The tumor promoter role and molecular mechanism of C8orf76/CALB2 axis in clear cell renal cell carcinoma

Summary

Clear cell renal cell carcinoma (ccRCC) is the predominant subtype of RCC. C8orf76 is upregulated in multiple cancers and linked to malignant progression, but its role in ccRCC remains unclear. Here, we explored the function and mechanism of C8orf76 in ccRCC using in vitro, in vivo, RNA-sequencing, and bioinformatic analyses. We found that C8orf76 and CALB2 were highly expressed in ccRCC and associated with poor prognosis. C8orf76 knockdown inhibited ccRCC proliferation and migration in vitro and in vivo by inducing G1 cell-cycle arrest and cellular senescence via downregulating CALB2, which could be partially reversed by CALB2 overexpression. Similarly, CALB2 knockdown induces cell-cycle arrest and cellular senescence in ccRCC, thereby inhibiting cell proliferation and migration. These effects are partially reversed by additional CDKN2A knockdown. Therefore, C8orf76 directly binds to the CALB2 promoter to activate its transcription. The C8orf76/CALB2 axis promotes ccRCC progression by repressing cellular senescence.

Graphical abstract

Highlights

• •C8orf76 is highly expressed in ccRCC and correlates with poor prognosis
• •C8orf76 binds CALB2 promoter, enhancing its expression and downstream processes
• •C8orf76/CALB2 drives ccRCC via regulating cell-cycle arrest and senescence pathways

Biological sciences; Molecular biology; Cell biology

Introduction

Renal cell carcinoma (RCC) is a common malignant tumor of the urinary system, accounting for about 90% of renal malignancies and constituting about 3% of adult malignant tumors globally.^1,2 In 2022, there were over 430,000 new RCC cases and 150,000 deaths worldwide.³ Notably, the incidence rate among younger populations (<50 years old) is on the rise.⁴ Clear cell renal cell carcinoma (ccRCC), the most prevalent subtype of RCC, originates from the proximal tubules of nephrons. It is characterized by a highly aggressive phenotype and poor prognosis.^5,6 Surgical treatment is the main strategy for ccRCC.⁷ However, due to the lack of effective early diagnostic measures, ccRCC often presents inconspicuously, with nearly 30% of patients diagnosed with metastatic disease at initial presentation.⁸ Metastatic tumor patients frequently develop treatment resistance and disease progression.^9,10 Therefore, it is necessary to further investigate the molecular mechanisms of the occurrence, development, and metastasis of ccRCC. Such exploration may be the key to assisting clinical early diagnosis, identifying new therapeutic targets, and developing personalized treatment strategies.

Chromosome 8 open reading frame 76 (C8orf76) is a nuclear protein-encoding gene located on chromosome 8q24.13–24.3, which encodes a 380-aa protein. It was first discovered in gastric cancer. C8orf76 could directly interact with the oncogenic long non-coding RNA (lncRNA) dual specificity phosphatase 5 pseudogene 1 (DUSP5P1), triggering its transcriptional upregulation and subsequent activation of the downstream mitogen-activated protein kinase (MAPK) signaling pathway.¹¹ Studies have also shown that C8orf76 participates in ferroptosis regulation by transcriptionally activating SLC7A11, thus promoting the progression of liver cancer.¹² The protein encoded by the calbindin 2 (CALB2) gene is a member of the troponin C superfamily, primarily regulating intracellular calcium levels and exerting biological functions such as signal transduction and calcium ion buffering. CALB2 is also associated with metastasis and drug resistance in multiple tumors.^13,14,15 For example, CALB2 can activate the TRPV2-Ca²⁺-ERK1/2 signaling pathway to induce metastasis in hepatocellular carcinoma.¹⁶ However, the specific roles and molecular mechanisms of C8orf76 and CALB2 in ccRCC have not yet been thoroughly investigated.

The concept of cellular senescence was first proposed in the 1960s,¹⁷ referring to a stable and persistent state of cell-cycle arrest. This state is associated with the upregulation of cyclin-dependent kinase inhibitors (CKIs), such as p16INK4a and p21WAF1/CIP1, chronic DNA damage responses, and a hyper-secretory state of the senescence-associated secretory phenotype (SASP).¹⁸ Among these, p16INK4a (p16) is a critically important cell cycle inhibitor. It can suppress the activity of CDK4/6, prevent the phosphorylation of retinoblastoma protein (RB), and thereby lead to G1 phase arrest in the cell cycle, promoting the occurrence of cellular senescence.¹⁹ This strong association with cellular senescence has made p16 a priority for research.²⁰ In tumor progression, cellular senescence exhibits a dual role: cell entry into senescence can act as an effective barrier against tumorigenesis,²¹ while under certain conditions, persistently senescent cells can also acquire pro-tumorigenic properties.^22,23 Preclinical evidence suggests that senescent cancer cells exhibit enhanced immunogenic properties, offering a potential avenue for therapeutic modulation of anti-cancer immunity.²⁴ Therefore, in-depth research on cellular senescence and tumorigenesis may serve as a new tool to break through the barriers of cancer therapy and tackle the challenges of early tumor diagnosis.

Results

C8orf76 up-regulation in ccRCC and its association with prognosis

The TIMER 2.0 database was employed to assess C8orf76 expression levels across pan-cancer, and the results indicated its high expression in these settings (Figure 1A). Both paired (Figure 1C) and unpaired (Figure 1B) analyses of KIRC-TCGA revealed elevated C8orf76 expression in tumor samples. To reduce the errors caused by a single database, we based our study on the GEO database and explored the datasets of GSE40435, GSE53757, GSE126964, and GSE167573. The results were similar to the former, that is, C8orf76 was significantly upregulated in ccRCC cancer tissues (Figure S2A). In addition, according to the TCGA database, the expression level of C8orf76 is higher in T3 and T4 and stages III and IV. Patients with lymph node metastasis or distant metastasis also have higher levels of C8orf76 (Figure S2B). An independent dataset containing information on 47 clinical samples yielded the similar results (Figure 1D). Consistently, C8orf76 protein levels were significantly higher in clinical tumor samples compared with adjacent normal tissues from 10 patients with ccRCC (Figure 1E). We also performed immunohistochemical experiments on ccRCC specimens using tissue microarray technology, with results further validating the above conclusion (Figure 1F). Moreover, KIRC-TCGA analysis revealed that patients with higher C8orf76 expression had poorer OS, PFI, and DSS than those with lower expression (Figures 1G–1I). C8orf76 also showed high diagnostic value for ccRCC, with an area under the curve (AUC) of 0.851 (Figure 1J), highlighting its specificity in ccRCC. Therefore, we can conclude that C8orf76 is upregulated in ccRCC and associated with a poor prognosis.

Figure 1.

C8orf76 up-regulation in ccRCC and its association with prognosis

(A) Differential C8orf76 expression in various types of tumor tissues and adjacent normal tissues was analyzed by the TIMER 2.0 database.

(B and C) C8orf76 was highly expressed in tumor tissues according to the TCGA-KIRC database.

(D) C8orf76 mRNA levels in 47 ccRCC tissues and adjacent normal tissues (the control group: the mRNA level of normal tissues).

(E) Western blot analyses were conducted to assess the protein levels of C8orf76 in tumor and adjacent tissues collected from 10 patients with ccRCC (N, normal; T, tumor; n = 10).

(F) Representative IHC images of C8orf76 in ccRCC tissues and adjacent normal tissues. Scale bar, 50 μm.

(G–I) Overall survival (OS), progression-free interval (PFI), and disease-specific survival (DSS) were analyzed according to high or low expression of C8orf76 (∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001).

(J) ROC curve analysis demonstrates that the expression of C8orf76 is specific to ccRCC.

Data for D, E are represented as means ± SDs (n = 3 per group). Ns for statistical significance, ∗∗ for p < 0.01, ∗∗∗ for p < 0.001, and ∗∗∗∗ for p < 0.0001.

Statistical significance for B was determined using the Mann-Whitney U test. Two-tailed Student’s t test for E. Paired sample t test for C, D, F. G–I were determined by the log rank t test.

C8orf76 knockdown inhibits the proliferation and migration of ccRCC both in vivo and in vitro

Western blot and qPCR analyses were performed in ccRCC cell lines (786-O, A-498, Caki-1, and 769-P). The results demonstrated that the mRNA and protein levels of C8orf76 were relatively elevated in the 786-O and 769-P cell lines (Figures 2A and 2B). As shown in Figures 2C–2E, S3A, and S3B, transient transfection with siC8orf76 resulted in a reduction in C8orf76 expression levels in both 786-O and 769-P cells relative to the negative control (NC), while the level of C8orf76 increased after overexpression. To explore the in vivo effect of C8orf76 on tumor progression, 769-P cells infected with C8orf76 knockdown lentivirus were selected and subcutaneously inoculated into separate experimental groups. The results demonstrated that tumor volume and weight in the C8orf76 knockdown group were significantly decreased compared with the control group (Figure 2F). In addition, we also performed H&E staining and IHC staining on the subcutaneous tumors. The results further confirmed our conclusion at the histological level (Figures S2C and S2D). CCK-8 and colony formation assays demonstrated that C8orf76 knockdown groups displayed decreased relative cell viability and colony formation ability (Figures 2G, 2H, 2K, S3E, S3F, and S3H). Additionally, wound healing and transwell cell migration assays also revealed that C8orf76 knockdown groups exhibited significantly reduced migratory capacity (Figures 2I, 2J, 2L, S3C, S3D, and S3G). Collectively, these results can suggest that C8orf76 knockdown inhibits the proliferation and migration of ccRCC both in vivo and in vitro.

Figure 2.

C8orf76 knockdown inhibits the proliferation and migration of ccRCC both in vivo and in vitro

(A and B) The mRNA levels and protein expression of C8orf76 in multiple ccRCC cell lines.

(C–E) In 786-O and 769-P cells, C8orf76 expression was knocked down at both the transcriptional and translational levels, and the knockdown efficiency was validated.

(F) Representative images and tumor volume curves of subcutaneous tumors in nude mice after transfection with shNC and shC8orf76 plasmids (n = 3 technical replicates from 5 biological replicates for each sample). Data are represented as mean ± SD.

(G and H) The cell viability of 786-O and 769-P cells was assessed using the CCK-8 assay.

(I and J) The migratory capacity of 786-O and 769-P cells was assessed using a wound healing assay. I₁, J₁: cell wound healing images; I₂, J₂: quantitative analysis images. Scale bars, 200 μm.

(K) The colony formation ability of 786-O and 769-P cells was evaluated using a colony formation assay. K₁: colony formation images; K₂: quantitative analysis images. Scale bars, 10 mm.

(L) The migratory capacity of 786-O and 769-P cells was evaluated using a transwell cell migration assay. L₁: transwell cell migration images; L₂: quantitative analysis images. Scale bars, 100 μm.

Ns for statistical significance, ∗∗ for p < 0.01 and ∗∗∗ for p < 0.001. Data are represented as mean ± SD (n = 3 per group). One-way ANOVA for A–F and I–L.

Knockdown of C8orf76 induces cell-cycle arrest and triggers cellular senescence in ccRCC

Both Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and Reactome analyses on 786-O cells between the siNC and the siC8orf76 group revealed enrichment for the cell cycle and cellular senescence pathways (Figures 3A and 3B). Cell Cycle Flow Cytometry indicated that after knocking down C8orf76 in 786-O and 769-P cell lines, G1 phase arrest occurred in the cell cycle (Figure 3C). Similarly, overexpression of C8orf76 can promote the progression of the cell cycle (Figure S4B). After knocking down C8orf76, western blot analyses revealed an upregulation of p16INK4a, a key senescence-associated protein, and a downregulation of cyclin-dependent kinases (CDK4 and CDK6). However, when C8orf76 is overexpressed, the opposite result is obtained (Figure S4A). These findings suggest that C8orf76 may mediate cellular senescence pathways. Concomitantly, reduced expression levels were observed for Lamin B1 and FOXM1—two critical proteins involved in cell cycle regulation and senescence—indicating suppressed cell cycle progression and enhanced cellular senescence (Figure 3D). To more intuitively demonstrate the correlation between C8orf76 and cellular senescence, we knocked down C8orf76 in 786-O and 769-P cells and conducted SA-β-Gal staining. The results revealed a significantly higher proportion of SA-β-Gal positive cells in the knockdown group compared to the control (Figure 3E). Certainly, after the overexpression of C8orf76, the degree of cellular aging was reduced (Figure S4D). Therefore, we can assume that C8orf76 knockdown induces cell-cycle arrest and triggers cellular senescence.

Figure 3.

Knockdown of C8orf76 induces cell cycle arrest and triggers cellular senescence in ccRCC

(A and B) Reactome and KEGG enrichment analyses on 786-O cells between the siNC control group and the siC8orf76 group.

(C) Cell cycle analysis shows the inhibition of C8orf76 resulted in G1 phase arrest of the cell cycle. Ns for statistical significance and ∗∗∗ for p < 0.001. Data are represented as mean ± SD (n = 3 per group).

(D) Western blot analysis demonstrated that inhibiting C8orf76 led to the downregulation of CDK4, CDK6, Lamin B1, and FOXM1, as well as the upregulation of p16INK4a. ∗∗∗ for p < 0.001. Data are represented as mean ± SD (n = 3 per group).

(E) SA-β-gal staining revealed that inhibiting C8orf76 increased the number of senescent cells in both 786-O and 769-P cells. Scale bars, 50 μm ∗∗∗ for p < 0.001. Data are represented as mean ± SD (n = 3 per group).

Statistical significance for C–E was determined using the One-way ANOVA.

CALB2, potentially downstream of C8orf76, is overexpressed in ccRCC and correlates with poor prognosis

We reviewed relevant literature¹¹ and identified five binding motifs of C8orf76. Meanwhile, by integrating RNA-seq results with the TCGA-KIRC database, we screened out CALB2 as a potential downstream target gene of C8orf76 (Figure 4A). RNA sequencing also revealed CALB2 downregulation following C8orf76 knockdown (Figures 4B and 4C). Furthermore, both paired (Figure 4E) and unpaired (Figure 4D) analyses of KIRC-TCGA revealed elevated CALB2 expression in tumor samples. Therefore, we conducted further verification in ccRCC cell lines (786-O, A-498, Caki-1, and 769-P cells). Western blot and qPCR analyses also revealed that CALB2 exhibited relatively high expression in 786-O and 769-P cells (Figures 4F and 4G). To prove from multiple perspectives, we collected clinical samples of ccRCC. As depicted in Figures 4H and 4I, CALB2 exhibits elevated expression in ccRCC tumor samples. Consequently, it is reasonable to conclude that CALB2 is highly expressed in ccRCC. Moreover, KIRC-TCGA analysis showed that higher CALB2 expression was associated with worse OS, PFI, and DSS in patients (Figures 4J–4L), and the AUC was 0.827 (Figure 4M), which suggested that high C8orf76 expression was associated with unfavorable clinical outcomes.

Figure 4.

CALB2, potentially downstream of C8orf76, is overexpressed in ccRCC and correlates with poor prognosis

(A) Integrating RNA sequencing, TCGA database, and literature data, we identified the downstream target genes of C8orf76.

(B and C) RNA-sequencing results showed that after knocking down C8orf76 in 786-O cells, the expression of CALB2 had decreased.

(D and E) CALB2 was highly expressed in ccRCC according to the TCGA-KIRC database.

(F and G) The mRNA levels and protein expression of CALB2 in multiple ccRCC cell lines.

(H) CALB2 mRNA levels in 47 ccRCC tissues and adjacent normal tissues (the control group: the mRNA level of normal tissues).

(I) Western blot analyses were performed to evaluate CALB2 protein levels in tumor and adjacent tissues from 10 patients with ccRCC (N, normal; T, tumor).

(J–L) OS, PFI, and DSS were analyzed according to high or low expression of CALB2. (∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001).

(M) ROC curve analysis shows that the expression of CALB2 is specific to ccRCC.

Data are represented as mean ± SD (n = 3 per group).

Ns for statistical significance, ∗∗ for p < 0.01, ∗∗∗ for p < 0.001, and ∗∗∗∗ for p < 0.0001. Statistical significance for D was determined using the Mann-Whitney U test. The log rank t test for J-L. Paired sample t test for E and H. Two-tailed Student’s t test for I. One-way ANOVA for F, G.

Knockdown of CALB2 suppresses the proliferation and migration of ccRCC

We firstly knocked down C8orf76 in ccRCC cells and found that the expression level of CALB2 also decreased (Figures 5A, 5B, 5E, and 5F). CALB2 was then knocked down in 786-O and 769-P cells, and the knockdown efficiency was verified by qPCR and western blot analyses (Figures 5C, 5D, 5G, and 5H). We conducted subsequent experiments in the CALB2 knockdown cells. CCK-8 and colony formation assays were performed to assess relative cell viability and colony formation capacity, respectively (Figures 5I, 5J, and 5M). Additionally, wound healing and transwell cell migration assays were utilized to assess the migratory ability of ccRCC (Figures 5K, 5L, and 5N). Based on the aforementioned experiments, we can conclude that the knockdown of CALB2 in vitro results in a certain degree of inhibition of the proliferative and migratory capacities in ccRCC.

Figure 5.

Knockdown of CALB2 suppresses the proliferation and migration of ccRCC

(A, B, E, and F) The expression level changes of CALB2 after C8orf76 knockdown.

(C, D, G, and H) Validate the knockdown efficiency of CALB2 at the mRNA and protein levels.

(I, J, and M) Cell viability and colony formation ability were evaluated in 786-O and 769-P cells utilizing the CCK-8 assay and colony formation assay. M₁: colony formation images; scale bars, 10 mm. M₂: quantitative analysis of images.

(K, L, and N) The migratory capacity of 786-O and 769-P cells was assessed using a wound healing assay and a transwell cell migration assay. K₁, L₁: cell wound healing images; scale bars, 200 μm. N₁: transwell cell migration images; scale bars, 100 μm. K₂, L₂, N₂: quantitative analysis images. All data in this figure are represented as mean ± SD (n = 3 per group).

∗for p < 0.05, ∗∗ for p < 0.01, and ∗∗∗ for p < 0.001. Statistical significance was determined using one-way ANOVA.

CALB2 knockdown induces cell-cycle arrest and elicits cellular senescence in ccRCC

Similarly, we employed cell cycle flow cytometry to determine the proportions of cells in different phases of the cell cycle. The results revealed that following CALB2 knockdown, the proportion of cells in the G1 phase increased significantly, indicating that the cell cycle had been arrested (Figure 6A). Meanwhile, we also assessed the expression levels of proteins associated with the cell cycle and cellular senescence at the protein level. When CALB2 was knocked down, the expression level of p16 increased significantly. Given that high p16 expression is known to inhibit CDK4 and CDK6,²⁵ this result is consistent with the findings from our western blot analysis. Furthermore, the expressions of Lamin B1 and FOXM1 were also downregulated. Collectively, these results indicate the disruption of the cell cycle and the occurrence of cellular senescence (Figure 6B). Furthermore, we directly observed the proportion of senescent cells through SA-β-Gal staining. The results indicate that cellular senescence is significantly exacerbated upon CALB2 knockdown. In summary, the knockdown of CALB2 exerts a profound impact on the biological behavior of ccRCC, with a particular propensity to induce cell-cycle arrest and promote cellular senescence.

Figure 6.

CALB2 knockdown induces cell cycle arrest and elicits cellular senescence in ccRCC

(A) Cell cycle analysis shows the inhibition of CALB2 resulted in G1 phase arrest of the cell cycle in 786-O and 769-P cells.

(B) Western blot analysis demonstrates that inhibiting CALB2 led to the downregulation of CDK4, CDK6, Lamin B1, and FOXM1, as well as the upregulation of p16INK4a.

(C) SA-β-gal staining reveals that inhibiting CALB2 increased the number of senescent cells in both 786-O and 769-P cells. Scale bars, 50 μm.

Data for A–C are represented as mean ± SD (n = 3 per group).

Ns for statistical significance, ∗ for p < 0.05 and ∗∗∗ for p < 0.001. Statistical significance for A–C was determined using one-way ANOVA.

C8orf76 directly regulates CALB2, thereby mediating downstream biological behaviors

From the preceding text, we can infer that CALB2 may act downstream of C8orf76 in biological processes. To further explore the interaction between C8orf76 and CALB2, we re-transfected the CALB2-OE plasmid into C8orf76-knockdown 786-O and 769-P cells. The results demonstrated that the phenotypes of ccRCC were all reversed to some extent. Transfection efficiency was validated at both the mRNA and protein levels (Figures 7A–7D). Following C8orf76 knockdown, we repeated the CCK-8 and colony formation assays, and the results revealed that cell proliferation activity was inhibited (Figures 7E, 7F, and 7I). Moreover, further overexpression of CALB2 could partially restore this proliferation activity. Additionally, in both the wound healing assay and Transwell migration experiment, ccRCC cells with C8orf76 knockdown exhibited an increased relative residual scratch area accompanied by a decreased relative migration rate, indicating impaired cell migratory capacity. Notably, these alterations could also be partially mitigated by further overexpression of CALB2 (Figures 7G, 7H, and 7J). Based on the above experimental findings, we subsequently performed a dual-luciferase reporter assay. Considering the three potential binding sites within the CALB2 promoter region, three sets of pGL3-basic plasmids harboring the mutant genes were constructed (Figure 7K). After co-transfecting the cells with the C8orf76-OE plasmid, no significant change was observed in the relative luciferase activity of the MUT2 group. This indicates that C8orf76 directly binds to the CALB2 promoter via this specific site (Figure 7L). To further verify this conclusion, we also conducted ChIP-qPCR experiments. The results indicated that the proportion of the si-C8orf76 group in the Input was significantly lower compared to the NC group. This suggests that C8orf76 directly binds to the promoter region of the CALB2 gene (Figure S4C). Thus, we can conclude that C8orf76 directly binds to the CALB2 promoter, and the C8orf76/CALB2 axis functions as an independent signaling axis to exert biological effects.

Figure 7.

C8orf76 directly regulates CALB2, thereby mediating downstream biological behaviors

(A–D) The alterations in mRNA and protein levels following the transfection of shC8orf76 and CALB2-OE plasmids into ccRCC.

(E, F, and I) CCK-8 and colony formation assay showed that CALB2 overexpression rescued the impaired cell proliferation and colony formation ability induced by C8orf76 inhibition. I₁: colony formation images; scale bars, 10 mm. I₂: quantitative analysis images.

(G, H, and J) Wound healing assay and transwell cell migration experiment revealed that over-expression of CALB2 restored the attenuated migratory capacity. G₁, H₁: cell wound healing images; scale bars, 200 μm. J₁: transwell cell migration images; scale bars, 100 μm. G₂, H₂, J₂: quantitative analysis images.

(K and L) Dual-luciferase reporter assays on the binding site of the CALB2 promoter in 786-O and 769-P cell lines. All data are represented as mean ± SD (n = 3 per group).

∗∗ for p < 0.01 and ∗∗∗ for p < 0.001. Statistical significance for A–J, L was determined using one-way ANOVA.

CALB2 facilitates the proliferation and migration of ccRCC through the inhibition of cellular senescence pathways

As shown in Figure 7, C8orf76 directly binds to the promoter region of CALB2. The C8orf76/CALB2 axis acts as an independent signaling module that mediates cellular senescence pathways, thereby influencing the proliferation and migration capabilities of downstream tumor cells. Based on these observations, we conducted further in-depth experiments. Transfection of sh-CALB2 plasmid into 786-O and 769-P cells resulted in a significant increase in the proportion of cells arrested in the cell cycle G1 phase (Figures 8A, S1A, and S1B), accompanied by the altered expression of senescence-associated proteins (upregulation of p16INK4a and downregulation of CDK4/6, Lamin B1, and FOXM1) (Figures 8B, S1D, and S1E). Additionally, an elevated percentage of senescent cells was observed (Figures 8C and S1C). However, subsequent transfection with the sh-CDKN2A plasmid reversed all of these effects (Figures 8A–8C). Subsequently, we performed CCK-8 assays (Figure 8D), colony formation assays (Figure 8G), wound healing assays (Figures 8E and 8F), and Transwell migration assays (Figure 8H), which allowed us to comprehensively evaluate the changes in the proliferation and migration abilities of tumor cells before and after plasmid transfection. The results indicated that co-transfection of sh-CALB2 and sh-CDKN2A plasmids reversed the inhibitory effects on cell proliferation and migration induced by sh-CALB2 transfection alone. Collectively, these findings suggest that CALB2 facilitates the proliferation and migration of ccRCC through the inhibition of cellular senescence pathways.

Figure 8.

CALB2 facilitates the proliferation and migration of ccRCC through the inhibition of cellular senescence pathways

(A) After transfection with sh-CALB2 and sh-CDKN2A plasmids in ccRCC cells, the effects on cell-cycle arrest can be observed.

(B) The expression levels of cell cycle- and cellular senescence-related proteins after transfection with sh-CALB2 and sh-CDKN2A plasmids.

(C) SA-β-gal staining showed that knocking down CDKN2A suppressed the cellular senescence phenotype induced by knocking down CALB2. Scale bars, 50 μm. (n = 3 per group).

(D and G) CCK-8 and colony formation assays revealed that transfection with the sh-CALB2 plasmid led to decreased cell proliferation and colony formation ability. However, co-transfection with sh-CDKN2A rescued these phenotypes. G₁: colony formation images; scale bars, 10 mm. G₂: quantitative analysis of images. ∗∗∗ for p < 0.001. Data are represented as mean ± SD. (n = 3 per group).

(E, F, and H) Wound healing and transwell cell migration assays demonstrated differential cell migration capacities among groups following transfection with respective plasmids. E₁, F₁: cell wound healing images; scale bars, 200 μm. H₁: transwell cell migration images; scale bars, 100 μm. E₂, F₂, H₂: quantitative analysis image. ∗∗ for p < 0.01 and ∗∗∗ for p < 0.001. Data are represented as mean ± SD (n = 3 per group). Statistical significance in this figure was determined using one-way ANOVA.

Discussion

Despite continuous advancements in the research and treatment of ccRCC, numerous challenges persist. For localized tumors, surgical resection can achieve satisfactory outcomes.⁸ However, approximately 40% of patients experience recurrence and distant metastasis each year after surgery.²⁶ For advanced/metastatic ccRCC, chemotherapy and radiotherapy show limited sensitivity,²⁷ and immune checkpoint inhibitors (ICIs) and tyrosine kinase inhibitors (TKIs) remain the primary treatment options.^28,29,30 Nevertheless, patients with advanced ccRCC typically develop resistance to TKI therapy within 6–15 months.³¹ Tumor progression also frequently occurs in patients treated with ICIs, necessitating subsequent further treatment.^10,31,32 In this study, we found that the expression level of C8orf76 in ccRCC is significantly higher than that in normal tissues. Moreover, C8orf76 promotes the progression of ccRCC by regulating downstream effectors and signaling pathways.

C8orf76 is a nuclear protein-encoding gene first identified for its ability to bind specific lncRNAs in gastric cancer and promote tumor progression.¹¹ Additionally, C8orf76 also plays roles in the occurrence and development of multiple tumors.^12,33,34 However, the current understanding of C8orf76 remains superficial. No large-scale studies have deeply explored its mechanism of action, and the potential role of C8orf76 in renal cancer lacks sufficient literature data support. Against this backdrop, we conducted a study and for the first time reported the biological status and mechanism of action of C8orf76 in ccRCC. We found that C8orf76 was highly expressed in ccRCC, and high expression of C8orf76 predicted poor prognosis. C8orf76 knockdown caused G1 phase arrest in the cell cycle, activated cellular senescence, and inhibited tumor cell proliferation and migration both in vivo and in vitro. These results indicate that C8orf76 mediates the progression of ccRCC through the cellular senescence signaling pathway, which warrants further investigation.

By reviewing the literature¹¹ and integrating RNA-seq results, we screened out CALB2 as a potential interactor of C8orf76. CALB2 belongs to the calmodulin family, and its primary biological functions involve calcium homeostasis regulation and signal transduction modulation. CALB2 has been shown to promote the progression of various tumors.^13,16 However, its role in ccRCC remains poorly documented. This study found that CALB2 is upregulated in ccRCC and that the high expression of CALB2 is associated with poor prognostic outcomes. Similar to C8orf76, CALB2 knockdown induced G1 phase cell-cycle arrest, cellular senescence, and inhibited the proliferation and migration of ccRCC cells. We further elucidated the functional relationship between C8orf76 and CALB2. Overexpression of CALB2 in C8orf76-knockdown ccRCC cell lines suppressed cell-cycle arrest and cellular senescence, and significantly rescued the proliferative and migratory capacities of tumor cells both in vitro and in vivo. Additionally, dual-luciferase reporter assays confirmed that C8orf76 directly binds to the promoter region of CALB2 to promote its transcription. Thus, CALB2 acts as a downstream effector of C8orf76 to exert its biological functions.

Cellular senescence refers to a unique state of cell-cycle arrest, which has been widely discussed due to its dual roles in tumors.³⁵ CKIs represent a critical component in the occurrence of cellular senescence, primarily functioning through the p53/p21 and p16/pRb pathways.³⁶ The p53 protein directly binds to the promoter region of CDKN1A to promote the transcription of p21CIP1, thereby inducing cell-cycle arrest and cellular senescence.^37,38 Similar findings have been reported in RCC.^39,40 On the other hand, the p16INK4a protein, encoded by the CDKN2A gene, shows low expression or loss in RCC.⁴¹

Notably, in the present study, Reactome pathway enrichment analysis also revealed the presence of relevant regulatory signals at the G2/M phase. This observation may suggest that C8orf76 exerts functional roles across multiple stages of the cell cycle.

Nevertheless, although pathway analysis implies the possibility of multi-stage regulation, our flow cytometry assays yielded the following findings: in the 769-P cell line (Figure 3C) and the 786-O cell line (Figure 6A), knockdown of C8orf76 resulted in a significant increase in the proportion of cells at the G0/G1 phase, whereas no consistent significant changes were detected in the proportions of cells at the G2/M and S phases. Consistently, Figure S4B also indicated that in the Caki-1 cell line, overexpression of C8orf76 led to a marked decrease in the proportion of G0/G1-phase cells, with no statistically significant difference observed in the G2/M-phase cell proportion. These direct experimental findings constitute the core basis for our emphasis on G1-phase arrest.

In addition, the upregulation of p16INK4a is a canonical hallmark of G1-phase arrest. It inhibits the activity of CDK4/CDK6, thereby preventing the phosphorylation of the Rb protein and ultimately blocking cells from entering the S phase. As for the G2/M-phase signals identified in the Reactome analysis, we speculate that these may be a secondary effect induced by cell cycle perturbation, or a reflection of the multifunctional properties of C8orf76 across distinct cell cycle stages, which warrants further in-depth investigation in subsequent studies.

In this study, we found that further knockdown of CDKN2A in stably CALB2-knockdown ccRCC cell lines significantly suppressed cell-cycle arrest and cellular senescence, and partially restored the proliferative and migratory capacities of tumor cells. These results indicate that the C8orf76/CALB2 axis promotes the proliferation and migration of ccRCC by inhibiting the cellular senescence pathway, potentially involving the p16/pRb signaling cascade.

Given the critical role of the cellular senescence pathway in cancer therapy, multiple related drugs have been developed clinically. For example, the selective CDK4/6-targeted agent palbociclib has achieved new progress in breast cancer treatment.⁴² This study supports the development of inhibitors targeting the C8orf76/CALB2 axis to activate the downstream cellular senescence pathway and inhibit the progression of ccRCC.

Limitations of the study

Although our findings suggest that the C8orf76/CALB2 axis exerts its regulatory function through the cellular senescence pathway, the precise molecular mechanisms underlying this process remain to be fully elucidated and warrant further in-depth experimental investigation. Additionally, the p53/p21 pathway also plays a significant role in ccRCC cell senescence. Whether there is a further relationship between the C8orf76/CALB2 axis and this pathway remains unexplored. Uncovering the potential crosstalk between these pathways will be the focus of our future research endeavors, which may provide potential insights into the pathogenesis and therapeutic targets of ccRCC.

Resource availability

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Ben Liu (drliuben@zju.edu.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

• •In compliance with national regulations regarding the sharing of human genetic resources, the RNA sequencing data must be managed under controlled access. Data have been deposited at SRA as SRA: PRJNA1428528 and are publicly available. All data reported in this article will be shared by the lead contact upon request.
• •This paper does not report original code.
• •Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (82273132, 82403933, and 82573582), the Medical and Health Research Project of Zhejiang Province (2024KY065), Key Research and Development Program of Zhejiang Province (no. 2025C02071), China Postdoctoral Science Foundation grant (2023M743022).

Author contributions

The conception and design of the study: B.L., D.L.; the acquisition of data: Y.L., X.N., P.L., F.Z., Z.Q., K.Y.; analysis and interpretation of data: X.M., J.S., S.H., Y.S., X.S.; drafting the article or revising it critically for important intellectual content: Y.L., X.N., D.L.; final approval of the version to be submitted: all authors.

Declaration of interests

The authors declare no competing interests.

Declaration of generative AI and AI-assisted technologies in the writing process

During the preparation of the manuscript, we utilized “DeepSeek” AI to enhance the linguistic logic and coherence of the text. Following the use of this tool, we carefully revised and modified the content as necessary, and we assume full responsibility for all content in this publication.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
C8orf76	Abnova	Cat#H00084933-B01P; RRID:AB_1571864
CALB2	Proteintech	Cat#12278-1-AP; RRID:AB_2228338
p16INK4a	Abcam	Cat#ab211542; RRID:AB_2891084
CDK4	Proteintech	Cat#11026-1-AP; RRID:AB_2078702
CDK6	Proteintech	Cat#14052-1-AP; RRID:AB_10642144
Lamin B1	Proteintech	Cat#12987-1-AP; RRID:AB_2136290
FOXM1	Proteintech	Cat#13147-1-AP; RRID:AB_2106213
β-actin	Proteintech	Cat#66009-1-Ig; RRID:AB_2687938
HRP conjugated Goat Anti-Mouse IgG (H + L)	Servicebio	Cat#GB23301; RRID:AB_2904020
HRP conjugated Goat Anti-Rabbit IgG (H + L)	Servicebio	Cat#GB23303; RRID:AB_2811189
Biological samples
clear cell renal cell carcinoma tissues and paired peritumoral tissues	The First Affiliated Hospital of Zhejiang University School of Medicine	N/A
BALB/c-nu mice	Hangzhou Medical College	N/A
Chemicals, peptides, and recombinant proteins
RPMI 1640 medium	Gibco	Cat#11875119
Fetal bovine serum	Gibco	Cat#10270107
Trypsin-EDTA	Gibco	Cat#3043768
DMEM	Gibco	Cat# 10569044
MEM	Procell	Cat# PM150410
TRIzol reagent	Invitrogen	Cat# 15596018CN
Lipofectamine 3000 transfection reagent	Invitrogen	Cat# L3000001
Critical commercial assays
Senescence β-Galactosidase Staining Kit	Beyotime	C0602
Annexin V-FITC/PI Apoptosis Detection Kit	Vazyme	A211
Deposited data
RNA sequence data	This paper	NCBI: PRJNA1428528
Experimental models: Cell lines
Human: 786-O	Cell Bank, Chinese Academy of Sciences	N/A
Human: 769-P	Cell Bank, Chinese Academy of Sciences	N/A
Human: A-498	Cell Bank, Chinese Academy of Sciences	N/A
Human: Caki-1	Cell Bank, Chinese Academy of Sciences	N/A
Oligonucleotides
β-Actin-F	Tsingke Biotechnology Co., Ltd.	ATCATGAAGTGTGACGTGGAC
β-Actin-R	Tsingke Biotechnology Co., Ltd.	GACTCGTCATACTCCTGCTTG
C8orf76-F	Tsingke Biotechnology Co., Ltd.	TTATACGAACCAGGCTTCTGC
C8orf76-R	Tsingke Biotechnology Co., Ltd.	GCCAACACACTTCACCTCTG
CALB2-F	Tsingke Biotechnology Co., Ltd.	ACTTTGACGCAGACGGAAATG
CALB2-R	Tsingke Biotechnology Co., Ltd.	GAAGTTCTCTTCGGTTGGCAG
Recombinant DNA
Sh-C8orf76	Ribobio Co., Ltd.	ACCGGGAGTATAAATGATTATTTATTCAAGAGATAA ATAATCATTTATACTCTTTTTTGAATTC
Sh-CALB2	Ribobio Co., Ltd.	ACCGGAGAGTTTACAGACAATAAATTCAAGAGATTT ATTGTCTGTAAACTCTTTTTTTGAATTC
Sh-CDKN2A	Ribobio Co., Ltd.	ACCGGGAACCAAAGCTCAAATAAATTCAAGAGATTT ATTTGAGCTTTGGTTCTTTTTTGAATTC
Software and algorithms
FlowJo Software	FlowJo LLC	Version 10.8.1
ImageJ Software	ImageJ	Version 1.48v
GraphPad Prism Software	GraphPad	Version 10.0
Modfit Software	Modfit LT	Version 5.0
Other
Raw and analyzed data	This paper	N/A

Experimental model and study participant details

Cell lines and cell culture

HEK-293T, HK-2, A-498, Caki-1, 769-P and 786-O cell lines were obtained from the Chinese Academy of Sciences Shanghai Cell Bank. HEK-293T cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. A-498 cells were cultured in MEM medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. HK-2, Caki-1, 786-O and 769-P cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. All cell lines are regularly tested for mycoplasma contamination. All cell lines were cultured in a humidified atmosphere at 37°C with 5% CO₂.

Clinical samples

Clear cell renal carcinoma (ccRCC) tissues and matched adjacent normal tissues were obtained from patients diagnosed at the First Affiliated Hospital of Zhejiang University School of Medicine. This study was approved by the Medical Ethics Committee of the First Affiliated Hospital, Zhejiang University School of Medicine. The ethical approval number is 2026-SD-003.

Tumor xenografts in nude mice

A total of 20 SPF-grade male Balb/c nude mice were used in this study. The quality certification number is SCXK (Zhe) 2024-0037. All nude mice were 4 weeks of age. All experiments were performed in accordance with relevant regulatory standards.

Method details

Western blot

Protein concentrations were measured utilizing a bicinchoninic acid protein assay kit. An equivalent quantity of protein (30 μg) was subjected to SDS-PAGE gel electrophoresis and transferred onto polyvinylidene difluoride membranes. After a blocking step with 5% non-fat dried milk in Tris-buffered saline containing Tween 20 (TBST) for 1.5 h at room temperature (RT), the membranes were subjected to primary antibodies specific to each target protein, followed by overnight incubation at 4°C. The next day, the membranes were washed three times with TBST before being treated with horseradish peroxidase-conjugated secondary antibodies for 2 h at RT. Protein bands were identified using an enhanced chemiluminescence (ECL) detection system. β-Actin was used as an internal control.

Quantitative real-time PCR

Total RNA was extracted from cell samples and stored at −80°C using RNAiso Plus Reagent, ensuring the genomic DNA contamination was removed, according to the manufacturer’s instructions. RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using the cDNA Reverse Transcription Kit (Vazyme, China) following the protocol. Quantitative real-time PCR (qPCR) was performed with SYBR qPCR Mix (Vazyme, China) on a Biorad CFX96 Detection System. The qPCR data were analyzed using the ΔΔCT method for relative quantification, normalizing to the β-actin. Data were analyzed using GraphPad Prism software (GraphPad Software10.0).

Cell counting kit-8 (CCK-8) assay

Seed cells at an appropriate density (800–1000 cells/well) in a 96-well plate with 100 μL of cell culture medium per well. Incubate the plate in a humidified CO2 incubator (e.g., 37°C, 5% CO2) for 24 h to allow cell attachment. Addition of CCK-8 Solution (Fude Bio, Hangzhou, China): Add 10 μL of CCK-8 solution to each well of the plate. Put the plate to the incubator and incubate for 1 h. Measure the absorbance at 450 nm using a microplate reader. Calculate the cell viability by comparing the absorbance values of the test wells to those of the control wells.

Colony formation assay

Cell proliferation ability was detected by clonal formation assay.⁴³ Seed 800–1000 cells per well in a 6-well plate. Incubate the cells in a humidified incubator at 37°C with 5% CO2 for approximately 1–3 weeks, changing the medium every 5 days and monitoring cell growth. Once visible colonies have formed, terminate the culture. Wash the cells with PBS, then fix with 4% polyoxymethylene for 30 min. After washing again, stain with crystal violet for 30 min. Count the number of colonies under a microscope for later analysis. Colonies are typically defined as groups of 50 or more cells. Plating Efficiency = (Number of Colonies/Number of Cells Seeded) × 100%.

Wound healing assay

Cells were seeded into 6-well plates at an appropriate density (e.g., 2–5 × 10⁵ cells per well, depending on cell type) and cultured in complete medium until they reached 90–100% confluence. A sterile 200 μL plastic pipette tip was used to create a uniform scratch across the cell monolayer. Care was taken to maintain a consistent angle and pressure during scratching. After wounding, the culture medium was aspirated gently to remove detached cells, and the wells were rinsed once or twice with PBS to eliminate cell debris. Fresh culture medium (with reduced serum to minimize proliferation) was then added. Immediately after scratching (0 h), reference images of the wounds were captured using an inverted optical microscope equipped with a camera. The plates were then returned to the incubator and allowed to migrate for 24h. At each designated time point, the same wound areas were re-imaged. The gap distances of migrating cells were measured using image analysis software (e.g., ImageJ), and the wound closure rate or percentage of wound healing was calculated to assess cell migration ability.

Transwell cell migration assay

Cell migration assay was performed with transwell chamber (Corning, USA) according to the standard method. 600 μL of complete media was added to the lower chamber, and 200 μL of medium containing 1 × 10⁴ cells in serum-free RPMI-1640 was put in the upper chamber (8-mm pore size, Corning). After being cultured for 24 h, cells were fixed with 4% paraformaldehyde for 15 min and then stained with crystal violet for half an hour. Five fields per well were randomly selected and images were acquired by a optical microscope.

Senescence associated β-galactosidase (SA-β-gal) staining

The Senescence-Associated β-Galactosidase Staining Kit was purchased from Beyotime (Shanghai, China). For the assay, 786-O and 769-P cells were seeded in 6-well plates at an appropriate density and cultured until they reached the desired confluence. The culture medium was then removed, and the cells were gently washed once with PBS. Subsequently, the cells were fixed using the fixative solution provided in the kit at room temperature for 15 min. After fixation, the cells were washed twice with PBS. The SA-β-gal staining working solution was freshly prepared according to the manufacturer’s protocol, comprising Staining Solution A, B, C, and X-Gal in specified proportions. This working solution was added to each well, ensuring that the cell monolayer was completely covered. To prevent evaporation, the plates were sealed with Parafilm and incubated overnight at 37°C in a dry incubator (without CO₂). Following incubation, the staining working solution was removed, and the cells were overlaid with PBS. Stained cells were observed under an optical microscope, with SA-β-gal positive cells exhibiting blue cytoplasmic staining. Images were captured from multiple random fields, and the proportion of positive cells was quantified using ImageJ software (version 1.48v).

Cell cycle flow cytometry

The cell cycle flow cytometry was conducted using the Cell Cycle Staining Kit following the manufacturer’s instructions. Briefly, cells were harvested by trypsinization, washed with PBS, and fixed in ice-cold 70% ethanol at 4°C overnight. After fixation, cells were centrifuged to remove ethanol, washed again with PBS, and resuspended in the staining solution provided in the kit. The cell suspension was incubated at room temperature in the dark for 30 min. Stained cells were then analyzed using a flow cytometer. Data were analyzed using FlowJo 10.8.1 and Modfit LT 5.0 software to determine the percentages of cells in G0/G1, S, and G2/M phases.

Plasmids transfection

Seed cells in a 6-well plate at a density that allows for 60–70% confluence on the day of transfection. Incubate the cells in an incubator at 37°C with 5% CO2. For each well, dilute 1 μg of plasmid DNA and Lipofectamine 3000 or JetPRIME transfection agents in buffer according to each protocol. Lipofectamine 3000 needs to be diluted before mixing with DNA. Incubate for 20 min at room temperature to allow the formation of transfection complexes. While the transfection complexes are forming, replace the medium in the cell culture wells with 1500 μL of fresh medium without serum. Add the transfection complexes dropwise to the cells and gently rock the plate to ensure even distribution. Return the plate to the incubator for 8 h to allow for transfection. After the incubation period, remove the transfection medium and replace it with 1 mL of complete growth medium (containing serum and antibiotics) to support cell growth and expression of the transfected gene.

Lentiviral construction

Day 0: Seed 293T cells into 6-well plates at a density of 1.0∗10^∧6 cells per well in 2 mL of lentivirus packaging medium. Incubate overnight at 37°C, 5% CO₂ to reach 70% confluence. Day 1: Prepare the transfection complexes by mixing 3 μg of the transfer vector and 9 μg of packaging plasmids with JetPRIME transfection agents in Opti-MEM medium according to the manufacturer’s instructions. Incubate for 10–20 min at room temperature. Replace medium in each well with 1 mL of fresh lentivirus packaging medium. Add the lipid-DNA complex to each well, gently agitating the plate to distribute the mixture evenly. Incubate overnight at 37°C, 5% CO₂. Day 2: Replace the medium containing the lipid-DNA complexes with 2 mL of pre-warmed lentivirus packaging medium. Return the plate to the incubator overnight. Collect the supernatant containing the virus and store at 4°C. Replace the collected medium with 2 mL of fresh lentivirus packaging medium. Day 3: Collect the second batch of supernatant. Combine this with the first collection and centrifuge at 2,000 rpm for 10 min at room temperature to remove cellular debris. Filter the supernatant through a 0.45 μm filter to remove any remaining debris. Aliquot the virus into cryovials and store at −80°C.

Dual-luciferase reporter gene assay

293T cells were used to detect dual-luciferase according to Promega protocol as described in the literature.⁴⁴ Briefly, plate cells in 24-well plates at a density of 100,000 cells/well in appropriate medium. The next day, co-transfect cells with the firefly luciferase reporter plasmid (under the control of the promoter of interest) and the Renilla luciferase control plasmid using Lipofectamine 3000. Incubate cells at 37°C with 5% CO2 overnight to allow for plasmid uptake and expression. Remove medium and wash cells with PBS. Lyse cells using 0.1 mL of Passive Lysis Buffer (PLB) per well. Aliquot lysates (5–20 μL) into duplicate wells of a white 96-well plate. Initiate bioluminescence by automatic injection of 0.1 mL of LAR II into the lysates. After a 1-min delay, record the firefly luciferase emission signals using a microplate luminometer. Quench the firefly luciferase signal and activate Renilla luciferase by adding Stop & Glo Reagent. Record the Renilla luciferase emission signals. Normalize the firefly luciferase activity to the Renilla luciferase activity to account for transfection efficiency and cell viability. Calculate the fold-change of transcriptional activity by comparing the normalized luciferase activity in the presence of the transcription factor to the vector control condition.

Chromatin immunoprecipitation-qPCR (ChIP-qPCR)

Chromatin immunoprecipitation was performed with the ChIP kit. First, when the density of ccRCC cells reaches 80%–90% in a 15 cm culture dish, gently wash once with ice-cold PBS. Add 10 mL of 1% paraformaldehyde per dish and incubate on a rocking platform (50 rpm) at room temperature for 10 min for crosslinking. Add pre-chilled glycine to a final concentration of 0.125 M and continue incubating on the rocker for 5 min. Then, wash twice with ice-cold PBS, scrape the cells, and transfer them to a 5 mL centrifuge tube. Centrifuge at 500×g for 5 min at 4°C to collect the pellet. Resuspend the pellet in 1 mL of pre-chilled Cell Lysis Buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% NP-40, 1× protease inhibitor) and lyse on ice for 15 min. Next, transfer the lysate to a sonicator. Set the parameters to 40% amplitude, with 30-s pulses followed by 30-s rest intervals, for a total of 8 cycles, to fragment the DNA to 200–500 bp. After that, take 50 μL of the post-sonication lysate as the Input group, flash-freeze in liquid nitrogen, and store at −80°C. Centrifuge the remaining sample at 11,600×g for 10 min at 4°C to remove debris. Transfer the supernatant to a new tube and add 5 μg of target monoclonal antibody and IP Buffer (to a final volume of 600 μL: 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% Triton X-100). Incubate with rotation at 4°C for 4 h. Then, add 50 μL of pre-blocked Protein A/G magnetic beads (washed 3 times with PBS) and incubate with rotation overnight at 4°C. The next day, wash the beads sequentially with Low-Salt Wash Buffer, High-Salt Wash Buffer, LiCl Wash Buffer, and Tris-EDTA Buffer (1 mL each, with rotation at 4°C for 5 min per wash). Last, discard the supernatant and add 50 μL of Elution Buffer (100 mM NaHCO₃, 1% SDS). Elute by incubating in a metal bath at 65°C for 15 min. Collect the eluate, add 5 μL of 5 M NaCl, and incubate at 65°C for 6 h to reverse crosslinking. Add 1 μL of RNase A (10 mg/mL) and 10 μL of Proteinase K (20 mg/mL), and digest at 45°C for 1 h. Purify the DNA using a DNA purification kit, eluting in a final volume of 30 μL. The subsequent steps are in accordance with qPCR.

Immumohistochemical (IHC) staining

Immumohistochemical staining was performed as described in the previous study.⁴⁵ Tumor tissue specimens were obtained from nude mice and fixed in 10% neutral buffered formalin for 24 h at RT to preserve cellular morphology and antigenicity. The fixed tissues were embedded in paraffin wax and sectioned into 4 μm thick slices using a microtome. The sections were mounted onto silane-coated slides and allowed to dry at 60°C on a hot plate. Paraffin was removed by incubating the slides in xylene, and the sections were rehydrated in a graded ethanol series and distilled water. Antigen retrieval was performed through heat treatment in sodium citrate buffer (pH 6.0) utilizing a water bath. The samples were incubated with a 3% hydrogen peroxide solution in distilled water for 10 min to inhibit endogenous peroxidase activity. Subsequently, sections were incubated with normal serum from the same species as the secondary antibody to diminish instances of non-specific binding. The diluted primary antibodies were applied to the sections and allowed to incubate at RT for 1 h. The slides were washed with TBST three times for 5 min each to eliminate unbound primary antibodies. Secondary antibodies were administered and incubated for 30 min at RT. The antigen-antibody complex was visualized using a chromogenic substrate, DAB, resulting in a brown color reaction at the antigen site. The sections were counterstained with hematoxylin for 1 min to yield a blue nuclear contrast. Tissue sections were systematically dehydrated using a graded ethanol series, thereafter mounted in an aqueous-based medium, and sealed with precisely cut glass coverslips. The slides were examined under a light microscope to visualize the specific antigen localization within the tissue sections.

Ethical statement

Written informed consent was gained from all participants based on the guidelines of the Declaration of Helsinki. The collection of human samples and operation of animals in our study were approved by the Medical Ethics Committee of the First Affiliated Hospital, Zhejiang University School of Medicine. The ethical approval number is 2026-SD-003. A total of 20 SPF-grade male Balb/c nude mice were used in this study. The quality certification number is SCXK (Zhe) 2024-0037. All nude mice were 4 weeks of age. All experiments were performed in accordance with relevant regulatory standards.

Quantification and statistical analysis

All in vitro experimental procedures conducted were repeated a minimum of three times to ensure reproducibility. For the in vivo studies, each experimental group was comprised of five BALB/c-nu mice. The survival data were assessed utilizing the Kaplan-Meier method, with the log rank test. The statistical processing of the data was carried out employing Prism 10.0 software by GraphPad. The data are presented as means ± SDs from at least three independent experiments. Both unpaired Student’s t-tests for parametric data and nonparametric tests were implemented to determine p-values. In detail, the normality of the data distribution was initially assessed using the normal-test function available in Prism 10.0, ensuring the applicability of the parametric t test. For datasets that deviated from a normal distribution, non-parametric tests were employed. When the F test in the parametric t test indicated statistical significance at a p-value less than 0.05, Welch’s correction was applied to adjust the data. A p-value threshold of less than 0.05 was set to define statistical significance. Results without statistical significance were denoted as ns, while significant differences were indicated with asterisks: ∗ for p < 0.05, ∗∗ for p < 0.01, ∗∗∗ for p < 0.001, and ∗∗∗∗ for p < 0.0001.

Published: March 30, 2026