Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2026 Mar 13;26:386. doi: 10.1186/s12866-026-04926-8

Attenuated efficacy of Streptococcus salivarius K12 against Mycoplasma pneumoniae infection in mice

Xiaoling Su 1,#, Yuan Li 1,#, Ying Huang 1, Haodang Luo 1, Chao Li 1, Xinchao Yi 1, Ning Wu 2,✉, Jun He 1,✉
PMCID: PMC13097809  PMID: 41820920

Abstract

The respiratory microbiota plays a crucial role in modulating pulmonary immune responses; however, the mechanisms by which commensal microbiota influence Mycoplasma pneumoniae pneumonia (MPP) pathogenesis remain incompletely understood. This study investigated the impact of Streptococcus salivarius K12 (K12) on pulmonary responses in mice infected with Mycoplasma pneumoniae (Mp). Twenty-four male BALB/c mice were randomly divided into three groups: a normal control group (Control), an Mp + PBS group, and an Mp+K12 group, with eight mice per group. After establishing the Mp infection model, mice were orally administered either K12 probiotic suspension or PBS for 14 consecutive days. Bronchoalveolar lavage fluid (BALF) was collected to assess Mp load and inflammatory cell counts. Inflammatory and pathological changes in serum, BALF, and lung tissue were evaluated. The lower respiratory tract (LRT) microbiota was characterized by 16S rRNA sequencing of BALF samples. No significant intergroup differences were observed in P1 protein or CARDS toxin mRNA levels. Hematoxylin and eosin staining of lung tissue demonstrated no discernible histopathological differences among groups. However, the Mp+K12 group showed a significant reduction in total white blood cell counts in BALF compared to the Mp + PBS group. Serum levels of TNF-α and IL-6 were notably lower in the Mp+K12 group than in the Mp + PBS group. TNF-α mRNA expression in lung tissue was also markedly reduced in the Mp+K12 group. Both the Mp + PBS and Mp+K12 groups exhibited reduced expression of the airway remodeling factor Col3A1 mRNA relative to the Control group, though Col3A1 mRNA expression was higher in the Mp+K12 group than in the Mp + PBS group. Shannon index analysis indicated no significant differences in species richness among the groups, with the Mp+K12 group displaying a microbial community structure most similar to the Control group. The probiotic K12 attenuated the effects of Mp infection in mice, primarily by mitigating inflammatory responses and shifting the lung microbiota toward a more balanced composition. These findings provide valuable insights into potential mechanisms and therapeutic strategies for Mp infections.

Keywords: Streptococcus salivarius K12, Mycoplasma pneumoniae, Oral probiotics, Mycoplasma pneumoniae infection mice model, BALB/c mice

Introduction

Mycoplasma pneumoniae pneumonia (MPP) is a common respiratory infectious disease caused by Mycoplasma pneumoniae (Mp). The pathogen initially adheres to and colonizes the airway epithelium through the P1 adhesin, then persists and replicates locally while producing virulence factors, notably the community-acquired respiratory distress syndrome (CARDS) toxin. These factors trigger and exacerbate pulmonary inflammation, imposing a substantial burden on human health [1]. Children under five years of age are particularly vulnerable and tend to experience more severe clinical manifestations [2, 3]. Primary symptoms of Mp infection include headache, sore throat, fever, and cough, along with other respiratory signs, with the incidence of respiratory infections ranging from 0% to 30% [4]. Epidemiological studies indicate that Mp outbreaks occur cyclically, approximately every 3 ~ 7 years. Following the COVID-19 pandemic, waning herd immunity and accumulated immune debt have contributed to a marked global resurgence in Mp infection rates [5, 6]. The increasing severity of MPP is frequently attributed to the host’s exaggerated inflammatory response to infection [7]. Consequently, there is an urgent need to refine clinical treatment strategies for Mp infections. Antibiotics remain the standard of care for MPP, but their widespread use drives resistance and disrupts the airway microbiota, leading to relapse and refractory disease. These limitations underscore the need for therapies that control infection while maintaining host microbial-immune balance.

Mp infection triggers airway inflammation and can disrupt epithelial homeostasis, leading to neutrophil protease responses, mucus program activation, and tissue remodeling. Neutrophil activity in MPP has been linked to elevated matrix metalloproteinase-9 (MMP9), a key mediator of extracellular-matrix turnover and inflammatory remodeling [8]. In parallel, Mp directly induces airway epithelial expression of the major gel-forming Mucin 5AC (MUC5AC), which is central to mucus hypersecretion and airway obstruction phenotypes [9]. Persistent inflammation further promotes extracellular-matrix remodeling, in which type III collagen (Col3A1) is a representative marker associated with airway wall remodeling and repair-associated matrix deposition [10]. Accordingly, this study quantified pulmonary mRNA levels of MMP9, MUC5AC, and Col3A1 to interrogate the inflammation–mucus–matrix remodeling axis during Mp infection.

The respiratory microbiota plays a crucial role in modulating pulmonary immune responses. Its composition and dynamic changes not only influence local immune homeostasis but also enhance host defense against pathogens through competitive exclusion and immunomodulation [11, 12]. Studies have shown that children with MPP exhibit an imbalanced respiratory microbiota, characterized by disrupted community structure and reduced diversity [13]. However, the mechanisms by which commensal microbiota influence MPP pathogenesis remain incompletely understood, warranting further investigation to improve the prevention and treatment of respiratory diseases.

Probiotic applications have seen recent advances, particularly involving K12, a predominant oral probiotic that commonly colonizes the upper respiratory tract [14]. K12 inhibits bacterial growth by producing antimicrobial peptides such as Salivarins and Bacteriocins [15], and it disrupts bacterial biofilm formation, thereby suppressing pathogens like Streptococcus pyogenes and Candida species [16]. Additionally, K12 modulates host immune responses, enhancing defense mechanisms [17]. Studies have shown that K12 probiotics can protect against SARS-CoV-2 by boosting immunity and regulating oral and pulmonary microbiomes [18]. Previous work from our group demonstrated that prophylactic administration of K12 probiotics reduces pulmonary inflammatory responses in Mp-infected mice, mitigates lung injury, and promotes airway remodeling in lung tissue [19]. Building on these promising prophylactic effects, this study further explores whether K12 probiotics attenuate Mp-induced host responses when administered after infection and investigates the underlying mechanisms.

In this study, we administered K12 probiotic orally to Mp-infected mice for 14 consecutive days. We monitored general behavior and health status, collected bronchoalveolar lavage fluid (BALF) to quantify Mp load and inflammatory cell counts, and assessed inflammatory and pathological changes in serum, BALF, and lung tissue. Finally, we performed 16S rRNA sequencing of BALF samples to analyze compositional and structural changes in the lower respiratory tract (LRT) microbiota. This study aims to evaluate the ability of K12 to attenuate Mp-induced responses in Mp-infected mice, providing experimental data and insights for further investigation into the pathogenic mechanisms of Mp and the development of targeted treatment strategies.

Materials and methods

Animals

Male BALB/c mice (4 ~ 6 weeks old, weighing 18 ~ 22 g) were purchased from Hunan SLAKE Jingda Laboratory Animal Co., Ltd. (Changsha, China) and housed in the Laboratory Animal Department of the University of South China (SCXK(Xiang)2020-0002). Mice were provided with standard maintenance feed and bedding and housed individually in specific pathogen-free (SPF) conditions with ad libitum access to water. They were maintained on a 12-hour light/dark cycle in a temperature- and humidity-controlled environment with proper ventilation. After a one-week acclimation period, experiments commenced. All animal procedures complied with the Chinese Guidelines for the Care and Use of Laboratory Animals and were performed by the Animal Ethics Committee of the University of South China (Approval No. USC202201XS78, Hengyang, China). Euthanasia was performed via cervical dislocation under isoflurane anesthesia to minimize distress and ensure humane handling. Efforts were made to reduce animal suffering and the number of mice used, following the 3Rs principles (Replacement, Reduction, and Refinement).

Materials and reagents

Medication

K12 probiotic tablets (NOW Foods, USA) each containing 10⁹ CFU were used. The mouse dosage was calculated based on body surface area conversion between humans and animals, as described in pharmacological experimental methods [20]. The body surface area index for a 20 g mouse is 0.0026 relative to an adult. Each 52 mg tablet was ground into powder. Given a standard adult dose of one tablet per day, the daily mouse dose was determined as 6.76 mg/kg. Mice received 40 times the human dosage, equivalent to 5.95 mg of probiotic powder daily. After each weighing, the compound was dissolved in 100 µL of PBS and administered orally to mice via oral gavage once daily. Following administration, access to food and water was restored after 30 min [21].

Strain

Mycoplasma pneumoniae strain M129 (ATCC 29342) was obtained from the Pathogenic Microorganism Laboratory at Hengyang Medical College, University of South China, where it was preserved and generously provided for this study.

Method of Mp infection

Mp was passaged and cultured in PPLO broth at a 1:10 dilution. After 3–4 days, when the medium turned orange-yellow, the Mp pellet was collected, centrifuged at 12,000 rpm/min for 5 min at 4 °C, and the supernatant was discarded. The pellet was washed once with PBS and then thoroughly mixed by pipetting with a sterile 27-gauge needle to prepare an Mp suspension. The Mp DNA concentration was determined based on previous studies from the research group. To ensure effective infection in mice, the Mp infection concentration was fixed at (1–9) × 10⁶ copies/µL, and infection was performed immediately after concentration. Each mouse was infected once via intranasal instillation under isoflurane anesthesia at a dose of 10⁷ copies of Mp DNA per mouse [22].

Reagents

PPLO powder (BD, USA), fetal bovine serum (ExCell, Shanghai, China), DNA extraction kit (Vazyme, Nanjing), ELISA kits for serum secretory immunoglobulin A (sIgA) (Huamei, Wuhan), TNF-α, and IL-6 (Xinbosheng, China), RNA-easy isolation reagent (Vazyme, Nanjing), Reverse transcription kit and SYBR Green quantitative PCR kit (TIANGEN, Beijing).

K12 probiotic treatment groups for the Mp infection model

Twenty-four mice were randomly assigned to three groups: normal control (Control), Mp + PBS, and Mp+K12, with eight mice per group. For the analysis of pulmonary microbiota in BALF, five mice were initially selected from each group. Due to issues such as undetectable results or outliers in some samples, we ultimately included three mice per group for the final lung microbiota analysis. Based on our previous findings that K12 has minimal impact on TNF-α and IL-6 mRNA expression after 14 days, mice in the Mp+K12 group received a 40-fold concentrated K12 probiotics daily for 14 consecutive days, starting on the day of Mp infection [19]. Mice were euthanized on day 15 post-infection for analysis. To assess the attenuating effects of K12, K12 administration was maintained throughout the infection period.

BALF cell counts

Mice were anesthetized with isoflurane and euthanized by cervical dislocation. The animals were then secured on a dissection board within a biosafety cabinet. The neck was incised with ophthalmic scissors to expose the trachea. A lavage device was assembled using an indwelling catheter and a gastric tube, and the trachea was secured to the device. BALF was performed by injecting 0.6 mL of pre-chilled PBS into the trachea using a 1.0 mL syringe, followed by gentle aspiration. The lavage was repeated twice, collecting the fluid into purple blood count tubes. The collected BALF was then subjected to cell counting.

ELISA detection of TNF-α and IL-6

Mouse serum was analyzed. Samples were processed according to the ELISA kit instructions. A standard curve was generated using eight concentration gradients. Then, 100 µL of each sample was added to the wells without air bubbles. After gentle mixing and sealing, plates were incubated at 37 °C for 2 h. Liquid was discarded, and 100 µL of biotin-labeled antibody working solution was added. After re-sealing and incubating at 37 °C for 1 h, plates were washed three times. Next, 100 µL of HRP-labeled streptavidin working solution was added, and plates were incubated at 37 °C for another hour. After five washes, 90 µL of substrate solution was added, and plates were incubated at 37 °C in the dark for 20 min. The reaction was stopped with 50 µL of stop solution, and absorbance at 450 nm was measured. Levels of sIgA, TNF-α, and IL-6 in serum were quantified accordingly. The standard curve was generated using the specialized ELISA software “Curve Expert” following the software prompts. Based on the optical density (OD) values of the samples, the corresponding concentrations were determined directly from the standard curve. Alternatively, the regression equation of the standard curve was calculated using the concentrations and OD values of the standards, and the sample concentrations were then calculated by substituting the sample OD values into this equation.

RT-qPCR detection

For each 20 mg of lung tissue, 500 µL of RNA-easy isolation reagent was added. After PBS washes, the tissue was homogenized on ice for RNA extraction. RNA concentration was measured, and reverse transcription was performed to obtain complementary DNA (cDNA). Cyclophilin was used as the internal reference for P1 protein and CARDS toxin mRNA detection, while GAPDH served as the reference for cytokines. Transcription levels of target genes were calculated using the 2−ΔΔCT method, normalized to the control groups. The qRT-PCR reaction was performed with the following conditions: pre-denaturation at 95℃ for 15 min, followed by 40 cycles of denaturation at 95℃ for 10 s and annealing/extension at 60℃ for 30 s. The melting curve was generated automatically using the ABI 7500 instrument program. Primers and probes for Mp DNA were synthesized by GenScript (Nanjing), while primers for other genes were synthesized by Shanghai Sangon Biotech (Table 1).

Table 1.

Primer Sequences

Primer name Primer sequence 5’-3’
P1 [23] F: CGCCGCAAAGATGAATGAC
R: TGTCCTTCCCCATCTAACAGTTC
CARDS F: TTCCACTTCAGAAACACCCACAGC
R: TCAATCAGGGCACGCAAACG
Cyclophilin [23] F: AGCACTGGAGAGAAAGGATTTGG
R: TCTTCTTGCTGGTCTTGCCATT
MUC5ACa F: ACGACACTTTTCAGTACCAATGAC
R: GCTTCCTTACAGATGCAGTCCT
MMP9 F: CGGATTTGGCCGTATTGGGC
R: TGATGGCATGCACTGTGGTC
TNF-α F: CCACCACGCTCTTCTGTCTAC
R: TGGGCTACAGGCTTGTCACT
IL-6 F: TTCACAAGTCGGAGGCTTA
R: CAAGTGCATCATCGTTGTTC
CXCL1 F: TGGCTGGGATTCACCTCAAG
R: CAAGCCTCGCGACCATTCTT
TLR-2 [24] F: GCCACCATTTCCACGGACT
R: GGCTTCCTCTTGGCCTGG
TLR-4 [24] F: TTTATTCAGAGCCGTTGGTG
R: CAGAGGATTGTCCTCCCATT
Col3A1 [23] F: GCCCACAGCCTTCTACAC
R: CCAGGGTCACCATTTCTC
GAPDH F: AGGTCGGTGTGAACGGATTTG
R: TGTAGACCATGTAGTTGAGGTCA

F Forward primer, R Reverse primer

H&E staining and AB/PAS staining

After euthanizing, the right lung was removed and fixed in 4% paraformaldehyde (fixative) at 4 °C. The fixed tissue was then sent to Changsha Viser Biotechnology Co., Ltd. for paraffin embedding, sectioning, and subsequent assessment of pulmonary inflammation [24].

Alcian blue/periodic acid–Schiff (AB/PAS) staining was performed on lung tissue sections following hematoxylin and eosin (H&E) staining. This combined Alcian blue and PAS staining method was used to differentiate and quantify neutral (magenta) and acidic (dark blue) mucins. Cells containing both neutral and acidic mucins appeared purple. Images of the stained tissue were captured using a standard light microscope at 10× and 20× magnifications. The stained slides were scored by blinded evaluators on a 15-point scale [24]. The intensity of magenta, dark blue, and purple staining was quantified using separate1-5 scales, with the total score ranging from 0 to 15.

16S rRNA sequencing analysis

Total DNA extraction for the pulmonary microbiota in all samples was performed by Shanghai Sangon Biotech Co., Ltd. using the OMEGA Qubit 3.0 DNA Detection Kit. PCR amplification targeting the 16S rRNA V3-V4 region was carried out with universal primers to enrich the specific sequence. Sequencing libraries were prepared using Illumina kits, and library concentration was measured using a Qubit 3.0 Fluorometer. The raw sequencing data were generated through machine sequencing. The raw sequencing data underwent quality control, filtering, and de-chimerization to obtain valid data for further analysis. Differences in microbial community structure and diversity indices were assessed using the Sangon BioCloud platform. Microbial 16S rRNA amplicon sequencing was performed on three animals per group.

Statistical analysis

All data in this experiment were statistically analyzed using GraphPad Prism 9.0 software. Continuous variables are expressed as mean ± standard deviation (SD). For comparisons between two groups, an unpaired two-tailed Student’s t-test was applied for data that followed a normal distribution. Comparisons among multiple groups were performed by one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test. A p < 0.05 was considered statistically significant, not significant at p > 0.05.

Results

Detection of Mp load and H&E staining of lung tissue after probiotic K12 treatment

To evaluate the attenuating effects of K12, oral administration began immediately after Mp infection and continued for 14 days. On day 1 post-infection, mice exhibited tachypnea; by day 2, they showed huddling, piloerection, and irritability. No fatalities occurred among the Mp-infected mice. Mp DNA was detected in BALF and lung tissue on the treatment day, confirming successful infection. After 14 days, no significant differences were observed in the levels of P1 protein or CARDS toxin mRNA among groups (Fig. 1a-c). H&E staining of lung tissue showed no discernible histopathological differences or inflammatory infiltration (Fig. 1d–e). These findings suggest that K12 does not alter pathogen-associated signals or gross histopathology, indicating a mechanism centered on immunomodulation rather than pathogen clearance.

Fig. 1.

Fig. 1

Experimental Diagram Illustrating the Attenuating Effects of K12 in Mp-infected Mice. a Experimental timeline of oral K12 administration in the Mp-infected model. b–c qRT-PCR analysis of Mp P1 protein and CARDS toxin mRNA expression in lung tissue. d–e Representative H&E–stained histopathological changes and pathological scoring of lung tissue (magnification [×100/×400]; scale bar [25/100] µm). Symbols: p < 0.05 versus Control (*); #p < 0.05 versus Mp model (#); ns, not significant. Sample size per group, n = 3

Assessment of inflammatory changes following probiotic K12 treatment

We next characterized the immunomodulatory activity of K12 by assessing inflammatory indices in BALF, serum, and lung tissue. Total white blood cell count in BALF was significantly lower in the Mp+K12 group than in the Mp + PBS group (Table 2), indicating attenuation of airway cellular inflammation. Consistent with enhanced mucosal defense, serum sIgA levels were markedly elevated in the Mp+K12 group compared to both the Mp + PBS group and the control group (Fig. 2a). Serum TNF-α and IL-6 levels were significantly reduced in the Mp+K12 group (Fig. 2b–c, p < 0.05). At the pulmonary transcriptional level, TNF-α mRNA expression in lung tissue was also significantly decreased (Fig. 2e, p < 0.01), while CXCL1 and IL-6 mRNA showed decreasing trends (Fig. 2d, f). Notably, K12 treatment significantly upregulated lung TLR2 mRNA, while TLR4 expression remained unchanged (Fig. 2g–h). Collectively, K12 attenuated Mp-induced airway inflammation and enhanced mucosal immunity, supporting an immunomodulatory mode of action.

Table 2.

White blood cell counts in Mp-infected mice treated with K12

WBC 106/L MN#106/L PMN#106/L MN% PMN%
Control 57.40 ± 23.90 54.00 ± 22.60 3.40 ± 1.94 94.00 ± 2.25 6.00 ± 2.25
Mp + PBS 141.80 ± 31.28** 133.60 ± 29.31** 8.20 ± 3.83 94.34 ± 2.40 5.66 ± 2.40
Mp+K12 102.20 ± 49.98 89.40 ± 38.61 12.80 ± 19.17 90.12 ± 10.73 9.88 ± 10.73

WBC white blood cells, MN mononuclear cells, PMN polymorphonuclear cells

**p < 0.01 (Mp+PBS vs. Control). n = 5

Fig. 2.

Fig. 2

Effects of K12 treatment on serum and pulmonary inflammatory responses in Mp-infected mice. a–c Serum levels of sIgA, TNF-α, and IL-6. d–f qRT-PCR analysis of CXCL1, TNF-α, and IL-6 mRNA expression in lung tissue. g–h qRT-PCR analysis of TLR2 and TLR4 mRNA expression in lung tissue. Symbols: **p < 0.01, ****p < 0.0001 versus Control (*); #p < 0.05, ##p < 0.01, ###p < 0.001 versus Mp + PBS model (#); ns, not significant. Sample size per group, n = 3

Analysis of MMP9, MUC5ac, and Col3A1 mRNA levels and AB/PAS staining in lung tissue

To assess whether K12 modifies airway remodeling post-Mp infection, we quantified lung mRNA levels of remodeling-associated factors and evaluated mucus production via AB/PAS staining. MMP9 mRNA did not differ significantly between Mp + PBS and Mp+K12 groups (Fig. 3a). Relative to the control group, Col3A1 mRNA was reduced in both Mp + PBS and Mp+K12 groups, but its expression was higher in the Mp+K12 group than in the Mp + PBS group (Fig. 3c). MUC5AC mRNA was significantly elevated in Mp+K12 compared to Mp + PBS (Fig. 3b; p < 0.05). AB/PAS staining revealed increased mucus secretion in Mp + PBS and Mp+K12 groups versus the Control. Although the AB/PAS score was numerically lower in Mp+K12 than in Mp + PBS, the difference was not statistically significant (Fig. 3d–e). These data indicate that K12 only partially mitigates Mp-induced airway remodeling in this model.

Fig. 3.

Fig. 3

Transcriptional levels of airway-remodeling factors and AB/PAS staining in lung tissue of Mp-infected mice. a–c qRT-PCR analysis of MMP9, MUC5AC, and Col3A1 mRNA expression in lung tissue. d Representative AB/PAS-stained lung sections. e Quantitative scoring of AB/PAS staining. Symbols: *p < 0.05, ***p < 0.001 versus Control (*); #p < 0.05 versus Mp + PBS group model (#); ns, not significant. Sample size per group, n = 3

Analysis of lung microbiota species richness and diversity

We performed 16S rRNA gene sequencing on BALF samples to determine whether K12 restores lung microbiota homeostasis after Mp infection. Alpha diversity, measured by the Shannon index, showed no significant differences in species richness among groups. However, Mp infection significantly reduced Shannon diversity compared to the control group (p < 0.05). This reduction was partially reversed in Mp+K12 treated mice, in which diversity indices trended toward restoration to baseline levels (Fig. 4a–b). Principal coordinates analysis (PCoA) of beta diversity revealed partial overlap in microbial community structure across groups, indicating moderate separation after infection and treatment (Fig. 4c). No significant differences in microbial composition were detected across phylogenetic levels from phylum to species (Fig. 4d–e). At the phylum level, the microbiota was dominated by Proteobacteria, Bacteroidota, and Firmicutes. Notably, Mp infection increased the relative abundance of Proteobacteria (74.36% in Mp + PBS vs. 62.38% in Control) and decreased the relative abundance of Bacteroidota (23.81% in Mp + PBS vs. 34.28% in Control). K12 treatment shifted these proportions toward control levels (Proteobacteria: 62.74%; Bacteroidota: 34.30%), while Firmicutes remained low across all infected groups. Correlation analysis further revealed a gradual shift in microbial community structure toward that of healthy controls following K12 treatment (Fig. 4f–g). These findings indicate that K12 partially attenuates Mp-induced dysbiosis by promoting a microbiota composition closer to that of uninfected controls.

Fig. 4.

Fig. 4

Changes in the pulmonary microbiota after K12 treatment in Mp-infected mice. a Shannon diversity index of BALF microbiota in each group. b Intergroup comparison of Shannon diversity indices. c Partial least squares discriminant analysis(PLS-DA) of BALF microbiota. d-e Relative abundances of BALF microbiota at the phylum and genus levels. f Heatmap displaying the correlation matris of samples from the Control, Mp+PBS, and Mp+K12 groups. g Statistical relevance of sample correlation. *p < 0.05. Sample size per group, n = 3

Discussion

Mp, a common cause of atypical pneumonia, adheres to the respiratory epithelium and releases virulence factors that trigger pulmonary inflammation. The P1 adhesin and CARDS toxin are key pathogenic proteins that reflect the Mp load and drive disease progression [25]. K12, an oral commensal with probiotic properties, inhibits respiratory pathogen colonization, promotes microbial homeostasis, and enhances host defenses via competitive exclusion, antimicrobial peptide production, and immunomodulation [26]. Building on our previous evidence that K12 effectively attenuates pulmonary inflammation, reduces lung injury, and improves airway remodeling in Mp-infected mice, we hypothesized that K12 might alleviate Mp infection by modulating the pulmonary microbiota. We established an Mp-infected mouse model and administered K12 orally for 14 consecutive days. Results showed no significant differences in Mp DNA load, P1/CARDS toxin levels, or lung histopathological changes among the groups after treatment. This indicates that K12 does not directly inhibit Mp growth or replication. Instead, the absence of observable differences in bacterial load or tissue pathology may be attributed to the effective immunomodulation of K12 over the treatment period. Alternatively, the prolonged duration of infection may have activated natural self-repair mechanisms in the host, potentially masking the specific interventional effects of the K12 probiotic.

Previous studies confirm that K12 ingestion induces systemic immune responses [27]. We found a significant increase in sIgA in the Mp+K12 group, indicating enhanced mucosal immune defense, consistent with established reports. K12 also reduced total WBC counts in BALF and significantly decreased serum TNF-α and IL-6 levels. Correspondingly, TNF-α and IL-6 mRNA expression in lung tissue was substantially downregulated. These results suggest that the K12 effectively suppresses the secretion of systemic inflammatory factors and ameliorates inflammatory responses in Mp-infected mice. Elevated TNF-α levels are frequently observed after Mp infection, promoting airway hyperresponsiveness and neutrophil-driven inflammation, a pattern consistent with the reduced BALF leukocyte counts after K12 treatment [28]. In line with this, a study on M. hyopneumoniae in pigs demonstrated that apigenin achieved therapeutic benefit by suppressing TNF-α mRNA via DNA methylation modulation at the TNF-α promoter [29]. These data highlight TNF-α as a key mediator in our Mp model and suggest that K12 ameliorates inflammation through direct or indirect regulation of TNF-α expression.

Pulmonary airway remodeling is a critical reparative process post-lung injury. MMP9, MUC5AC, and Col3A1 are key readouts of this process. In MPP, MMP9 can promote neutrophil recruitment and amplify neutrophil effector activity. At the same time, by degrading collagen and other extracellular matrix components, MMP9 contributes to post-inflammatory matrix turnover and airway and lung tissue remodeling [30, 31]. Mp infection upregulates MUC5AC expression in bronchial epithelial cells, promoting mucin production and contributing to the mucus hypersecretory response characteristic of respiratory tract infection [32]. Moreover, Col3A1 is widely used as a representative ECM component associated with tissue repair and remodeling programs, including in airway remodeling contexts [33]. A functional mucus barrier is essential for effective clearance of pathogens and irritants under physiological conditions. Given the central role of airway remodeling in post-injury repair, we profiled remodeling markers and the mucus barrier in Mp-infected mice with or without K12. We observed reduced TNF-α and IL-6 mRNA and a lower AB/PAS mucus score in the Mp+K12 group compared with Mp + PBS, indicating attenuation of inflammatory burden and mucus accumulation. In this context, the higher MMP9/MUC5ac/Col3A1 transcript levels in Mp+K12 mice are most consistent with a shift toward a regulated barrier/repair remodeling program (matrix turnover, epithelial restitution-associated transcription, and ECM remodeling) rather than exacerbated inflammation or mucus obstruction, which is supported by the concomitant decreases in TNF-α/IL-6 and AB/PAS scores. Nonetheless, because these assessments were performed at a single late time point, future longitudinal analyses integrating mucin protein localization (e.g., MUC5AC immunostaining) and collagen deposition/remodeling markers will be needed to define whether these changes represent restitution, compensation, or delayed pathology.

K12 has been shown to reshape the oral microbiota and alleviate radiation-induced oral mucositis in mice [21], with recent clinical data confirming similar mitigation in head-and-neck cancer patients receiving radiotherapy [34]. Importantly, K12 exerts no disruptive effects on the normal microbiome of young children [35]. In line with these probiotic benefits, other strains such as Lacticaseibacillus casei T1 have been reported to attenuate Helicobacter pylori induced gastric inflammation and gut microbiota dysbiosis in mice [36]. Motivated by these findings, we performed 16S rRNA sequencing of BALF to test whether K12 modulates the lung microbiome during Mp infection. Although overall microbial diversity did not differ significantly among groups, at the phylum level, the community structure in Mp+K12 mice more closely resembled that of uninfected controls. Specifically, K12 administration shifted the relative abundances of Proteobacteria and Bacteroidota toward the community structure observed in the control group, suggesting that K12 may partially reverse Mp-induced alterations in the lung microbiome. While the exact mechanisms remain to be fully elucidated, growing evidence supports the existence of the gut-lung axis, where the gut microbiota influences pulmonary immunity and microbial composition. Oral probiotics can modulate systemic immunity through interactions with gut-associated lymphoid tissue, facilitating the migration of immune cells and cytokines from the gut to the respiratory tract via circulation [37]. Studies have shown that a dietary gut supplement containing Lacticaseibacillus paracasei MCC1849 confers protective effects against influenza virus infection, which may be associated with increased proportions of IgA⁺ B cells and follicular helper T (Tfh) cells in Peyer’s patches, along with a marked elevation in pulmonary IgA secretion [38]. These changes may help promote a shift toward a more favorable environment for beneficial microorganisms. Although our study shows that oral K12 alleviates airway inflammation and partially restores the lung microbiota in Mp-infected mice, certain limitations deserve mention. The lack of longitudinal sampling prevented evaluation of temporal changes in microbial composition and inflammatory responses, as well as the persistence of K12’s effects. We observed an increase in TLR2 mRNA levels in lung tissue following K12 treatment; however, this finding is currently associative and does not support a causal inference. Because we did not perform functional perturbation studies in Mp–infected cell and animal models, such as TLR2 knockdown or overexpression, to determine whether K12’s effects are altered, we cannot conclude that TLR2 is a key mechanistic mediator of K12-driven immunomodulation. We also did not investigate whether shifts in the pulmonary microbiota correlate with gut microbiome changes, a factor increasingly linked to lung health. Future work incorporating time-series profiling, parallel inflammatory readouts, and integrative gut-lung analyses will clarify the durability, mechanisms, and systemic context of K12-mediated microbiome modulation during Mp infection.

Conclusion

This study suggests that K12 acts as an effective probiotic against Mp infection through coordinated mechanisms involving barrier protection, immune regulation, and microbial modulation. In mouse models, the beneficial effects of K12 primarily stem from its immunomodulatory activity rather than direct bactericidal effects, effectively mitigating pulmonary inflammation and shifting the lung microbiota toward a more balanced composition. Future research should establish dose-response relationships, optimize the timing of intervention, and integrate multi-omics analyses with controlled functional microbiota studies to further elucidate the mechanistic basis of K12 action. These efforts will provide new insights into Mp pathogenesis and support novel therapeutic strategies.

Acknowledgements

Not applicable.

Clinical trial number

Not applicable.

Authors’ contributions

Xiaoling Su and Yuan Li contributed equally as co–first authors. They jointly conceived and designed the study, led the animal experiments/sample collection and data analysis, and drafted the initial manuscript. Ying Huang and Haodang Luo optimized methodologies, performed experiments, curated data, and assisted with figure preparation/visualization. Chao Li and Xinchao Yi conducted bioinformatics/statistical analyses and contributed to result verification and manuscript revision. Ling Wu and Jun He served as co–corresponding authors, providing overall supervision, project administration, and funding acquisition; they guided the study framework and key technical decisions, and oversaw critical revisions and final approval of the manuscript. All authors read and approved the final version and accept responsibility for the work.

Funding

This work was supported by the Natural Science Foundation of Hunan Province (2024JJ7459), the Hunan Provincial Health High Level Talent Support Project (20240304128), the Hunan Provincial Health Commission Key Research Project (20255728).

Data availability

The datasets supporting the conclusions of this article are available in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) repository, BioProject ID PRJNA1372914 (https://www.ncbi.nlm.nih.gov/search/all/?term=PRJNA1372914).

Declarations

Ethics approval and consent to participate

All animal procedures complied with the Chinese Guidelines for the Care and Use of Laboratory Animals and were performed by the Animal Ethics Committee of University of South China (Approval No. USC202201XS78, Hengyang, China).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xiaoling Su and Yuan Li contributed equally to this work and are co-first authors.

Contributor Information

Ning Wu, Email: rencaoer@163.com.

Jun He, Email: junhe@usc.edu.cn.

References

  • 1.Jiang Z, Li S, Zhu C, Zhou R, Leung PHM. Mycoplasma pneumoniae Infections: Pathogenesis and Vaccine Development. Pathogens. 2021;10:119. 10.3390/pathogens10020119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Waites KB, Xiao L, Liu Y, Balish MF, Atkinson TP. Mycoplasma pneumoniae from the Respiratory Tract and Beyond. Clin Microbiol Rev. 2017;30:747–809. 10.1128/CMR.00114-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bajantri B, Venkatram S, Diaz-Fuentes G. Mycoplasma pneumoniae: A Potentially Severe Infection. J Clin Med Res. 2018;10:535–44. 10.14740/jocmr3421w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zhang Z, Wan R, Yuan Q, Dou H, Tu P, Shi D, et al. Cell damage and neutrophils promote the infection of Mycoplasma pneumoniae and inflammatory response. Microb Pathog. 2022;169:105647. 10.1016/j.micpath.2022.105647. [DOI] [PubMed] [Google Scholar]
  • 5.Meyer Sauteur PM, Beeton ML, European Society of Clinical Microbiology and Infectious Diseases (ESCMID). Study Group for Mycoplasma and Chlamydia Infections (ESGMAC), and the ESGMAC Mycoplasma pneumoniae Surveillance (MAPS) study group. Mycoplasma pneumoniae: delayed re-emergence after COVID-19 pandemic restrictions. Lancet Microbe. 2024;5:e100–1. 10.1016/S2666-5247(23)00344-0. [DOI] [PubMed] [Google Scholar]
  • 6.Tamiya S, Yoshikawa E, Ogura M, Kuroda E, Suzuki K, Yoshioka Y. Vaccination using inactivated Mycoplasma pneumoniae induces detrimental infiltration of neutrophils after subsequent infection in mice. Vaccine. 2020;38:4979–87. 10.1016/j.vaccine.2020.05.074. [DOI] [PubMed] [Google Scholar]
  • 7.Chen Y, Zhang Y, Tang Q-N, Shi H-B. Efficacy of doxycycline therapy for macrolide-resistant Mycoplasma pneumoniae pneumonia in children at different periods. Ital J Pediatr. 2024;50:38. 10.1186/s13052-024-01615-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen Z, Shao X, Dou X, Zhang X, Wang Y, Zhu C, et al. Role of the Mycoplasma pneumoniae/Interleukin-8/Neutrophil Axis in the Pathogenesis of Pneumonia. PLoS ONE. 2016;11:e0146377. 10.1371/journal.pone.0146377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hao Y, Kuang Z, Jing J, Miao J, Mei LY, Lee RJ, et al. Mycoplasma pneumoniae modulates STAT3-STAT6/EGFR-FOXA2 signaling to induce overexpression of airway mucins. Infect Immun. 2014;82:5246–55. 10.1128/IAI.01989-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fan Y, Moser J, Jongman RM, Borghuis T, Vonk JM, Timens W, et al. Compositional changes of the lung extracellular matrix in acute respiratory distress syndrome. Am J Physiol Cell Physiol. 2025;328:C1279–92. 10.1152/ajpcell.01007.2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liao W-C, Li S-W, Hsing E-W, Hsiao S-H, Chang IY-F, Chen Y-C, et al. Respiratory microbiome and metabolome features associate disease severity and the need for doxycycline treatment in children with macrolide-resistant Mycoplasma pneumoniae-mediated pneumonia. Front Cell Infect Microbiol. 2025;15:1537182. 10.3389/fcimb.2025.1537182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jiang X, Zhang S. Respiratory microbiota, host immunity, respiratory viral infections and malignant tumors. Front Microbiol. 2025;16:1626077. 10.3389/fmicb.2025.1626077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wang Y, Yu X, Liu F, Tian X, Quan S, Jiao A, et al. Respiratory microbiota imbalance in children with Mycoplasma pneumoniae pneumonia. Emerg Microbes Infect. 2023;12:2202272. 10.1080/22221751.2023.2202272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Peng X, Li Z, Pei Y, Zheng S, Liu J, Wang J, et al. Streptococcus salivarius K12 Alleviates Oral Mucositis in Patients Undergoing Radiotherapy for Malignant Head and Neck Tumors: A Randomized Controlled Trial. J Clin Oncol. 2024;42:1426–35. 10.1200/JCO.23.00837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Di Pierro F, Colombo M, Zanvit A, Risso P, Rottoli AS. Use of Streptococcus salivarius K12 in the prevention of streptococcal and viral pharyngotonsillitis in children. Drug Healthc Patient Saf. 2014;6:15–20. 10.2147/DHPS.S59665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mokhtar M, Rismayuddin NAR, Mat Yassim AS, Ahmad H, Abdul Wahab R, Dashper S, et al. Streptococcus salivarius K12 inhibits Candida albicans aggregation, biofilm formation and dimorphism. Biofouling. 2021;37:767–76. 10.1080/08927014.2021.1967334. [DOI] [PubMed] [Google Scholar]
  • 17.Kim H-J, Yoo H-J. Inhibitory effects of Streptococcus salivarius K12 on formation of cariogenic biofilm. J Dent Sci. 2023;18:65–72. 10.1016/j.jds.2022.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Di Pierro F, Iqtadar S, Mumtaz SU, Bertuccioli A, Recchia M, Zerbinati N, et al. Clinical Effects of Streptococcus salivarius K12 in Hospitalized COVID-19 Patients: Results of a Preliminary Study. Microorganisms. 2022;10:1926. 10.3390/microorganisms10101926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Su X, Liao D, Li C, Chen L, Wang J, Gan T, et al. [Protective effect of Streptococcus salivarius K12 against Mycoplasma pneumoniae infection in mice]. Nan Fang Yi Ke Da Xue Xue Bao. 2024;44:2300–7. 10.12122/j.issn.1673-4254.2024.12.05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Reagan-Shaw S, Nihal M, Ahmad N. Dose translation from animal to human studies revisited. FASEB J. 2008;22:659–61. 10.1096/fj.07-9574LSF. [DOI] [PubMed] [Google Scholar]
  • 21.Wang Y, Li J, Zhang H, Zheng X, Wang J, Jia X, et al. Probiotic Streptococcus salivarius K12 Alleviates Radiation-Induced Oral Mucositis in Mice. Front Immunol. 2021;12:684824. 10.3389/fimmu.2021.684824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Johnson MDL, Younis US, Menghani SV, Addison KJ, Whalen M, Pilon AL, et al. CC16 Binding to α4β1 Integrin Protects against Mycoplasma pneumoniae Infection. Am J Respir Crit Care Med. 2021;203:1410–8. 10.1164/rccm.202006-2576OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Iannuzo N, Insel M, Marshall C, Pederson WP, Addison KJ, Polverino F, et al. CC16 Deficiency in the Context of Early-Life Mycoplasma pneumoniae Infection Results in Augmented Airway Responses in Adult Mice. Infect Immun. 2022;90:e0054821. 10.1128/IAI.00548-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Daniel S, Phillippi D, Schneider LJ, Nguyen KN, Mirpuri J, Lund AK. Exposure to diesel exhaust particles results in altered lung microbial profiles, associated with increased reactive oxygen species/reactive nitrogen species and inflammation, in C57Bl/6 wildtype mice on a high-fat diet. Part Fibre Toxicol. 2021;18:3. 10.1186/s12989-020-00393-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang T, Sun H, Lu Z, Jiang W, Dai G, Huang L, et al. The CARDS toxin of Mycoplasma pneumoniae induces a positive feedback loop of type 1 immune response. Front Immunol. 2022;13:1054788. 10.3389/fimmu.2022.1054788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li Y, Shao F, Zheng S, Tan Z, He Y. Alteration of Streptococcus salivarius in Buccal Mucosa of Oral Lichen Planus and Controlled Clinical Trial in OLP Treatment. Probiotics Antimicrob Proteins. 2020;12:1340–8. 10.1007/s12602-020-09664-5. [DOI] [PubMed] [Google Scholar]
  • 27.Laws GL, Hale JDF, Kemp RA. Human Systemic Immune Response to Ingestion of the Oral Probiotic Streptococcus salivarius BLIS K12. Probiotics Antimicrob Proteins. 2021;13:1521–9. 10.1007/s12602-021-09822-3. [DOI] [PubMed] [Google Scholar]
  • 28.Tamiya S, Yoshikawa E, Ogura M, Kuroda E, Suzuki K, Yoshioka Y. Neutrophil-Mediated Lung Injury Both via TLR2-Dependent Production of IL-1α and IL-12 p40, and TLR2-Independent CARDS Toxin after Mycoplasma pneumoniae Infection in Mice. Microbiol Spectr. 2021;9:e0158821. 10.1128/spectrum.01588-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chen M, Deng H, Zhao Y, Miao X, Gu H, Bi Y, et al. Toll-Like Receptor 2 Modulates Pulmonary Inflammation and TNF-α Release Mediated by Mycoplasma pneumoniae. Front Cell Infect Microbiol. 2022;12:824027. 10.3389/fcimb.2022.824027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chen Z, Shao X, Dou X, Zhang X, Wang Y, Zhu C, et al. Role of the Mycoplasma pneumoniae/Interleukin-8/Neutrophil Axis in the Pathogenesis of Pneumonia. PLoS ONE. 2016;11:e0146377. 10.1371/journal.pone.0146377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Atkinson JJ, Senior RM. Matrix metalloproteinase-9 in lung remodeling. Am J Respir Cell Mol Biol. 2003;28:12–24. 10.1165/rcmb.2002-0166TR. [DOI] [PubMed] [Google Scholar]
  • 32.Hao Y, Kuang Z, Jing J, Miao J, Mei LY, Lee RJ, et al. Mycoplasma pneumoniae modulates STAT3-STAT6/EGFR-FOXA2 signaling to induce overexpression of airway mucins. Infect Immun. 2014;82:5246–55. 10.1128/IAI.01989-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Fan Y, Moser J, Jongman RM, Borghuis T, Vonk JM, Timens W, et al. Compositional changes of the lung extracellular matrix in acute respiratory distress syndrome. Am J Physiol Cell Physiol. 2025;328:C1279–92. 10.1152/ajpcell.01007.2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Peng X, Li Z, Pei Y, Zheng S, Liu J, Wang J, et al. Streptococcus salivarius K12 Alleviates Oral Mucositis in Patients Undergoing Radiotherapy for Malignant Head and Neck Tumors: A Randomized Controlled Trial. J Clin Oncol. 2024;42:1426–35. 10.1200/JCO.23.00837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sarlin S, Tejesvi MV, Turunen J, Vänni P, Pokka T, Renko M, et al. Impact of Streptococcus salivarius K12 on Nasopharyngeal and Saliva Microbiome: A Randomized Controlled Trial. Pediatr Infect Dis J. 2021;40:394–402. 10.1097/INF.0000000000003016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Liang X, He Q, Xu C, Ali M, Gu L, Safdar M, et al. Ligilactobacillus salivarius alleviated intestinal damage induced by Salmonella in mice via regulating microbiota. BMC Microbiol. 2025;25:586. 10.1186/s12866-025-04277-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Du T, Lei A, Zhang N, Zhu C. The Beneficial Role of Probiotic Lactobacillus in Respiratory Diseases. Front Immunol. 2022;13:908010. 10.3389/fimmu.2022.908010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Arai S, Iwabuchi N, Takahashi S, Xiao J-Z, Abe F, Hachimura S. Orally administered heat-killed Lactobacillus paracasei MCC1849 enhances antigen-specific IgA secretion and induces follicular helper T cells in mice. PLoS ONE. 2018;13:e0199018. 10.1371/journal.pone.0199018. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets supporting the conclusions of this article are available in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) repository, BioProject ID PRJNA1372914 (https://www.ncbi.nlm.nih.gov/search/all/?term=PRJNA1372914).


Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES