to TCAA, with an MCL of 100 μg/L according to Chinese “standards for drinking water quality” guidelines (GB 5749–2022). Beyond drinking water, humans can be exposed to TCAA through multiple pathways, including consumption of chlorine-processed food, dermal absorption from swimming pool water, and inhalation in industrial areas. Several studies have assessed human exposure by measuring urinary TCAA levels, with one reporting a median concentration of 3.3 mg/L. Based on this value, we estimated the average environmental exposure in humans to be approximately 0.1 mg/kg/day for a 70 kg adult. This corresponds to a mouse equivalent dose of 1.23 mg/kg/day, which lies between the low (0.527 mg/kg/day) and middle (5.27 mg/kg/day) exposure doses used in our study. The selected doses aligned with those employed in other toxicological studies. For instance, one study demonstrated that administration of 205 mg/kg/day for 4 weeks induced hyperactivation of CD4⁺ T cells, a process linked to autoimmune disease development. Another study reported that TCAA exposure at doses ranging from 12 to 800 mg/kg/day over 5 days increased the incidence of liver adenomas or carcinomas in a dose-dependent manner. These results together strengthened the evidence for TCAA toxicity and provided scientific support for evaluating and refining disinfectant regulations to safeguard public health, particularly for vulnerable groups.

In summary, our study demonstrates that gestational TCAA exposure induces miscarriage in mice by impairing the placental structure and trophoblast function. Mechanistically, TCAA disrupts iron homeostasis via the suppression of the KEAP1-NRF2 axis, which drives the expansion of the LIP and ROS overaccumulation in placental tissues. The iron chelator DFO effectively rescued TCAA-induced miscarriages. Our findings not only revealed TCAA’s reproductive toxicity but also highlighted the potential of targeting iron homeostasis as a therapeutic strategy.

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/envhealth.5c00172.

• Body weight and fetal sex ratio of TCAA-exposed mice; effects of NRF2 overexpression on trophoblast cell migration and iron accumulation; NRF2 inhibition disruption of trophoblast cell proliferation and migration via increasing labile iron pool; primers used in qPCR assay (PDF)

#.

Y. Zhang and H. Rao. contributed equally to this work.

The authors declare no competing financial interest.