USP19 alleviates LPS-induced acute lung injury via inhibiting TAK1 activation

Abstract

Acute lung injury (ALI) is a clinically prevalent condition characterized by excessive inflammatory activation leading to tissue damage, with high mortality rates. USP19, a deubiquitinase (DUB) known to play critical roles in skeletal muscle atrophy, antiviral responses, and stabilization of transmembrane endoplasmic reticulum-associated degradation (ERAD) substrates, has not been previously investigated in ALI pathogenesis. In this study, we established both in vivo (lipopolysaccharide (LPS)-challenged C57BL/6j mice) and in vitro (LPS-stimulated HULEC-5a cells) to simulate acute lung injury (ALI), demonstrating significant downregulation of USP19 expression during ALI progression. Functional studies revealed that genetic ablation of USP19 in mice exacerbated LPS-induced acute lung injury, manifesting as enhanced pulmonary tissue damage, increased vascular permeability, amplified inflammatory responses, and elevated cellular apoptosis. In HULEC-5a cells, USP19 overexpression attenuated LPS-induced cellular damage, inflammatory activation and apoptosis, while USP19 knockdown exacerbated these effects. These findings were recapitulated in USP19-knockout mouse lung microvascular endothelial cells. Mechanistically, we identified that USP19 exerts its protective effects by suppressing TAK1 phosphorylation, thereby inhibiting activation of the downstream JNK/p38 signaling pathway. These findings not only elucidate USP19 as a novel negative regulator of ALI through modulation of the TAK1-JNK/p38 axis, but also provide potential therapeutic targets and conceptual advances for ALI treatment strategies.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13062-026-00753-z.

Introduction

Acute lung injury (ALI) is a life-threatening clinical condition characterized by diffuse pulmonary capillary damage, increased alveolar-capillary permeability, widespread pulmonary edema, and hyaline membrane formation. Its primary clinical manifestations include acute progressive dyspnea and refractory hypoxemia. When the condition progresses to a severe stage with a PaO₂/FiO₂ ratio < 200 mmHg, it is classified as acute respiratory distress syndrome (ARDS) [1, 2]. Epidemiological studies indicate that ARDS/ALI accounts for approximately 10% of all ICU admissions, with a mortality rate of around 40% [3, 4]. In the pathogenesis of acute lung injury (ALI) and acute respiratory distress syndrome (ARDS), injury and dysfunction of pulmonary microvascular endothelial cells are considered early and decisive events in disease onset and progression. Endothelial cells constitute the main structural component of the alveolar-capillary barrier, maintaining vascular permeability and the stability of gas exchange. Various pathogenic factors—including infection, toxins, and inflammatory mediators—can directly or indirectly damage endothelial cells, resulting in loss of barrier function, increased vascular permeability, protein leakage, and the development of pulmonary edema. These changes ultimately lead to hypoxemia and respiratory dysfunction [5–7].

ALI is triggered by diverse pathogenic factors, with bacterial infection being the most common etiology, particularly gram-negative bacterial endotoxins such as lipopolysaccharide (LPS) [8]. LPS primarily activates the innate immune response through toll-like receptor 4 (TLR4) signaling, subsequently triggering downstream nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways [9, 10]. The NF-κB and MAPK signaling cascades further induce the expression of pro-inflammatory genes, oxidative stress, and excessive mucus production, thereby exacerbating pulmonary inflammation and vascular permeability, ultimately leading to ALI [9, 11–13]. Activation of NF-κB initiates an inflammatory cascade through the production of pro-inflammatory cytokines, including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) [14]. The generated inflammatory factors further recruit immune cells to the lung tissue, leading to an excessive activation of the inflammatory response and causing extensive damage to the lung tissue. Additionally, inflammatory factors directly or indirectly induce cell apoptosis. The damage-related molecular patterns released during apoptosis further activate inflammatory cells, forming a vicious cycle that aggravates lung injury. Consequently, suppressing dysregulated inflammatory responses and apoptosis represents a critical therapeutic strategy for modulating ALI [1, 15–17].

Ubiquitin-specific protease 19 (USP19) is a 150-kDa enzyme belonging to the ubiquitin-specific protease family, which represents the largest subclass of deubiquitinating enzymes. USP19 contains a carboxyl-terminal region adjacent to its core catalytic domain, featuring characteristic cysteine and histidine box motifs. The flanking sequences surrounding these motifs mediate substrate specificity, protein-protein interactions, and subcellular localization [18]. USP19 participates in diverse cellular processes, including endoplasmic reticulum-associated degradation (ERAD), misfolded protein secretion, immune responses, cell growth, and adipogenesis [19–23]. USP19 has been found can promote the polarization of M2-like macrophages and inhibit inflammatory response by regulating the protein stability of NLRP3 [24]. Besides, USP19 could interact with TRIF and remove its K27-linked polyubiquitin moieties, thereby impairing the recruitment of TRIF to TLR3/4 and inhibiting innate immune responses [25]. Lei et al. also discovered that USP19 can inhibit the activation of TAK1 induced by TNF-α and IL-1β, thereby suppressing the activation of the NF-κB signaling pathway [26]. In terms of the regulation of cell apoptosis, the absence of USP19 was found to promote cell apoptosis by regulating the downstream signals of Survivin, thereby reducing tumor growth [27]. However, the specific function of USP19 in the pathogenesis of ALI has yet to be elucidated.

This study found that USP19 was downregulated in C57BL/6j mouse lung tissue and human lung microvascular endothelial cells stimulated by lipopolysaccharide (LPS). To further elucidate the regulatory role of USP19 in ALI pathogenesis, USP19 gene knockout mice and their littermate negative controls were using to establish an ALI model in vivo. We found that the USP19 deletion could promote LPS-induced lung tissue damage, inflammatory response and cell apoptosis. Consistently, knockdown of USP19 can promote endothelial cell damage, inflammatory activation and apoptosis caused by LPS stimulation in vitro, while USP19 overexpression exerts the opposite function. Mechanistically, USP19 inhibits ALI by suppressing TAK1 phosphorylation activation, thereby reducing the activation of the downstream JNK/p38 signaling axis. This discovery reveals USP19 as a new potential therapeutic target for treating ALI.

Materials and methods

Experimental animals

Male C57BL/6 mice (8–10 weeks old, 26–28 g body weight), USP19 knockout (KO) mice, and their wild-type littermates were maintained under specific pathogen-free (SPF) conditions at 22–24 °C with 40–70% humidity and a 12-hour light/dark cycle. All animal procedures were approved by the Institutional Animal Care and Use Committee of Renmin Hospital of Wuhan University (approval number SYXK 2020-0027) and conducted in accordance with institutional ethical guidelines.

Acute Lung Injury (ALI) model establishment

ALI was induced by intratracheal instillation of LPS (30 mg/kg in 50 µL saline; Sigma). Briefly, mice were anesthetized with isoflurane (induction 2%, maintenance 1.5%) and placed in a supine position. After confirming stable respiration, LPS solution was administered using a micro-spray applicator. Mice were maintained in this position for 5 min to prevent reflux, then transferred to a 28 °C recovery chamber until fully awake. All analyses were performed 6 h post-LPS administration.

Bronchoalveolar Lavage Fluid (BALF) collection and analysis

Following euthanasia with sodium pentobarbital (100 mg/kg, i.p.), the trachea was exposed and cannulated with a 16G catheter. Lungs were lavaged three times with 1 mL ice-cold phosphate buffer (PBS). BALF was centrifuged at 800 × g (4 °C, 10 min), with the supernatant stored at -80 °C for subsequent analysis. Total protein concentration was determined using a BCA assay kit (Thermo Scientific). Inflammatory cytokines (TNF-α, IL-6, IL-1β) were quantified by ELISA (ELK Biotechnology) according to manufacturer protocols. Cell pellets were resuspended in PBS for counting using an automated cytometer (Auto 1000, Nexcelom).

Vascular permeability assessment

At 5.5 h post-LPS challenge, mice received Evans Blue (EB; 20 mg/kg) via tail vein injection. After 30 min, blood was collected by cardiac puncture and allowed to clot at room temperature for 2 h. Lungs were perfused with PBS, excised, weighed, and photographed. EB was extracted from tissues and serum using formamide (60 °C, 18 h), with absorbance measured at 620 nm (SpectraMax M5, Molecular Devices).

Lung wet/dry weight ratio determination

Mice were sacrificed 6 h post-LPS administration, and lungs were excised, blot-dried, and weighed to obtain wet weight. Tissues were then dehydrated at 70 °C for 72 h until stable dry weights were attained. The wet-to-dry (W/D) ratio was computed as an index of lung water content.

Histopathological analysis

H&E staining

Left lungs were fixed in 10% neutral buffered formalin for 72 h, paraffin-embedded, and sectioned at 5 μm thickness. After deparaffinization, sections were stained with hematoxylin (G1004, Servicebio) and eosin (BA-4024, Baso). Histological scoring evaluated.

1. Alveolar hemorrhage

2. Neutrophil infiltration

3. Hyaline membrane formation

4. Interstitial thickening

Immunohistochemistry (IHC)

Antigen retrieval was performed in citrate buffer (pH 6.0) at 95 °C for 15 min. Sections were blocked with 10% BSA (NA8692, Bomei) for 1 h at room temperature, then incubated overnight at 4 °C with primary antibodies against Ly6G (1:200; GB11229, Servicebio) or Mac3 (1:150; 550292, BD Biosciences). Detection employed HRP-conjugated secondary antibodies (PV-9001/PV-9004, ZSGB-BIO) with DAB chromogen (ZLI-9018, ZSGB-BIO).

Cell culture and treatments

Human lung microvascular endothelial cells (HULEC-5a; ATCC CRL-3244) were cultured in MCDB131 medium supplemented with 10% FBS (Newzeru), 10 ng/mL EGF, 1 µg/mL hydrocortisone, 10 mM L-glutamine (Beyotime), and 1% penicillin-streptomycin (Biosharp) at 37 °C with 5% CO₂. For LPS challenge, cells were treated with 100 ng/mL LPS (Beyotime) for 24 h.

Construction of USP19 knockdown and overexpression cell lines

To overexpress USP19, the full-length sequence of human USP19 CDS was amplified using Phanta Max polymerase (P505-d1, Vazyme) and cloned into pHAGE-CMV-MCS-EF1α-puro vector via ClonExpress II kit (C112-02, Vazyme). To knockdown USP19, design and synthesize the shRNA sequence targeting the USP19 gene, and then cloned it into pLKO.1-puro vector. Lentiviral particles were produced in HEK293T cells (ATCC CRL-3216) using PEI (23966-1, Polysciences)-mediated cotransfection with packaging plasmids (pMD2.G/psPAX2). Viral supernatants were concentrated by ultracentrifugation (50,000 × g, 2 h) and transduced into HULEC-5a with 8 µg/mL polybrene (SC-134220, Santa Cruz). Stable lines were selected with 2.5 µg/mL puromycin (Biolight) for 48 h, with knockdown/overexpression efficiency verified by Western blot.

Pulmonary microvascular endothelial cell isolation

Mouse lung microvascular endothelial cells were isolated as previously described [28, 29]. Briefly, six- to eight-week-old USP19 knockout mice and littermate negative controls were used. Following euthanasia by anesthesia, the abdominal skin was disinfected with 75% alcohol. The chest was opened to expose the heart and lungs, and sterile PBS was perfused through the right ventricle until the lungs became pale. Lung tissues were then excised and placed in prechilled sterile PBS, gently rinsed 2–3 times to remove residual blood and contaminants. The peripheral lung tissue was minced into approximately 1 mm³ fragments and incubated in DMEM supplemented with 20% fetal bovine serum for 60 h to allow endothelial cell outgrowth. After removal of the tissue fragments, adherent cells were cultured in DMEM containing 10% fetal bovine serum and 100 U/ml penicillin–streptomycin for 3 days. Upon reaching confluence, cells were harvested using 0.25% trypsin. The isolated endothelial cells were confirmed by positive immunofluorescence staining for CD31.

Cell viability assay

Cells (3,000/well) were seeded in 96-well plates. After LPS treatment, 10 µL CCK-8 reagent (B34303, Biomake) was added per well and incubated for 2 h at 37 °C. Absorbance at 450 nm was measured using a microplate reader (BioTek Synergy H1).

Molecular analyses

RNA isolation and qPCR

Total RNA was extracted with TRIzol (Invitrogen), reverse transcribed using HiScript II RT mix (R323-01, Vazyme), and amplified with ChamQ SYBR qPCR Master Mix (Q311-02, Vazyme) on a QuantStudio 6 Flex (Applied Biosystems). The nucleotide sequences for all oligonucleotide primers utilized in this study are provided in Table 1. Cycling conditions: 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Relative expression was calculated by the 2^(-ΔΔCt) method using β-actin for normalization.

Table 1.

Primer sequences for RT-qPCR

Gene	Species	Forward 5’--3’	Reverse 5’--3’
USP19	mice	TGGGGATAGTGTGGAGGAGG	GTCACGAAGTTCCCGAGTGT
Tnf	mice	CATCTTCTCAAAATTCGAGTGACAA	TGGGAGTAGACAAGGTACAACCC
Il6	mice	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC
Il1b	mice	CCGTGGACCTTCCAGGATGA	GGGAACGTCACACACCAGCA
Ccl2	mice	TACAAGAGGATCACCAGCAGC	ACCTTAGGGCAGATGCAGTT
β-actin	mice	GTGACGTTGACATCCGTAAAGA	GCCGGACTCATCGTACTCC
Bax	mice	TGAGCGAGTGTCTCCGGCGAAT	GCACTTTAGTGCACAGGGCCTTG
Bcl2	mice	CAACAGGGAGATGTCACCCC	TCAAACAGAGGTCGCATGCT
USP19	Human	TAAATCCAAGGCACGATCTGAGG	GCTTTGGGGTTACATGCTCCA
Tnf	Human	TGGCGTGGAGCTGAGAGATA	TGATGGCAGAGAGGAGGTTG
Il6	Human	GAGTAGTGAGGAACAAGCCAGA	AAGCTGCGCAGAATGAGATGA
Il1b	Human	TCGCCAGTGAAATGATGGCT	TGGAAGGAGCACTTCATCTGTT
β-actin	Human	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT
Bax	Human	CCCGAGAGGTCTTTTTCCGAG	CCAGCCCATGATGGTTCTGAT
Bcl2	Human	GGTGGGGTCATGTGTGTGG	CGGTTCAGGTACTCAGTCATCC

Western blotting

Cells/tissues were lysed in RIPA buffer (65 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) containing protease/phosphatase inhibitors (Roche). Proteins (20 µg/lane) were separated by 10% SDS-PAGE and transferred to PVDF membranes (IPVH00010, Millipore). After blocking with 5% non-fat milk, membranes were probed overnight at 4 °C with primary antibodies (Table 2), then, the membranes were incubated with species-matched secondary antibodies ( Jackson ImmunoResearch). Signals were developed with ECL (1705062, Bio-Rad) and imaged (ChemiDoc XRS+).

Table 2.

Antibody Information

Target	Company	Catalog #
β-actin	Abclonal	AC026
USP19	Genetex	GTX87472
Bax	CST	2772
Bcl2	CST	3498
Flag	MBL	M185-3 L
p-ERK	CST	4370
ERK	CST	4695
p-JNK	CST	4668
JNK	CST	9252
p-p38	CST	4511
p38	CST	8690
p-TAK1	CST	4508
TAK1	CST	5206

Statistical analysis

Data are presented as mean ± SD. Comparisons were made by unpaired two-tailed Student’s t-test or one-way ANOVA with Tukey’s post-hoc test using GraphPad Prism 9.0. P < 0.05 was considered statistically significant.

Results

1. USP19 is downregulated in LPS-induced acute lung injury

To investigate the role of USP19 in ALI pathogenesis, we established a model using lipopolysaccharide (LPS) stimulation in C57BL/6J mice to simulate acute lung injury (ALI). Histopathological examination revealed characteristic features of lung injury including alveolar wall thickening, interstitial hemorrhage, inflammatory infiltration, and structural disruption (Fig. 1A). Quantitative PCR analysis demonstrated significant upregulation of inflammatory mediators (Tnf, Il6, Il1b and Ccl2) in lung tissues (Fig. 1B). Notably, LPS stimulation significantly reduced both the transcriptional and translational levels of USP25 and USP19, whereas USP18 expression was markedly upregulated (Fig. 1C, D).

Fig. 1.

USP19 expression is downregulated during acute lung injury. (A) Representative images of hematoxylin and eosin (H&E)-staining of lung sections from mice treated with PBS or LPS (n = 6 mice per group). (B) mRNA expression levels of inflammatory mediators (Tnf, Il6, Il1b, and Ccl2) in lung tissues from PBS- or LPS-challenged mice (n = 4 mice per group). (C) USP19 mRNA levels in lung tissues from PBS- or LPS-treated mice (n = 4 mice per group). (D) Western blot and quantitative analysis of USP19 protein expression in lung tissues from PBS- or LPS-administered mice (n = 3 mice per group). (E) mRNA levels of inflammatory genes (Tnf, Il6, and Il1b) in HULEC-5a cells treated with PBS or LPS (n = 3 independent repetitions). (F) Real-time PCR analysis of USP19 mRNA expression in HULEC-5a cells following PBS or LPS treatment (n = 3 independent repetitions). (G) Western blot and quantitative analysis of USP19 protein expression in HULEC-5a cells treated with PBS or LPS (n = 3 independent repetitions). A two-tailed Student’s t-test was used for statistical analysis. *P < 0.05, **P < 0.01 versus the PBS group

Parallel in vitro experiments using LPS-stimulated HULEC-5a cells recapitulated these findings, showing elevated expression of inflammatory cytokines (Tnf, Il6 and Il1b) concomitant with decreased USP19 expression (Fig. 1E-G). These observations suggest a potential regulatory role of USP19 in ALI progression.

• 2. Genetic ablation of USP19 exacerbates LPS-induced lung injury

USP19 knockout in lung tissues of mice were validated by Western blot analysis (Fig. 2A). Compared to wild-type littermates, USP19-deficient mice exhibited more severe histopathological alterations following LPS administration, including exacerbated alveolar collapse, hemorrhage, and inflammatory cell accumulation (Fig. 2B). Quantitative assessments demonstrated that USP19 deficiency significantly elevated total cell counts and protein content in BALF, increased the lung wet/dry weight ratio, and enhanced pulmonary vascular permeability as indicated by Evans Blue extravasation (Fig. 2C-F). These data demonstrate that genetic deletion of USP19 significantly aggravates LPS-induced ALI.

Fig. 2.

USP19 deficiency exacerbates LPS-induced lung injury. (A) Western blot detection results of USP19 protein expression in lung tissues from wild-type (WT) and USP19-knockout (KO) mice (n = 3 mice per group). (B) Representative hematoxylin and eosin (H&E)-stained lung sections from WT and USP19-KO mice treated with PBS or LPS (n = 6 mice per group). (C) Total cell counts (left) and protein concentration (re=right) in BALF from PBS- or LPS-treated WT and USP19-KO mice (n = 6 mice per group). (D) Lung wet/dry weight ratio of PBS- or LPS-challenged WT and USP19-KO mice (n = 6 mice per group). (E) Representative macroscopic images of lungs from PBS- or LPS-treated WT and USP19-KO mice following Evans blue (EB) injection (n = 6 mice per group). (F) Quantitative analysis of EB extravasation in lung tissue and serum from PBS- or LPS-exposed WT and USP19-KO mice after EB administration (n = 6 mice per group). For C, D, and F, a one-way ANOVA analysis was used for statistical analysis. **P < 0.01 versus the WT PBS group. #P < 0.05, ##P < 0.01 versus the WT LPS group

• 3. USP19 deficiency aggravates inflammatory responses and apoptosis during ALI

Excessive inflammatory activation is particularly important in the pathological mechanism of ALI. To investigate the regulatory effect of USP19 on inflammation activation during ALI, we performed Ly6g(Neutrophil) and Mac3(Monocyte-macrophage) immunohistochemical assays on lung tissue. We found that LPS induced ly6g positive cells were significantly increased in USP19 deficient mouse lung tissue (Fig. 3A), and macrophage infiltration was significantly increased (Fig. 3B). At the physiological level, our findings demonstrate that USP19 deficiency does not exert a significant impact on either inflammation or apoptosis. After LPS stimulation, the mRNA levels of Tnf, Il6, Il1b, and Ccl2 were increased in USP19-delected lung tissue (Fig. 3C). The contents of TNF-α, IL-6, and IL-1β in BALF from USP19-delected mice also increased (Fig. 3D). Consistently, USP19 deficiency elevated the expression of the pro-apoptotic molecule Bax and suppressed the expression of anti-apoptotic molecule Bcl2, indicating that USP19 loss potentiates apoptosis during ALI (Fig. 3E-G). These results demonstrate that USP19 can promote the inflammatory response and apoptosis in ALI.

Fig. 3.

USP19 deficiency exacerbates inflammatory responses and apoptosis during ALI. (A) Representative immunohistochemical staining images of Ly6g in lung tissues of WT and USP19-KO mice stimulated by LPS (n = 4 mice per group). (B) Representative immunohistochemical staining images of Mac3 in lung tissues of WT and USP19-KO mice stimulated by LPS (n = 4 mice per group). (C) mRNA levels of inflammatory mediators (Tnf, Il6, Il1b, and Ccl2) in lung tissues were measured in PBS- and LPS-treated WT and USP19-KO mice (n = 4 mice per group). (D) Cytokine concentrations in BALF were measured in PBS- and LPS-challenged WT and USP19-KO mice (n = 6 mice per group). (E, F) mRNA expression of apoptosis-related genes (Bax and Bcl2) in lung tissues were measured in PBS- and LPS-exposed WT and USP19-KO mice (n = 4 mice per group). (G) Western blot and quantitative analysis of apoptosis regulators Bax and Bcl2 in lung tissues were measured in PBS- and LPS-treated WT and USP19-KO mice (n = 3 mice per group). For C-G, a two-tailed Student’s t-test was used for statistical analysis. ##P < 0.01 versus the WT LPS group

• 4.USP19 protects against LPS induced endothelial cell injury, inflammatory responses and apoptosis

Previous studies have well-established that endothelial cells play a pivotal role in regulating the inflammatory response during ALI [30]. To further investigate the regulatory effect of USP19 on ALI, we constructed a stable HULEC-5a cell line with USP19 knockdown and analyzed the cell activity, inflammatory activation and apoptosis after LPS stimulation. Western blot analysis showed a significant downregulation of USP19 expression, indicating successful cell line construction (Fig. 4A). Stimulating USP19 knockdown cells and control cells with PBS or LPS, and detecting cell viability using Cell Counting Kit-8. The results showed that knocking down USP19 increased cell damage induced by LPS stimulation (Fig. 4B). Next, we investigated the effect of USP19 knockdown on the inflammatory response triggered by LPS stimulation. Results indicated that USP19 knockdown increased the mRNA levels of Il6, Il1b, Ccl2, and Icam1 in LPS induced HULEC-5a cells (Fig. 4C, D). Knocking down USP19 also increases the levels of cytokines in the HULEC-5a cell culture medium induced by LPS (Fig. 4E). In addition, USP19 knockdown significantly upregulated the expression pro-apoptotic factor Bax while downregulating the expression of anti-apoptotic molecule Bcl2 in LPS stimulated HULEC-5a cells, suggesting that USP19 deficiency promotes LPS induced cellular apoptosis (Fig. 4F, G).

Fig. 4.

USP19 protects against LPS-induced endothelial cell injury, inflammatory responses and apoptosis. (A) USP19 protein expression in control (shRNA) and USP19-knockdown (shUSP19) HULEC-5a cells, as determined by western blotting (n = 3 independent repetitions). (B) The viability of shRNA and shUSP19 HULEC-5a cells following treatment with PBS or LPS (n = 4 independent repetitions). (C, D) The mRNA expression of pro-inflammatory genes (Il6, Il1b, Ccl2, and Icam1) in PBS- and LPS-stimulated shRNA and shUSP19 HULEC-5a cells, measured by RT-qPCR (n = 4 independent repetitions). (E) Cytokine levels in culture supernatants from shRNA and shUSP19 HULEC-5a cells treated with PBS- and LPS (n = 4 independent repetitions). (F) mRNA expression of apoptosis-related genes (Bax and Bcl2) in PBS- and LPS-treated shRNA and shUSP19 HULEC-5a cells, detected by RT-qPCR (n = 4 independent repetitions). (G) Western blot and quantitative analysis of Bax and Bcl2 in PBS- and LPS-challenged shRNA and shUSP19 HULEC-5a cells (n = 3 independent repetitions). For B, a two-tailed Student’s t-test was used for statistical analysis. For C-G, a one-way ANOVA analysis was used for statistical analysis. **P < 0.01 versus the shRNA PBS group or Vector PBS group. #P < 0.05, ##P < 0.01 versus the shRNA LPS group or Vector LPS group

Subsequently, we constructed a USP19 overexpressed stable HULEC-5a cell line. Western blot analysis showed a significant upregulation of USP19 expression, indicating successful cell line construction (Fig. 5A). Cell viability testing showed that overexpression of USP19 can alleviate cell damage caused by LPS stimulation (Fig. 5B). In USP19-overexpressing HULEC-5a cells, the expression and secretion of inflammatory factors stimulated by LPS were significantly downregulated (Fig. 5C-E), the apoptosis caused by LPS stimulation was also alleviated (Fig. 5F, G).

Fig. 5.

USP19 protects against LPS-induced endothelial cell injury, inflammatory responses and apoptosis. (A) Western blot result shown the USP19 expression in empty vector (Vector) and Flag-USP19 overexpressing HULEC-5a cells (n = 3 independent repetitions). (B) The viability of Vector and Flag-USP19 overexpressed HULEC-5a cells after PBS or LPS treatment (n = 4 independent repetitions). (C, D) RT-qPCR detected the mRNA levels of pro-inflammatory genes (Il6, Il1b, Ccl2, and Icam1) in PBS- and LPS-stimulated Vector and Flag-USP19 overexpressed HULEC-5a cells (n = 4 independent repetitions). (E) Cytokine secretion in culture supernatants of PBS- and LPS-treated Vector and Flag-USP19 overexpressed HULEC-5a cells (n = 4 independent repetitions). (F) Apoptosis-related gene expression (Bax and Bcl2) in PBS- and LPS-exposed Vector and Flag-USP19 overexpressed HULEC-5a cells (n = 4 independent repetitions). (G) Western blot and quantitative analysis of Bax and Bcl2 in PBS- and LPS-induced Vector and Flag-USP19 overexpressed HULEC-5a cells (n = 3 independent repetitions). For B, a two-tailed Student’s t-test was used for statistical analysis. For C-G, a one-way ANOVA analysis was used for statistical analysis. **P < 0.01 versus the shRNA PBS group or Vector PBS group. #P < 0.05, ##P < 0.01 versus the shRNA LPS group or Vector LPS group

In addition, pulmonary microvascular endothelial cells were isolated from USP19 knockout mice and their littermate controls, and an in vitro model was established by LPS stimulation. USP19 deficiency significantly enhanced the inflammatory response and apoptosis in primary pulmonary microvascular endothelial cells following LPS treatment. Specifically, knockout of USP19 exacerbated LPS-induced cellular damage (Supplementary Fig. 1A) and upregulated the mRNA levels of Il6, Il1b, Ccl2, and Icam1 (Supplementary Figs. 1B and C). Consistently, the levels of inflammatory cytokines in the culture supernatant were also elevated in USP19-deficient cells upon LPS stimulation (Supplementary Fig. 1D). Moreover, USP19 deficiency led to a marked upregulation of the pro-apoptotic factor Bax and downregulation of the anti-apoptotic molecule Bcl2, indicating enhanced apoptosis under LPS stimulation (Supplementary Figs. 1E-G).

Collectively, these results suggest that USP19 exerts protective effects in LPS mitigated endothelial cell damage, inflammatory responses, and apoptosis in an ALI model in vitro.

• 5. USP19 inhibits the activation of TAK1-JNK/p38 signaling axis

TGF-β-activated kinase 1 (TAK1), also designated as MAP3K7, is a member of the MAPKKK family that plays pivotal roles in pro-inflammatory signaling pathways [31]. Substantial research supports TAK1’s involvement in mediating cellular damage induced by various stimulants, including ALI [32]. USP19 has been reported to inhibit TAK1 activation, thereby suppressing the expression of downstream NF-κB target genes [33]. We investigated the role of USP19 in regulating the activation of TAK1 and its downstream signaling pathways in ALI. Our results demonstrate that USP19 deletion specifically promoted LPS-induced phosphorylation of TAK1 and its downstream JNK and p38. This enhancement occurred without affecting ERK phosphorylation and the total protein levels of any of these kinases (Fig. 6A). These observations were recapitulated in LPS-stimulated USP19-knockdown HULEC-5a cells (Fig. 6B). Conversely, USP19 overexpression attenuated the activation of the TAK1, JNK, and p38 signaling cascade in LPS-challenged HULEC-5a cells (Fig. 6C). These results demonstrate that USP19 acts as a negative regulator of the TAK1-JNK/p38 signaling axis in ALI.

Fig. 6.

USP19 inhibits activation of the TAK1–JNK/p38 signaling axis in ALI. (A) Western blot and quantitative analysis of total and phosphorylation levels of TAK1, ERK, JNK, and p38 in lung tissues were measured in PBS- and LPS-treated WT and USP19- KO mice (n = 3 mice per group). (B) Western blot and quantitative analysis of total and phosphorylation levels of TAK1, ERK, JNK, and p38 in PBS- and LPS-challenged shRNA and shUSP19 HULEC-5a cells (n = 3 independent repetitions). (C) Western blot and quantitative analysis of total and phosphorylation levels of TAK1, ERK, JNK, and p38 in PBS- and LPS-stimulated empty vector (Vector) and Flag-USP19-overexpressing HULEC-5a cells (n = 3 independent repetitions). A two-tailed Student’s t-test was used for statistical analysis. #P < 0.05, ##P < 0.01 versus the LPS-treated WT group or LPS-challenged shRNA group or LPS-induced Vector group. n.s., non-significance

• 6. USP19 modulates the progression of ALI through regulation of the TAK1-JNK/p38 signaling pathway

To determine whether USP19’s protection in ALI depends on suppressing the TAK1-JNK/p38 axis, we pre-treated control and USP19-knockdown cells with a TAK1 inhibitor (iTAK1) prior to LPS stimulation. In LPS-challenged HULEC-5a cells, iTAK1 treatment effectively reversed the upregulation of TAK1, JNK and p38 phosphorylation levels caused by the knockdown of USP19 (Fig. 7A). Functionally, inhibiting the phosphorylation activation of TAK1 recused the enhancement of cell damage caused by the knockdown of USP19 in response to LPS stimulation (Fig. 7B). Furthermore, the results of RT-PCR and Elisa for inflammatory factors indicated that the treatment with TAK1 inhibitor abolished the enhanced inflammatory response due to the knockdown of USP19 in LPS stimulation (Fig. 7C, D). Consistently, treatment with the TAK1 inhibitor also reversed the increase in cell apoptosis caused by the knockdown of USP19 in response to LPS stimulation (Fig. 7E, F). Our findings demonstrate that USP19 confers protection against ALI by negatively regulating the TAK1-JNK/p38 signaling pathway.

Fig. 7.

USP19 modulates the progression of ALI through regulation of the TAK1–JNK/p38 signaling pathway. (A) Western blot and quantitative analysis of total and phosphorylation levels of TAK1, JNK, and p38 in TAK1 inhibitor (iTAK1) treated control (shRNA) and USP19-knockdown (shUSP19) HULEC-5a cells, and challenged with OGD/R stimulation. (B) The viability of shRNA and shUSP19 HULEC-5a cells pretreated with iTAK1 and subsequently exposed to LPS. (C) The mRNA levels of pro-inflammatory genes (Il6, Il1b, Ccl2, and Icam1) in LPS-stimulated shRNA and shUSP19 cells pretreated with iTAK1. (D) Cytokine secretion in culture supernatants from shRNA and shUSP19 cells pretreated with iTAK1 and challenged with LPS. (E) The mRNA expression of apoptosis-related genes (Bax and Bcl2) in LPS-exposed shRNA and shUSP19 cells following iTAK1 pretreatment. (F) Western blot and quantitative analysis of Bax and Bcl2 in LPS-induced shRNA and shUSP19 cells with iTAK1 pretreatment. n = 3–4 independent experiments. A one-way ANOVA analysis was used for statistical analysis. *P < 0.05, **P < 0.01 versus the shRNA LPS group. #P < 0.05, ##P < 0.01 versus the shUSP19 LPS group

Discussion

Acute lung injury (ALI) represents a life-threatening clinical syndrome triggered by diverse etiological factors such as pneumonia, sepsis, severe trauma, and pancreatitis [34]. In this study, we established LPS-induced ALI models to investigate the role of USP19 both in vivo and in vitro. Our data revealed significant downregulation of USP19 expression in ALI models, implicating its potential involvement in disease pathogenesis. Genetic ablation of USP19 exacerbated LPS-induced ALI in vivo, as evidenced by enhanced pulmonary tissue damage, inflammatory response and apoptotic cell death. These findings were corroborated in vitro. Mechanistically, we demonstrated that USP19 exerts its function of inhibiting ALI by suppressing the activation of the TAK1-JNK/p38 signaling axis.

In inflammatory diseases such as acute lung injury (ALI) and acute respiratory distress syndrome (ARDS), the expression and activity of USP family members are altered, impacting the production of inflammatory cytokines, the activation of immune cells, and the selection of cell death modalities. Emerging evidence indicates that the USP family participates in the pathogenesis of ALI/ARDS by regulating the ubiquitination status of proteins involved in inflammatory signaling and cell death, highlighting the critical role of deubiquitination in the control of inflammation and cell fate decisions [35]. USP25 has been shown to be downregulated in pulmonary inflammatory diseases and functions to inhibit the inflammatory response in lung epithelial cells, thereby attenuating the severity of acute lung injury [36, 37]. USP18 expression is increased in acute lung injury/acute respiratory distress syndrome (ALI/ARDS), where it plays a pro-inflammatory role by promoting macrophage M1 polarization through STING stabilization, thereby facilitating the early phase of lung inflammation [38, 39]. USP19 is an endoplasmic reticulum (ER)-anchored deubiquitinating enzyme that regulates ER-associated protein degradation and DNA damage repair [40, 41]. Recently, emerging evidence has shown that USP19 acts as a crucial negative regulator of the immune response by distinct mechanisms. It directly inhibits TNF-α/IL-1β- and TLR3/4-mediated signaling by deubiquitinating TAK1 and TRIF, respectively [25, 33]. Emerging evidence demonstrates that USP19 plays a dual regulatory role in cellular homeostasis by stabilizing Beclin-1 protein to enhance autophagic flux while simultaneously suppressing type I interferon signaling [22]. Notably, in M1-like macrophages, USP19-mediated autophagy promotes the clearance of reactive oxygen species (ROS), which in turn inhibits NLRP3 inflammasome activation and subsequent inflammatory responses. Multiple studies have confirmed that NLRP3 inflammasome-mediated pyroptosis plays a central role in ALI/ARDS, particularly in sepsis-associated lung injury [42–45]. The USP family, particularly USP19, participates in the pathogenesis of ALI/ARDS by regulating the deubiquitination of proteins involved in inflammatory signaling and cell death. As a core mechanism of inflammatory injury in ALI/ARDS, the ubiquitination status of key molecules in pyroptosis may be modulated by DUBs such as USP19. Although there is currently no direct evidence demonstrating that USP19 regulates the ubiquitination of the NLRP3 inflammasome or gasdermin D, USP19 may influence the inflammatory microenvironment and immune cell polarization by modulating immune signaling, apoptosis, and ROS metabolism, thereby indirectly affecting the occurrence and intensity of pyroptosis. In our investigation, we found the absence of USP19 can promote the activation and infiltration of inflammatory cells, as well as the expression and secretion of inflammatory factors such as TNF-α, IL-6, IL-1β and Ccl2 in lung tissue stimulated by LPS. In endothelial cells stimulated by LPS, the inhibitory effect of USP19 on the inflammatory response was also observed. These results are consistent with the previously reported inhibitory effect of USP19 on the inflammatory response.

TAK1, a member of the mitogen-activated protein kinase kinase kinase (MAPKKK) family, serves as a critical upstream activator that mediates diverse signaling pathways through its regulation of MAP kinase activation [46–48]. Emerging evidence indicates that ubiquitination and deubiquitination play a crucial role in regulating and maintaining the stability and activation of TAK1 [49, 50]. Studies have shown that the E3 ubiquitin ligase TRIM16 can promote the degradation of TAK1 by facilitating its K48-linked ubiquitination, thereby inhibiting the progression of non-alcoholic steatohepatitis [51]. In the mouse model of sepsis, TIGAR can directly bind to TAK1 and promote the K63-linked ubiquitination of TAK1 mediated by TRAF6, thereby facilitating the own phosphorylation and activation of TAK1 [52]. The deubiquitinating enzyme OTUD5 can inhibit the activity of TAK1 by removing the K63-linked deubiquitination from TAK1, thereby suppressing the inflammatory response during diabetic nephropathy [53]. Our data demonstrate that USP19 serves as a critical regulator of the TAK1-JNK/p38 signaling axis in ALI pathogenesis. Specifically, genetic deletion of USP19 significantly enhanced TAK1 phosphorylation, whereas USP19 overexpression attenuated TAK1 activation. However, our research did not clarify how USP19 inhibits the phosphorylation activation of TAK1 in ALI. Based on the fact that USP19 is a deubiquitinating enzyme and the significance of K63-linked ubiquitination regulation in the activation of TAK1, we speculate that USP19 may inhibit the activation of TAK1 by removing the K63-linked ubiquitination of TAK1 in ALI. This is also consistent with the reports in the published articles that in immune cells, TAK1 removes the K63-linked ubiquitination of TAK1, thereby inhibiting the activation of its downstream signals [26].

iTAK1 is a class of specific TAK1 inhibitors that have been utilized in various disease models to elucidate the role of the TAK1 pathway. In models of cerebral ischemia-reperfusion injury (CIRI), iTAK1 can attenuate inflammation and apoptosis and ameliorate tissue damage by inhibiting the TAK1-JNK/p38 signaling pathway [54]. Similarly, in disease models such as prostate cancer and cardiac hypertrophy, iTAK1 exerts anti-inflammatory and anti-fibrotic effects through suppression of downstream TAK1 signaling [55, 56]. The core pathology of ALI/ARDS is characterized by pulmonary inflammation, disruption of the endothelial/epithelial barrier, and cytokine storm, with the TAK1 signaling pathway playing a crucial role in regulating the expression of inflammatory mediators such as IL-6, ICAM-1, and VCAM-1 [57]. Current literature on ALI primarily focuses on the regulation of inflammatory signaling, cytokines, and cell death; as a central hub in inflammatory signaling, TAK1 and its inhibitors are theoretically capable of intervening in the key pathological processes of ALI. Therefore, iTAK1 may serve as a potential therapeutic agent for acute lung injury (ALI).

This study still has some limitations. For instance, the upstream regulatory mechanism for the downregulation of USP19 in ALI remains unclear. Furthermore, we have demonstrated that USP19 can exert its regulatory effect by inhibiting the TAK1-JNK/p38 signaling axis in endothelial cells. However, it is unclear whether USP19 has the same regulatory effect in other types of cells in the lung tissue, such as epithelial cells and macrophages. All of these require further investigation.

Conclusion

In conclusion, this study identified USP19 as a critical suppressor of ALI progression. Specifically, USP19 demonstrated remarkable protective effects against pulmonary microvascular endothelial cell injury and inflammatory activation, effectively ameliorating LPS-induced pulmonary edema, inflammatory cell infiltration, increased alveolar permeability, and enhanced microvascular permeability. Consistently, USP19 ablation markedly exacerbated LPS-induced ALI in mice. Mechanistically, we revealed that USP19 primarily regulates ALI by inhibiting TAK1 activation. These results not only provide novel insights into the pathogenesis of ALI but also highlight USP19 as a potential therapeutic target for this devastating condition.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Cong Li and Kui Qin performed the experiments and analyzed data; Youna Wang and Yuqing Huang conducted cell experiments; and Jiangsong Zhang and Hongbin Chen designed the project, edited the manuscript, and supervised the study. All authors discussed the results and contributed to manuscript writing and revisions.

Funding

No external funding was received for this work.

Data availability

The datasets supporting the conclusions of this article are included within the article. Any other data and materials generated in this study are available from the corresponding author upon request.

Declarations

Ethics approval and consent to participate

All animal procedures were approved by the Institutional Animal Care and Use Committee of Renmin Hospital of Wuhan University (approval number SYXK 2020-0027) and conducted in accordance with institutional ethical guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.