Involvement of Fibro-Adipogenic Progenitors and Cellular Communication Network Family Signaling in the Impaired Muscle Regeneration of Wooden Breast

Abstract

Wooden Breast is a myopathy affecting broiler chickens, characterized by hardening of the pectoral muscle, fibrosis, adipogenesis, and deteriorated meat quality. This study investigated the pathological mechanisms underlying wooden breast development, focusing on the interplay between fibrogenesis and myogenesis. Seventy-eight broiler chickens were categorized into normal, mild, and severe wooden breast groups based on the extent of fibrosis and adipogenesis in the pectoral muscle. Histological analysis revealed immature collagen fibers within muscle fascicles in severe wooden breast, indicating concurrent fibrogenesis and muscle regeneration. Immunofluorescence staining confirmed the close spatial localization of fibro-adipogenic progenitors (FAPs) and myosatellite cells in these areas, suggesting potential interaction during wooden breast pathogenesis. RNA sequencing and qPCR revealed upregulation of PAX7 and MYOG, markers of myogenesis, in the affected pectoral muscle, whereas MYOD expression remained unchanged. This pattern indicates an attempt at myogenic differentiation that is ultimately disrupted in severe wooden breast samples. Furthermore, cellular communication network (CCN) family members, particularly CCN2 and CCN4, were upregulated in the wooden breast-affected pectoral muscle. CCN4 expression strongly correlated with the fibro-adipogenic progenitor marker PDGFRα, implying that fibro-adipogenic progenitors-mediated CCN4 secretion contributes to wooden breast pathogenesis. Our findings suggest that fibro-adipogenic progenitors and cellular communication network family members are associated with an imbalance between fibrogenesis and myogenesis, leading to the muscle degeneration observed in wooden breast.

Introduction

The increasing global demand for poultry meat has driven intensive efforts in selective breeding and nutritional strategies to maximize muscle yield in broiler chickens. This pursuit of enhanced growth performance, however, has been accompanied by an unwelcome increase in muscle myopathies, particularly Wooden Breast (WB). WB, which primarily affects the pectoralis major muscle (PM), is characterized by palpable firmness, along with discoloration, edema, and petechial hemorrhages. Histopathological hallmarks include myofiber hypertrophy and necrosis, inflammation, fibrosis, and adipogenesis[1]. These changes compromise meat quality, leading to substantial economic losses due to product downgrading and consumer rejection[2]. The absence of overt clinical signs in affected birds complicates antemortem diagnosis, underscoring the need for a deeper understanding of the underlying histopathological mechanisms to support early detection and preventive strategies.

A prevailing hypothesis for WB development centers on the inability of the vascular supply to keep pace with rapid PM growth, resulting in chronic ischemia and the subsequent cascade of histopathological changes[3]. Muscle regeneration following injury typically progresses through two phases: an initial phase of myofiber necrosis and inflammation, followed by a regenerative phase driven by myosatellite cell activation[4]. In the latter phase, quiescent myosatellite cells are activated in response to injury, proliferate and differentiate into myoblasts that fuse to form myotubes, ultimately restoring muscle integrity[5]. When regeneration is insufficient, myofiber atrophy can occur because of the loss of intracellular organelles, cytoplasm, and proteins[6].

Unlike typical muscle injury responses, WB is characterized not only by inflammation and regenerative failure but also by prominent fibrosis[7]. Recent studies of mammalian skeletal muscle regeneration have implicated dysregulation of fibro-adipogenic progenitors (FAPs), mesenchymal progenitor cells residing in the interstitial space between muscle fibers, in the development of fibrosis and adipogenesis[5]. Emerging evidence from gene expression analyses suggests a similar role for FAPs in the pathogenesis of WB in chickens[8,9,10].

In mammals, key regulators of skeletal muscle regeneration include paired box 7 (PAX7), myoblast determination 1 (MYOD), and cellular communication network factors (CCNs)[11]. Importantly, CCNs influence not only myogenesis but also FAP behavior, modulating fibrosis and adipogenesis[5,11]. Four CCN family members (CCN1-4) have been implicated in mammalian skeletal muscle dynamics. CCN1 promotes FAP activation and adipogenic differentiation, while also inhibiting the fibrogenic differentiation of FAPs and the proliferation of myosatellite cells[12,13]. CCN2, conversely, enhances fibrogenesis, which may be mediated by FAPs[11,14]. CCN3 and CCN4 (known as Wnt-induced secreted protein 1, WISP1) contribute to myoblast adhesion and myosatellite cell proliferation, respectively[5,15]. Notably, reduced CCN4 expression in aged mice impairs muscle regeneration and exacerbates fibrosis[5].

Chickens possess six identified CCN family members, mirroring the mammalian system. We hypothesized that CCNs play a crucial role in the fibrogenic mechanisms underlying WB in chickens. To investigate this, we examined the involvement of CCN family members in WB pathogenesis using histomorphological and molecular analyses of broiler PM.

Materials and Methods

Animals and specimens

Seventy-eight male broiler chickens (ROSS 308) were raised at the university farm on a standard commercial diet. At 47–50 days of age, they were euthanized by exsanguination under deep anesthesia induced by intraperitoneal injection of 20–30 mg/kg pentobarbital sodium (Somnopentyl; Kyoritsu Pharmaceutical Co., Tokyo, Japan). For histological analysis, the PMs were cut into 2×2×1 cm cubes, fixed in 4% paraformaldehyde at 4°C overnight, and embedded in paraffin blocks according to standard procedures. For gene expression analysis, 77 out of 78 PMs were collected and immersed in RNAlater (QIAGEN, Venlo, Netherlands) at 4°C overnight. The RNAlater solution was removed the following day, and the samples were stored at -80°C.

Evaluation of fibrosis and adipogenesis

Paraffin blocks were sectioned at 4 μm, and serial sections were mounted on MAS-coated slides (Matsunami Glass Ind., Ltd., Osaka, Japan). Sections were deparaffinized, rehydrated, and stained with picrosirius red (PSR) using a commercial kit (Polysciences, Inc., Warrington, PA, USA). Fibrotic and adipogenic areas were quantified as previously described[3]. Briefly, five or more images centered on muscle fascicles were randomly captured from each bird. The fibrotic and adipogenic areas within each image were measured using Image-Pro Premier version 10.0.04 (Media Cybernetics, Inc., Rockville, MD, USA) and expressed as a percentage of the total image area. The fibrotic and adipogenic rates were calculated as follows: % = 100 × [whole muscle area – myofiber area]/whole muscle area. The average percentage across all images for each bird was used to classify WB severity into three simplified stages, based on the six-stage classification defined in our previous study[3]: normal (< 20%, n = 37), mild (20–30%, n = 26), and severe (> 30%, n = 14). The mean values ± standard deviation (SD) for each stage were 13.1 ± 3.6, 24.8 ± 3.0, and 42.4 ± 7.4, respectively. Sections with very severe fibrosis (> 40%, n = 8) were further analyzed under polarized light microscopy to assess collagen fiber thickness[16].

Double-immunofluorescence staining for myosatellite cells and FAPs

Immunofluorescence staining was performed on sections from birds with normal, mild, and severe WB to analyze the expression of PAX7, a marker of myosatellite cells, and platelet-derived growth factor receptor alpha (PDGFRα), a marker of FAPs. Sections were deparaffinized, and antigen retrieval was performed using Histo VT One (Nacalai Tesque Inc., Kyoto, Japan) at 90°C for 20 min. Sections were then incubated with blocking reagent (Blocking one Histo; Nacalai Tesque Inc.) for 10 min at room temperature. For PDGFRα detection, sections were incubated overnight at 4°C with mouse primary antibody against PDGFRα (8E12F2; Novus Biologicals, LLC, Littleton, CO, USA), diluted 1:2,000 (0.5 µg/mL) in immune reaction enhancer solution (Can Get Signal immunostain Solution A; TOYOBO Co., Ltd., Osaka, Japan). After three washes with 0.01 M phosphate-buffered saline (PBS), the sections were incubated with polymer horseradish peroxidase (HRP)-conjugated secondary antibody (Opal Multiplex IHC Kit; Perkin Elmer Co., Waltham, MA, USA) for 10 min at room temperature, and the immune complex was visualized with a fluorophore solution (Opal 520 Fluorophore; Perkin Elmer Co.) for 10 min at room temperature. The glass slides were then treated in a microwave to strip the primary-secondary-HRP complex and allow the introduction of another mouse primary antibody according to the manufacturer’s instructions for the Opal Multiplex IHC Kit. After three washes with 0.01 M PBS, the sections were incubated overnight at 4°C with a mouse primary antibody against PAX7 (DSHB Hybridoma Product PAX7; deposited by A. Kawakami), diluted 1:100 (0.23 µg/mL), to detect PAX7. After three washes with 0.01 M PBS, the sections were incubated with CF594-conjugated goat anti-mouse immunoglobulin G (IgG) antibody (Biotium Inc., Fremont, CA, USA), diluted 1:300, for 3 h. After three washes with 0.01 M PBS, the sections were mounted with mounting reagent (Fluoro-KEEPER Antifade Reagent; Nacalai Tesque Inc.), covered with coverslips, and observed using a fluorescence microscope (ECLIPSE Ni; Nikon Co., Tokyo, Japan) equipped with Alexa 488 and 568 filters.

RNA extraction

Total RNA was extracted from a single site within the PM in each bird using RNeasy Plus Universal Mini Kits (QIAGEN) according to the manufacturer’s instructions. The left and right sides of the muscle were considered equivalent for these analyses. Purified total RNA was then used as the template for complementary DNA (cDNA) synthesis using Rever Tra Ace qPCR RT Master Mix (TOYOBO Co., Ltd.).

RNA-Sequencing (RNA-seq)

Based on the fibrotic and adipogenic rate measurements, RNA sequencing was performed using total RNA from the three chickens with the lowest values (< 10%) and the three chickens with the highest values (> 40%). Sequencing libraries were prepared with NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA). Libraries were sequenced on an Illumina NovaSeq 6000 using a 150 bp paired-end sequencing kit (Illumina Inc., San Diego, CA, USA). A total of six libraries were sequenced, yielding an average of 50.3 million raw reads per sample, ranging from 45.2 to 54.7 million reads. High sequencing quality was confirmed, with a mean quality score > 35.6 and more than 92.1% of bases exceeding a Phred quality score of 30 (Q30) in all samples. Sequencing reads were trimmed using cutadapt (ver. 1.18), and transcript abundance was quantified using Salmon (ver. 1.2.1) based on the chicken reference genome (GRCg6a). On average, 17.9 million read pairs were mapped per sample. Differential expression analysis was performed using the TCC R package (ver. 1.30.0). Genes with a q-value < 0.05 were defined as differentially expressed genes (DEGs). A volcano plot was generated using the EnhancedVolcano package (ver. 1.14.0) in R. ShinyGO 0.82 was used for gene ontology analysis using DEGs (227 upregulated genes and 117 downregulated genes) as input. A false discovery rate (FDR) < 0.01 was considered significant.

Quantitative real-time polymerase chain reaction

Quantitative real-time PCR (qPCR) analysis was performed on the cDNA using THUNDERBIRD SYBR qPCR Mix (TOYOBOCo., Ltd.) and gene-specific primers (Table 1). The qPCR was performed at 95°C for 1 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 45 sec. The qPCR was performed in duplicate, and the average of the obtained results was used as an indicator of the gene expression level in each sample. Relative expression levels were calculated using the ΔΔCt method. The amplification efficiency of all primer sets used in this study ranged from 0.89 to 0.98 (Table 1). Amplification efficiencies were used for primer quality control, and relative expression was calculated without efficiency correction. Ribosomal protein L30 (RPL30) was used as a housekeeping gene. This gene has been reported to show no difference in expression levels between normal broilers and white striping disease, a condition similar to WB[17], and the log₂ fold change was less than 0.05 in the RNA-seq analysis.

Table 1.   Primers used for quantitative PCR analysis.

Gene	Ref_seq	Forward primer	Reverse primer	Product size (bp)	Efficiency
PAX7	NM_205065	CTGCCTTTGAAGAGGAAGCA	TTGCTGAACCACACCTGAAC	170	0.981
MYOD	NM_204214	GACCCAAAGCATGGGAAGA	GCACTTGGTAGATTGGATTGCTG	255	0.921
MYOG	NM_204184	AGGCTGAAGAAGGTGAACGA	ATCGCTCAGGAGGTGATCTG	300	0.920
PDGFRα	NM_204749	ATGCTCTGGAGACAGCGAAG	TGGTCTTCTGGTAAGGAAGGAA	261	0.920
CCN1	NM_001031563	CAACGAGCTGATTGCCATCG	TGTCGTTGGTGACTCTGGTG	170	0.919
CCN2	NM_204274	ACTTAGCTCTGTACGTCTTCA	CACCAACGATAATGCTTTC	185	0.981
CCN3	NM_205268	ATGGCTGCATACAGACAGGAG	GATTTCTGTTGGTAACACGGGTAG	142	0.892
CCN4	NM_001024579	AAACTGCATCGTTCACACCTC	AGACAGCCAGGCACTTCTTC	188	0.895
RPL30	NM_001007967	ATGATTCGGCAAGGCAAAGC	GTCAGAGTCACCTGGGTCAA	201	0.929

Statistical analysis

Results are expressed as the mean ± standard error (SE). Data from the three groups were compared using one-way ANOVA followed by the Tukey-Kramer HSD test (P < 0.05). Correlations between two parameters were analyzed using Spearman’s correlation test.

Results

Fibrosis and Adipogenesis Assessment in PM

Based on fibrosis/adipogenesis rates, PM samples were classified into normal (< 20%), mild (20–30%), and severe (> 30%) WB groups (Figure 1). Compared with normal PM (Figure 1a), the mild and severe WB groups exhibited myofibers with a more rounded morphology and small or large vacuoles (Figure 1b and c). Both groups also displayed marked interfascicular and intermyofibrillar fibrosis and adipogenesis (Figure 1b and c). Severe WB muscles showed regenerating myofibers with a small caliber (SC) and split fibers, indicative of impaired muscle regeneration (Figure 1c). These findings suggest that elevated fibrosis/adipogenesis rates are associated with defective muscle regeneration in WB. Next, we focused on regions showing both fibrosis and regeneration in WB muscles. Under brightfield microscopy, PSR staining revealed fibrotic areas. Further analysis of these fibrotic areas under polarized light microscopy distinguished immature (green/yellow) and mature (red) collagen fibers within muscle fascicles (Figures 1d, e).

Fig. 1.

  Histological analysis of pectoralis muscle (PM) in broiler chickens with varying degrees of Wooden Breast (WB). Representative images of PM from chickens with normal (a), mild (b), and severe (c) WB, stained with picrosirius red to visualize collagen (red). D, degenerating myofiber; LV, myofiber with large vacuoles; SV, myofiber with small vacuoles; SC, small-caliber myofiber; Asterisk, adipose tissue; Dashed line, split fiber. Scale bars = 200 μm.

(d) Brightfield microscopy image of a picrosirius red-stained section showing fibrotic areas (red). (e) Polarized light microscopy image of the same area shown in (d), showing immature (green/yellow, arrow) and mature (red, arrow head) collagen fibers. Scale bars = 50 μm.

Localization analysis of FAPs and Myosatellite Cells

Under fluorescence microscopy, PAX7-positive myosatellite cells were scattered in normal birds, whereas PDGFRα-positive FAPs were not observed (Figures 2a–c). In contrast, clusters of PAX7-positive myosatellite cells and PDGFRα-positive FAPs in close proximity were identified in mild WB birds (Figures 2d–f). Both cell types were present in regions in which myofibers were degenerating or around thin regenerating myofibers, as shown in Figure 1. In severe WB, these positive cells were readily detected, consistent with the increased extent of regions containing degenerating and regenerating myofibers and fibrosis (Figures 2g–i). Negative controls using the antibody dilution buffer or mouse IgG isotype did not show any signal (Supplemental Figure S1).

Fig. 2.

  Immunofluorescence analysis across three stages showing PAX7 protein (myosatellite cell; a, d, g) and PDGFRα protein (FAP; b, e, h). Figures a–c, d–f, and g–i show representative images of normal, mild, and severe WB, respectively. Images c, f, and i are overlays of a and b, d and e, and g and h, respectively. Arrows indicate areas of degeneration and regeneration. Arrowheads indicate fibrotic areas. Bars = 50 μm. FAP: fibro-adipogenic progenitor, PAX7: paired box 7, and PDGFRα: platelet-derived growth factor receptor alpha.

Gene expression profiling by RNA-Sequencing

To investigate the molecular communication between FAPs and myosatellite cells in WB, RNA-seq was performed on normal and severe WB samples (n = 3 per group, Figure 3). Hierarchical clustering analysis revealed a clear separation between the normal and severe WB groups (Supplemental Figure S2). We identified 227 upregulated and 127 downregulated genes in severe WB compared with normal PM (Figure 3a). The lists of upregulated and downregulated genes are shown in Supplemental Tables S1 and S2, respectively. Gene ontology analysis revealed enrichment of upregulated genes in cytokine production and immune response pathways (Figure 3b), whereas downregulated genes were enriched in mitochondrial metabolism pathways (Figure 3c). Among the DEGs, CCN3 and CCN4, which are known to be secreted by FAPs and to be involved in muscle regeneration, were upregulated in severe WB (Figure 3a).

Fig. 3.

  Gene expression profiling of normal and severe WB muscles by RNA-seq. (a) Volcano plot showing differentially expressed genes (DEGs, defined by q-value < 0.05) between normal and severe WB-affected PM. CCN3 and CCN4 are highlighted. (b and c) Gene ontology (GO) enrichment analysis of upregulated (b) and downregulated genes (c). The top 10 enriched GO terms related to biological processes are shown for each. The x-axis in (b and c) represents −log₁₀(p.value).

Validation of gene expression by quantitative real-time PCR

To validate the RNA-seq findings and perform a more comprehensive analysis, qPCR was conducted on 77 PM samples (Figure 4). Expression of PAX7, a myosatellite cell marker, was significantly higher in both the mild and severe WB groups than in the normal group (Figure 4a). MYOD expression showed no significant difference among the groups (Figure 4b). MYOG, which promotes myoblast fusion into myotubes, was significantly upregulated in the severe WB group (Figure 4c). PDGFRα, a marker of FAPs, was significantly elevated in both the mild and severe WB groups (Figure 4d). CCN1 was upregulated in the mild WB group, but not in the severe WB group (Figure 4e). CCN2 and CCN3 were significantly upregulated in the severe WB group (Figure 4f, g), whereas CCN4 was upregulated in both the mild and severe WB groups (Figure 4h). The exact P-values for the qPCR analysis are provided in Supplemental Table S3.

Fig. 4.

   Validation of gene expression by quantitative real-time PCR (qPCR). mRNA expression levels of PAX7 (a), MYOD (b), MYOG (c), PDGFRα (d), and CCN family members (e-h, CCN1, CCN2, CCN3, and CCN4, respectively) in normal, mild, and severe WB muscle samples (n = 37, 26, and 14, respectively). Relative expression was normalized to RPL30 and expressed relative to the mean of the normal group (set as 1). Data are presented as mean ± standard error. Asterisks indicate significant differences (*P < 0.05, and **P < 0.005) as determined by one-way ANOVA with Tukey-Kramer HSD test for post-hoc comparisons.

Correlation Analysis between the Fibrosis/Adipogenesis Rate and Gene Expression Levels

Positive correlations were observed between the fibrosis/adipogenesis rate and the expression levels of PAX7, MYOG, and PDGFRα (Figure 5), suggesting increased muscle regeneration and FAP proliferation as fibrosis progressed. MYOD expression did not correlate with the fibrosis/adipogenesis rate or with the expression of other markers. Among the CCN family members, CCN1, CCN2, and CCN4 expression positively correlated with the fibrosis/adipogenesis rate and with the expression of PDGFRα, PAX7, and MYOG. CCN4 showed the strongest correlation with PDGFRα (Rho = 0.79), consistent with previous reports of FAP-mediated CCN4 secretion. CCN1 and CCN2 exhibited stronger correlations with PAX7 than with PDGFRα.

Fig. 5.

  Correlation analysis of fibrosis/adipogenesis rate and gene expression levels. Heatmap showing Spearman’s rank correlation coefficients (Rho) between the fibrosis/adipogenesis rate and the expression levels of PAX7, MYOG, PDGFRα, CCN1, CCN2, CCN3, CCN4, and MYOD. Color intensity represents the strength and direction of the correlation (blue = negative correlation, red = positive correlation and white = no correlation). Numerical values in each tile represent Rho.

Discussion

It is well established that fibrosis in WB-affected PM extends beyond the perimysium and endomysium, encroaching on the intermyofibrillar space[1,18]. Our observation of abundant immature collagen fibers within muscle fascicles of severe WB samples, particularly around small-caliber myofibers, strongly suggests a spatial association between muscle regeneration and fibrosis. This interpretation was further supported by immunofluorescence microscopy, which revealed PAX7-positive myosatellite cells and FAPs within fibrotic areas of the muscle fascicles[5]. While previous WB research has largely focused on gene expression analyses related to fibrosis and adipogenesis, our study provides important morphological evidence of ongoing muscle regeneration, even in severe WB, and highlights the increased presence of FAPs, implicating them in both regenerative and fibrotic/adipogenic processes. However, these regenerative attempts are ultimately unsuccessful, resulting in the persistence of small-caliber myofibers and failure to restore normal muscle architecture.

The upregulation of PAX7 and MYOG, markers of myosatellite cell activation and myotube formation, respectively, in severe WB further supports the presence of active muscle regeneration. However, the histological observation of abundant small-caliber and split fibers indicates impaired myofiber maturation despite this upregulation. Reports on the expression of myogenic regulatory factors in WB have been inconsistent, with some studies showing increased PAX7 and MYOG expression[19], whereas others have reported decreases[10]. This discrepancy may reflect the ongoing physiological muscle development of rapidly growing broilers, which makes it difficult to distinguish physiological myogenesis from pathological myogenesis. Furthermore, transcriptomic analyses often rely on small sample sizes, making them susceptible to individual variation, particularly in food-producing animals such as poultry. In our study, qPCR analysis using a larger cohort (n = 77) confirmed significant changes in MYOG and PAX7 expression, whereas these genes were not identified as DEGs in RNA-seq using a smaller sample size (n = 6). We suggest that this discrepancy may reflect sampling bias in the small RNA-seq cohort. In a small cohort, outliers can skew mean expression levels, potentially masking significant differences and leading to false-negative results. By analyzing a larger cohort of birds classified on the basis of histopathological assessment, our study demonstrates enhanced activation of the myogenic program and ongoing but incomplete muscle regeneration in severely fibrotic WB-affected PM.

The increased PAX7 and MYOG expression in severely fibrotic tissues points to an activated muscle regeneration program. However, the lack of fully mature, large-caliber myofibers and the presence of numerous small and split fibers suggest impaired progression into later stages of myogenesis, including myoblast fusion, highlighting the unsuccessful nature of the regenerative process. The unchanged MYOD expression despite increased PAX7 and MYOG is particularly intriguing. Myogenic differentiation involves sequential activation of these factors, with MYOD expression preceding MYOG in PAX7-positive cells. MYOD and MYOG, both crucial transcription factors in myogenesis, exhibit overlapping genomic binding sites and cooperate to regulate muscle differentiation[20,21]. The observed dysregulation of this MYOD-MYOG axis in WB, with elevated PAX7 and MYOG but unchanged MYOD, suggests disruption of the normal myogenic program, potentially hindering proper myoblast fusion and contributing to the observed regenerative failure. These findings suggest that the early stages of myogenesis are initiated, but the process stalls before completion, contributing to the overall pathology of WB. Wang et al. also showed that terminal differentiation of myosatellite cells was compromised in WB, with increased expression of MSTN (myostatin), a negative regulator of myosatellite cell differentiation[22]. Notably, MYOD and MYOG expression were also upregulated in severe WB samples in that report[22].

In addition to CCN4, we observed upregulation of CCN1 and CCN2 in WB-affected PM. In mammals, CCN1 and CCN2 promote adipogenic and fibrogenic differentiation of FAPs, respectively, during muscle regeneration[5]. Furthermore, CCN2 inhibits MYOD expression and myogenic differentiation in murine C2C12 myoblasts[27]. Thus, elevated CCN1 and CCN2 in WB may contribute to pathogenesis by promoting fibrosis and adipogenesis while simultaneously suppressing myogenic differentiation. While the cellular source of CCN1 and CCN2 in PM remains unclear, these factors are known to be secreted by fibroblasts[28,29] and may also be produced by FAPs. CCN2 is also secreted by skeletal muscle cells[27]. The interplay among these factors may create a microenvironment that favors fibrosis over successful muscle regeneration. Further research is needed to identify the cellular sources of CCN family members and to unravel the complex molecular crosstalk driving WB pathogenesis.

Our RNA-seq analysis demonstrated significant downregulation of genes regulating mitochondrial metabolism, particularly oxidative phosphorylation and Adenosine triphosphate (ATP) production, in WB muscles (Figure 3c). This finding is consistent with previous multi-omics analyses[30] and with reports of mitochondrial morphological abnormalities in WB[31]. Although not directly assessed in this study, prior research has suggested that such dysfunction may stem from impaired mitophagy-mediated mitochondrial recycling[3], which is known to hinder myogenic differentiation in vivo and likely contributes to the regenerative failure observed in WB[32]. Furthermore, consistent with the established role of hypoxia in WB[19], our RNA-seq data indicated enhanced inflammatory responses in WB (Figure 3b). Although inflammation typically promotes angiogenesis, chronic inflammation can also induce hypoxia[33,34], creating a cycle in which hypoxia further amplifies inflammation through reactive oxygen species production and mitochondrial DNA (mtDNA) release[35]. Importantly, given the emerging role of FAPs in tissue homeostasis, future studies should investigate how FAP signaling influences mitochondrial function and inflammation during impaired muscle regeneration in WB. Isolating and co-culturing FAPs with myocytes from WB-affected tissues could provide valuable insights into FAP-mediated effects on mitochondrial function and may reveal novel therapeutic targets.

In conclusion, our study provides the first histological evidence of FAP localization within fibrotic lesions in WB, alongside regenerating myofibers, indicating concurrent fibrosis and attempted muscle regeneration. Gene expression analyses revealed enhanced early myogenesis but impaired later stages, particularly myoblast fusion. Our findings suggest that upregulated CCN family members (CCN1, CCN2, CCN3, and CCN4) in WB may play multifaceted roles, influencing not only fibrosis and adipogenesis but also myogenic differentiation (Figure 6). We emphasize that this proposed model remains hypothetical and is derived from correlative data and comparisons with mammalian systems. While previous WB research has primarily focused on fibrosis, understanding the mechanisms that hinder myoblast fusion may help clarify the pathogenesis of WB. Specifically, identifying the factors that disrupt normal FAP-myosatellite cell interactions and lead to unsuccessful muscle regeneration is a critical area for future investigation. Future research should prioritize the investigation of FAP function as a central link between fibrosis and muscle regeneration in WB.

Fig. 6.

   Hypothetical model of WB pathogenesis involving fibro-adipogenic progenitors (FAPs) and CCN molecules. In normal muscle regeneration (top), a transient increase in FAPs facilitates muscle regeneration through moderate CCN4 secretion. These FAPs are subsequently cleared by apoptosis. In severe WB (bottom), however, FAP clearance is impaired, leading to sustained elevation of CCN4, which promotes myosatellite cell (MSC) proliferation. Additionally, aberrant expression of CCN1 and CCN2 contributes to disrupted muscle regeneration through adipogenesis and fibrosis, respectively. This proposed model is largely derived from correlative data from mammalian systems. Therefore, future studies are needed to validate these mechanisms in chickens.

Ethical approval

The animal experiments were approved by the Institutional Animal Care and Use Committee of Rakuno Gakuen University (No. DH200A3, DH21A3, VH20A11), in accordance with the Act on Welfare and Management of Animals of the Japanese government.

Supplementary materials.

jpsa-63-2026009-s001.pdf ^{(473.8KB, pdf)}

Funding Statement

Japan Society for the Promotion of Science: 21K05942

Japan Society for the Promotion of Science: 24K01912

Japan Society for the Promotion of Science: 24K09214