Neu5Ac promotes high-fat diet-induced progression of atherosclerosis in ApoE-deficient mice

Abstract

Atherosclerosis (AS) is a chronic inflammatory disorder underlying most cardiovascular events sialic acid (SIA), a terminal metabolite of glycolipid catabolism, modulates vascular injury, but its role in endothelial dysfunction remains unclear. To investigate whether N-acetylneuraminic acid (Neu5Ac) accelerates AS development. ApoE^–/– mice were fed a high-fat diet to induce AS. Lesion burden was assessed by Oil Red O staining, plaque morphology by H&E staining, reactive oxygen species and macrophage polarization by flow cytometry, and signaling alterations by Western blotting. Neu5Ac markedly amplified systemic inflammation, enhanced atherosclerotic plaque formation, and disrupted lipid homeostasis. Neu5Ac exacerbates AS through pro-inflammatory, pro-lipid, and chemotactic/angiogenic mechanisms, highlighting potential therapeutic targets.

Introduction

Atherosclerosis (AS) is a chronic vascular inflammatory disorder and the leading cause of cardiovascular disease (CVD) [1]. AS is a type of chronic vascular inflammatory disease mainly characterized by vascular endothelial damage caused by lipid peroxidation deposition [2]. Specifically, it is also an important factor contributing to cardiovascular and cerebrovascular diseases such as coronary heart disease, heart failure, and stroke [3]. Its characteristics include arterial endothelial damage, lipid deposition, and fibrous tissue hyperplasia, which lead to thickening of the vascular wall and may eventually result in vascular stenosis or occlusion [4, 5]. Approximately 70% of acute cardiovascular diseases are caused by the rupture of vulnerable plaques in AS and subsequent secondary thrombosis [6, 7]. Therefore, the prevention, diagnosis, and treatment of AS are key steps in preventing cardiovascular and cerebrovascular diseases.

Sialic acid (SIA) is a negatively charged monosaccharide on the surface of mammalian cells. It plays an important role in cell surface interactions, protecting cell membranes from hydrolysis by proteolytic enzymes and promoting cell adhesion [8, 9]. SIA is mainly used in clinical practice for the auxiliary diagnosis of tumors and the prognosis of cardiovascular diseases [10, 11]. There are more than 50 known types of SIA, among which N-glycolylneuraminic acid (Neu5Gc) and N-acetylneuraminic acid (Neu5Ac) are the most common [12]. Recent research findings have shown that the intake of Neu5Ac from food can induce chronic inflammatory responses, especially AS [13, 14]. Studies have shown that the levels of total serum SIA and lipid-bound SIA in patients with acute myocardial infarction are significantly higher than those of healthy individuals, and the levels of total sialic acid (TSA) and lipid-bound SIA in the serum show an upward trend 3 days after infarction, indicating that SIA plays an important role in the onset of AS [15, 16]. SIA has the advantages of being detectable in vitro, with convenient methods, in vitro detectability, convenient measurement methods, minimal invasiveness, and short detection time. It has certain potential value for the diagnosis of AS and related diseases. Therefore, this study aims to explore the impact of Neu5Ac on AS in apolipoprotein E gene knockout (ApoE^−/−) mice induced by a high-fat diet.

Materials and Methods

Animal models and grouping of experimental mice

All procedures were approved by the Animal Care and Use Committee of the Second Affiliated Hospital of Kunming Medical University (Approval No. kyfey2023080). Male ApoE^–/– mice (6–8 weeks old, 20–22 g) from the Model Animal Research Center of Nanjing University were maintained under SPF conditions (12-h light/dark cycle; 22–24°C). After one week of acclimation, mice were fed a high-fat diet (D12492) that was purchased from Research Diets Inc. (New Brunswick, NJ, USA). Wild-type C57BL/6J mice served as controls (6–8 weeks old, wild-type (WT) group, n=10). Additional ApoE^–/– mice were randomly divided into three groups (n=10 per group) as follows: (1) AS model group, which received an equal volume of sterile saline via oral gavage; (2) AS + Ato group (atorvastatin-treated), which received atorvastatin (10 mg/kg/day) via oral gavage; and (3) AS + Neu5Ac group (Neu5Ac-treated), which received Neu5Ac (60 mg/kg/day) via intraperitoneal injection. Atorvastatin was used as a positive control to assess the therapeutic effect on atherosclerotic progression. Both atorvastatin and Neu5Ac were dissolved in sterile saline prior to administration. All treatments were conducted once daily for five consecutive weeks [17]. Mice were euthanized with pentobarbital sodium (200 mg/kg, i.p.), and aortas, blood, and organs were collected.

Serum lipid measurement

Plasma was thawed, centrifuged, and supernatants analyzed for triglycerides (TG), total cholesterol (TC), HDL-C, and LDL-C using an automated biochemical analyzer (Direx CS-T180).

Oil Red O staining

Aortas were dissected, stained with Oil Red O (Solarbio, Beijing, China) for 15 min, rinsed, counterstained with hematoxylin, and mounted in glycerin. Lesion area was quantified with Image-Pro Plus software.

H&E staining and quantification of lesion size

Frozen aortic sections (6 µm) were stained with H&E (Biosharp, Anhui, China, BL735A), dehydrated, and mounted. Images were acquired with a slide scanner, and lesion size quantified as the average of three sections per aorta using ImageJ.

Reactive oxygen species (ROS) levels

ROS levels were determined using DCFH-DA fluorescent probe assay (Beyotime, Shanghai, China) following the manufacturer’s instructions.

Flow cytometry

Aortas were digested with elastase, DNase I, and collagenase I. Cell suspensions were stained with antibodies against F4/80, CD86, and CD206, and analyzed by flow cytometry to quantify macrophage subsets.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted with TRIzol (Thermo Fisher Scientific, Waltham, MA, USA), reverse-transcribed, and amplified by qPCR. Fluorescence signals were monitored throughout, amplification curves were plotted, Ct values were determined, and target gene expression was quantified using the 2^-ΔΔCt method. Primer sequences were as follows:

IL-6: F 5′- GTTCTCTGGGAAATCGTGGA −3′, R 5′- TGTACTCCAGGTAGCTATGG −3′

TNF-α: F 5′- CCCTCACACTCAGATCATCTTCT −3′, R 5′- GCTACGACGTGGGCTACAG −3′;

MCP-1: F 5′- CAGCCAGATGCAATCAATGCC −3′, R 5′- TGGAATCCTGAACCCACTTCT −3′;

GAPDH: F 5′- AACTTTGGCATTGTGGAAGG −3′, R 5′- ACACATTGGGGGTAGGAACA −3′.

Western blot (WB)

Total protein was extracted from mouse aorta and denatured at 95–100°C for 10 min; protein concentration was determined using a BCA assay. Equal amounts of protein were separated by 6% stacking and 12% resolving SDS-PAGE, then transferred to a 0.45 µm PVDF membrane, which was blocked with 5% non-fat milk in TBST for 1 h at room temperature before being incubated overnight at 4°C with the following primary antibodies: Anti-low-density lipoprotein receptor (LDLR; Abcam, Cambridge, UK, ab270212), Anti-tumor necrosis factor (TNF; Proteintech, Rosemont, IL, USA, A11308-1-AP), Anti-interleukin-6 (IL-6; Abcam, ab83), Anti-monocyte chemoattractant protein-1 (MCP-1; Affinity Biosciences, Cincinnati, OH, USA, AF5139), and Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Proteintech, 60004-1-Ig). After washing with TBST, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (anti-rabbit, #7074; anti-mouse, #7076; Cell Signaling Technology, Danvers, MA, USA) for 1 h at room temperature, and protein bands were visualized using Amersham^TM ECL Prime Blotting Reagent (Cytiva, Marlborough, MA, USA) and quantified with ImageJ (NIH, Bethesda, MD, USA).

Neu5Ac quantification

Plasma Neu5Ac levels were measured with a commercial colorimetric assay kit (E-BC-K068-M, Elabscience, Wuhan, China).

Network pharmacology

Potential Neu5Ac targets were predicted using SwissADME and cross-referenced with AS-related targets from GeneCards. Common targets were analyzed via STRING PPI networks, GO enrichment, and KEGG pathway analysis.

Statistical analysis

Prism software was used for statistical analysis. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test for multiple group comparisons. Statistical significance for all the tests, assessed by calculating the P values, was defined as P<0.05.

Results

Neu5Ac levels are elevated in AS and associated with pathogenic pathways

To explore the potential mechanisms of Neu5Ac in AS, we performed a network pharmacology analysis (Supplementary Fig. 1). Expression of Neu5Ac-associated key targets will be further validated in future experiments. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses revealed that Neu5Ac targets are mainly enriched in chemokine signaling, angiogenesis, and glucose metabolism pathways (Fig. 1A). These processes are closely linked to inflammatory regulation, vascular smooth muscle cell phenotypic switching, and lipid metabolism. To validate the relationship between Neu5Ac and AS, we established an ApoE^–/– mouse model fed a high-fat diet. Neu5Ac levels in both plasma and atherosclerotic lesions were significantly increased in ApoE^–/– mice compared with WT controls (Fig. 1B).

Fig. 1.

Neu5Ac levels and pro-atherogenic pathway activation in AS mice. (A) Bar charts of GO and KEGG enrichment analyses for key targets. (B) Neu5Ac levels in plasma and aortic lesion tissues, measured using a commercial assay kit, were significantly elevated in AS mice compared with WT controls. *** P<0.001.

Neu5Ac aggravates dyslipidemia and enhances lipid deposition

Given the central role of dyslipidemia in AS, we measured serum lipid levels in each group. Compared with WT mice, AS mice displayed elevated TC, TG, and LDL-C levels, along with reduced HDL-C levels, confirming high-fat diet–induced dyslipidemia. Neu5Ac treatment further exacerbated these changes (P<0.05). Consistently, LDLR mRNA and protein levels in vascular tissues were reduced in AS mice and further downregulated upon Neu5Ac treatment (Figs. 2A and B). At the tissue level, Oil Red O staining revealed significantly greater lipid accumulation in the aorta of AS mice compared with WT controls, whereas atorvastatin treatment markedly reduced lipid deposition. Neu5Ac treatment, in contrast, significantly enlarged the lipid droplet area compared with the AS group (P<0.05) (Figs. 2C and D). Together, these results indicate that Neu5Ac aggravates lipid dysregulation and accelerates lipid deposition in atherosclerotic vessels.

Fig. 2.

Neu5Ac disrupts serum lipid metabolism and promotes lipid deposition in AS mice. (A) Effects of Neu5Ac on serum lipid profiles: triglycerides (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C). (B) RT-qPCR and Western blot analyses demonstrated that Neu5Ac downregulated low-density lipoprotein receptor (LDLR) expression at both mRNA and protein levels. (C) Representative Oil Red O-stained aortic root sections illustrating lipid deposition across experimental groups (Scale bar=100 µm). (D) Quantification of atherosclerotic lesion area. *P<0.05, **P<0.01, *** P<0.001.

Neu5Ac exacerbates plaque formation and vascular injury

Histological analysis of aortic root sections by hematoxylin-eosin (HE) staining demonstrated intact vascular architecture in WT mice. In AS mice, endothelial disruption, disorganized cell layers, cytoplasmic vacuolization, and fibrous plaques were observed, accompanied by inflammatory cell infiltration and foam cell formation. Neu5Ac treatment further aggravated these pathological changes, resulting in more extensive inflammatory infiltration compared with AS mice (Fig. 3). These results indicate that Neu5Ac accelerates plaque progression and vascular injury in high-fat diet–fed mice.

Fig. 3.

Neu5Ac exacerbates atherosclerotic plaque necrosis in AS mice. (A) Representative H&E-stained aortic root sections illustrating necrotic core areas across experimental groups (Scale bar=100 µm). (B) Quantitative analysis of necrotic core area. *P<0.05, ** P<0.01, *** P<0.001.

Neu5Ac amplifies inflammatory responses and oxidative stress

To evaluate the inflammatory effects of Neu5Ac, we quantified the expression of TNF-α, IL-6, and MCP-1. The relative mRNA expression levels were normalized to GAPDH and expressed as fold change compared with the control group. All three cytokines were significantly elevated in AS mice compared with WT mice (P<0.05), and Neu5Ac treatment further increased their expression at both mRNA and protein levels (Figs. 4A and B). In addition, ROS analysis showed markedly enhanced oxidative stress in the vascular tissues of Neu5Ac-treated mice (Fig. 4C). These findings suggest that Neu5Ac amplifies inflammatory cytokine production and promotes ROS-mediated oxidative damage in AS.

Fig. 4.

Neu5Ac enhances pro-inflammatory cytokine expression and oxidative stress in AS mice. (A) RT-qPCR analysis revealed significant upregulation of TNF-α, IL-6, and MCP-1 mRNA expression in Neu5Ac-treated mice compared with AS mice. (B) Western blot analysis confirmed increased TNF-α, IL-6, and MCP-1 protein levels following Neu5Ac treatment. (C) Flow cytometry analysis demonstrated increased reactive oxygen species (ROS) production in the Neu5Ac group relative to the AS group. *P<0.05, ** P<0.01, *** P<0.001.

Neu5Ac drives pro-inflammatory macrophage polarization

Macrophage polarization is a critical determinant of plaque stability. Flow cytometry revealed that Neu5Ac treatment significantly upregulated the M1 marker CD86 while downregulating the M2 marker CD206 compared with AS mice (P<0.05) (Figs. 5A and B). These results demonstrate that Neu5Ac skews macrophage polarization toward a pro-inflammatory M1 phenotype, thereby exacerbating atherosclerotic progression.

Fig. 5.

Neu5Ac promotes a pro-inflammatory macrophage phenotype in AS mice. (A) Flow cytometry analysis demonstrated that Neu5Ac significantly increased the proportion of CD86⁺ M1 macrophages. (B) Neu5Ac treatment concurrently reduced the CD206⁺ M2 macrophage population compared with AS controls. *P<0.05, ** P<0.01, *** P<0.001.

Discussion

AS is the pathological basis of various cardiovascular diseases such as myocardial infarction and stroke, imposing a significant global health burden [18]. SIA is a derivative of a 9-carbon monosaccharide, widely present in animals as a terminal residue of cell surface glycoconjugates. Its biosynthesis, activation, transfer, degradation, and recycling are involved in various biological processes and pathologies [19]. Numerous studies have shown that elevated plasma SIA levels are associated with an increased risk of cardiovascular diseases and the severity of AS. Treating mice with SIA exacerbates AS severity, consistent with previous results showing that Neu5Ac, a common form of SIA, worsens AS in vivo [20]. Mechanisms triggering AS in humans include Toll-like receptor (TLR) signaling activation, which is thought to link the immune system and cardiovascular disease. Activation of this pathway leads to the production of multiple inflammatory cytokines, thereby exacerbating the atherosclerotic process [21]. Mechanisms that trigger AS in humans include the transmission of TLR signaling, which is thought to be the link between the immune system and cardiovascular disease. Activation of this acquisition leads to the activation of multiple inflammatory cytokines, thereby exacerbating the atherosclerotic process [22,23,24]. Although direct evidence of TLR2 subtype activation was not obtained in this study, previous studies suggest that Neu5Ac can interact with TLR2/4 to induce pro-inflammatory signaling. Future work will investigate TLR2 subtype-specific activation [25]. Increased serum ceramidase activity and decreased SIA content in LDL are important causes of elevated free SIA levels, which contribute to atherosclerotic cardiovascular disease [26]. Previous studies have demonstrated that SIA may activate NF-κB and JNK pathways through TLR-mediated mechanisms, thereby amplifying inflammatory and oxidative responses [27].

This study measured TNF-α, IL-6, and MCP-1 levels, and the results confirmed the above findings. Our data are consistent with these findings and suggest that SIA may act upstream of NF-κB − dependent transcriptional activation. Additionally, studies have shown that proprotein convertase subtilisin/kexin type 9 (PCSK9) binds to LDLR, promoting its internalization and degradation; thus, reduced PCSK9 levels increase LDLR expression [28]. This study found that LDLR levels were significantly decreased in Neu5Ac-treated mice, further indicating that Neu5Ac may exacerbate AS progression by affecting LDLR-related signaling pathways.

Since the inflammatory response mediated by macrophages is an important cause of atherosclerotic plaque formation [29], we evaluated the effect of Neu5Ac on macrophage polarization via flow cytometry. Neu5Ac accelerates the atherosclerotic inflammatory response by promoting M1 macrophage activation. Interestingly, while M1 activation was enhanced, M2 activation was also slightly increased. This phenomenon may be attributed to the dose effect of Neu5Ac: as Neu5Ac dose gradually increases, M2 activation may show a downward trend.

Meanwhile, combined with the analysis results of network pharmacology, we predicted the key targets through which Neu5Ac accelerates the process of AS. For example, in AS, matrix metalloproteinase-9 (MMP-9) can promote the abnormal proliferation of smooth muscle cells, lipid accumulation and inflammatory response by activating growth factors and cytokines [30]. Kinase insert domain receptor (KDR) is regarded as vascular endothelial growth factor type 2 and may accelerate the process of AS by influencing the integrity of the blood vessel wall, promoting the migration and proliferation of vascular smooth muscle cells [31]. In addition, studies have shown that the increased expression of fibroblast growth factor 2 (FGF2) and its receptor Fibroblast Growth Factor Receptor 1 (FGFR-1) in macrophages and smooth muscle cells may be involved in the process of AS [32]. Meanwhile, Galectin-3 (LGALS3) may participate in the occurrence and development of AS by regulating the proliferation, migration and differentiation of smooth muscle cells as well as influencing the deposition and composition of the extracellular matrix. These findings provide us with new perspectives and potential targets for in-depth understanding and intervening in the process of Neu5Ac-driven AS [33].

This study provides new evidence that Neu5Ac exacerbates atherosclerosis by amplifying systemic inflammation and lipid dysregulation. The novelty lies in demonstrating a direct pathological role of Neu5Ac in vivo using ApoE^−/− mice. Limitations include the lack of mechanistic verification at the cellular signaling level and the absence of clinical validation, which will be addressed in future work.

Conclusions

Neu5Ac exacerbates lipid accumulation, plaque formation, and inflammation in atherosclerotic mice, suggesting a pathogenic role in AS progression. Elevated free SIA may increase cardiovascular risk, and targeting its downstream pathways could represent a novel therapeutic strategy.

Funding

This work was supported by the Intramural Science and Technology Programme of the Second Affiliated Hospital of Kunming Medical University (Grant No. 2022yk06).

Authors’ Contributions

Di Wang conceived and designed the study, secured funding, oversaw the project, and drafted the manuscript. Chengyong Yin performed animal and cellular experiments. Dong Huang conducted statistical analyses, prepared figures, and, with Chengyong Yin, verified data integrity. All authors reviewed and approved the final manuscript.

Ethics Approval

Approved by the Animal Care and Use Committee of the Second Affiliated Hospital of Kunming Medical University (Approval No. kyfey2023080).

Patient Consent for Publication

Not applicable.

Competing Interests

The authors declare no competing interests.

Funding Statement

This study was funded by the Intramural Science and Technology Programme of the Second Affiliated Hospital of Kunming Medical University (Grant No. 2022yk06).

Availability of Data and Materials

Data are available from the corresponding author upon reasonable request.