Abstract
We present a reproducible in vitro protocol for harvesting and culturing murine bone marrow‐derived macrophages, with the added capability of freezing bone marrow cells at –80°C for scalability and long‐term storage. To induce macrophage senescence, we developed a genotoxic stress‐based method using either 10 Gy ionizing radiation or 500 nM doxorubicin treatment. The resulting senescent macrophages exhibit key hallmarks of cellular senescence, including irreversible cell cycle arrest, upregulation of senescence‐associated markers (e.g., Cdkn1a), secretion of senescence‐associated secretory phenotype (SASP) factors, morphological changes, and SA‐β‐galactosidase activity. This model serves as a valuable tool for investigating macrophage senescence, a relatively understudied senescent cell type, and provides mechanistic insights into the contribution of the innate immune system to aging and age‐related diseases. © 2026 The Author(s). Current Protocols published by Wiley Periodicals LLC.
Basic Protocol 1: Mouse dissection and bone marrow harvest
Basic Protocol 2: Thawing and plating cryopreserved murine bone marrow for macrophage differentiation
Support Protocol 1: Flow cytometry validation of macrophage surface markers
Support Protocol 2: Gene expression analysis via RT‐qPCR
Basic Protocol 3: Inducing senescence in macrophages using doxorubicin or irradiation
Alternate Protocol: Maintenance and expansion of control macrophages
Support Protocol 3: Brightfield microscopy and SA‐β‐galactosidase staining to assess senescence‐associated morphology
Support Protocol 4: Quantifying senescence and SASP marker expression by qPCR and/or western blot
Support Protocol 5: Assessment of cell cycle arrest using EdU labeling with optional DNA content staining
Keywords: bone marrow‐derived macrophages, DNA damage, innate immune aging, macrophage differentiation, macrophage senescence
INTRODUCTION
Macrophages are frontline effectors of the innate immune system, responsible for modulating tissue homeostasis, inflammation, and repair. With advancing age or chronic stress, these cells can enter cellular senescence, an irreversible state of growth arrest accompanied by metabolic reprogramming and secretion of proinflammatory molecules collectively known as the senescence‐associated secretory phenotype (SASP). Senescent macrophages accumulate in the aged and diseased microenvironment, yet their biology remains poorly understood because most in vitro models rely on immortalized lines, e.g., RAW264.7 or THP‐1 (Geng et al., 2022). These cancer‐derived lines frequently harbor deletions or mutations in Tp53 (Liu et al., 2022), a master regulator of senescence (Mijit et al., 2020), and therefore do not reliably represent macrophage senescence.
A robust model must also discriminate bona fide senescence from acute stress or classical macrophage polarization states (M1/M2), which can transiently upregulate markers, e.g., Cdkn2a (p16), Cdkn1a (p21), and proinflammatory cytokines (Su et al., 2021). Furthermore, activated and senescent macrophages share features, such as growth arrest, metabolic remodeling, and lysosomal expansion (Behmoaras & Gil, 2020). To avoid conflating these phenomena, phenotypic validation should be assessed 10 to 12 days after induction rather than within the first 48 hr.
Here, we describe a scalable, in vitro model of macrophage senescence using primary murine bone marrow‐derived macrophages (BMDM) that overcomes the limitations above. The workflow couples an optional bone marrow cryopreservation step (–80°C) for long‐term banking with genotoxic stress induction of senescence via either 10 Gy ionizing radiation or administration of 500 nM doxorubicin (Fig. 1). These stimuli, adapted from fibroblast models and optimized here for BMDMs, consistently produce macrophages that display all canonical hallmarks of cellular senescence. Additionally, these observations have also been validated in both human aging and disease contexts, thereby confirming this model for subsequent research studies relevant to the biology of macrophage senescence (Salladay‐Perez et al. 2026; Salladay‐Perez & Covarrubias, 2026).
Figure 1.

Diagram outlining the procedure used to generate senescent macrophages from primary murine bone marrow. 8‐ to 10‐week‐old C57BL/6 mice are euthanized and dissected to harvest leg bones, followed by bone marrow isolation. Bone marrow cells are cultured in macrophage growth medium supplemented with M‐CSF for 7 to 8 days to induce macrophage differentiation. On day 7 or 8, macrophages are exposed to genotoxic stress via either a single 10‐Gy dose of ionizing radiation or 24‐hr treatment with 500 nM doxorubicin. Senescence phenotypes are assessed 10 to 12 days post‐induction using assays such as SA‐β‐gal staining, morphological characterization, flow cytometry, RT‐qPCR, and/or immunoblotting.
The data generated span quantitative imaging, colorimetric SA‐β‐gal assays, RT‐qPCR/RNA‐seq, immunoblotting, and flow cytometry, providing an integrated view of the senescent phenotype. Compared with immortalized cell or acute polarization models, this primary cell model offers physiological relevance, reproducibility, and the ability to interrogate DNA damage‐linked pathways. Disadvantages include the need for specialized radiation equipment or use of cytotoxic drugs.
The following protocols will detail steps for harvesting and differentiating BMDMs, which involve isolation of murine bone marrow and 7‐ to 8‐day macrophage colony‐stimulating factor (M‐CSF)‐driven differentiation to macrophages. Upon isolation of murine bone marrow, this protocol offers the option of bone marrow cryopreservation enabling synchronized, large‐scale experiments, which ensures reproducibility across batches or when long‐term studies are required. Macrophage senescence can be induced with a single 10‐Gy dose administered on day 7 or 8 post‐macrophage differentiation. This method can be utilized when radiation facilities are available and when rapid, uniform DNA damage is desired. Alternatively, macrophage senescence can also be induced with 24‐hr exposure of doxorubicin at a concentration of 500 nM, followed by drug washout. This alternative option can be considered when radiation access is limited or when comparing chemical vs physical genotoxic stress. Additionally, both methods can be used simultaneously to validate and compare macrophage senescent phenotypes. Standardized assays including morphological assessment, SA‐β‐gal activity, qPCR or western blotting for p21, p16 and SASP genes, and EdU/PI flow cytometry should be performed 10 to 12 days‐post induction to confirm senescence and rule out transient activation or polarization of macrophages.
Together, these protocols provide a versatile and powerful toolkit for dissecting the mechanisms and consequences of macrophage senescence in aging and age‐related disease contexts.
CAUTION: Doxorubicin is a potent chemotherapeutic agent that poses significant health risks upon exposure. It is known to be mutagenic, carcinogenic, and toxic to reproductive organs, and can cause severe skin, eye, and respiratory irritation. Doxorubicin must be handled with appropriate safety precautions. Proper personal protective equipment (PPE), including safety glasses and chemical‐resistant gloves, must be worn during handling. Follow all institutional guidelines for the safe storage, use, and disposal of chemotherapeutic compounds.
CAUTION: Use of the irradiator involves exposure to ionizing radiation, which can cause DNA damage, increase cancer risk, and harm reproductive and other sensitive tissues. Exposure, even at low doses, can have cumulative effects. Strictly follow all institutional radiation safety guidelines.
NOTE: All protocols involving animals must be reviewed and approved by the appropriate Animal Care and Use Committee and must follow regulations for the care and use of laboratory animals. Appropriate informed consent is necessary for obtaining and use of human study material.
Basic Protocol 1. MOUSE DISSECTION AND BONE MARROW HARVEST
This protocol outlines how to perform a mouse dissection on 8‐ to 10‐week‐old C57BL/6 mice for the purpose of isolating both femurs and tibias (leg bones). The harvested bones will then undergo a crude extraction process using a mortar and pestle to release bone marrow cells, enabling the collection of murine bone marrow leukocytes. The protocol concludes with the option to cryopreserve the bone marrow cells for long‐term storage. When performed correctly, this procedure should yield approximately 2–2.4 × 10⁸ bone marrow cells, which can be aliquoted into 16 to 20 vials, each containing 1 ml at a concentration of 1.2 × 10⁷ cells/ml.
Materials
Macrophage growth medium (MGM; see recipe)
RPMI‐C (see recipe)
8‐ to 10‐week‐old C57BL/6J mice (The Jackson Laboratory, strain no. 000664)
Isoflurane (VetOne, cat. no. 13985‐528‐60)
70% ethanol (see recipe)
BMDM cryopreservation solution (see recipe)
Bead or water bath, 37°C
Biological safety cabinet (BSC; Nuaire Class II Type 2, or equivalent)
50‐ml conical tubes (Thermo Fisher, cat. no. 339653)
Ice bucket with ice
Drop jar apparatus for euthanasia
Sterilized dissection kit
Mortar and pestle (Thermo Fisher, cat. no. 039791.KT)
Biological material vaccum aspiration system (inside of BSC)
Aspirating pipettes
Serological pipet controller (Drummond, or equivalent)
5‐, 10‐, and 25‐ml filtered, individually wrapped serological pipettes
70‐µm cell strainer
Centrifuge (Sorvall ST40R centrifuge with TX‐1000 rotor, or equivalent)
10‐, 20‐, and 200‐µl pipettes and filtered pipette tips
Hemocytometer
Tissue culture microscope (Nikon or equivalent)
100‐mm untreated Petri dishes (VWR, cat. no. 25384‐342)
Tissue culture incubator 37°C, 5% CO2
Cryogenic vials (Fisher Scientific, cat no. 12‐567‐501)
Mouse dissection (1 to 1.5 hr)
-
1
Place MGM to warm in 37°C bead or water bath.
-
2
In a BSC, aliquot 10 ml (5 ml per leg bone) RPMI‐C into a 50‐ml conical tube.
-
3
Transfer tube containing RPMI‐C out of the hood and place near dissection area. Keep on ice.
-
4
Euthanize an 8‐ to 10‐week‐old C57BL/6 mouse following NIH ARAC and/or IACUC guidelines.
Use 0.7 to 1 ml isoflurane for anesthesia, followed by cervical dislocation to ensure proper euthanasia.
-
5
Place the carcass ventral side up on a dissecting tray and pin down all limbs.
-
6
Spray the carcass thoroughly with 70% ethanol until the fur is fully saturated.
-
7
Use forceps to gently pinch the abdominal skin, then make a small superficial snip using dissecting scissors.
-
8
Cut horizontally from the initial incision down the leg, being careful not to puncture any internal organs or structures.
-
9
Dissect out the entire leg, including the femur, tibia/fibula, and hind paw.
Remove the femur just below the hip socket without cutting through the bone to maximize cell yield.
-
10
Remove as much skeletal muscle tissue from the bone as possible and remove hind paw.
Tip: Use a Kimwipe to remove residual tissue.
-
11
Transfer the cleaned bones into 10 ml RPMI‐C in a 50‐ml conical tube and place the tube on ice.
Bone marrow harvest (1 to 1.5 hr)
-
12
Transfer the 50‐ml conical tube containing leg bones into the BSC.
-
13
Dump the bones and remaining medium into a sterile mortar and pestle.
-
14
Aspirate and discard the medium.
-
15
Spray the bones with 70% ethanol until fully submerged.
-
16
Incubate the bones at room temperature for ∼1 min.
-
17
Aspirate and discard the ethanol.
-
18
Pipette 7 ml of sterile RPMI‐C into the mortar to dilute residual ethanol, using a serological pipet controller.
-
19
Aspirate and discard the medium.
-
20
Repeat steps 17 and 18 three times to ensure complete ethanol removal.
-
21
Place a 70‐µm cell strainer into a fresh 50‐ml conical tube for cell collection.
-
22
Pipette 10 ml of fresh sterile RPMI‐C into the mortar.
-
23
Crush the bones using the pestle at a 90° angle.
Gently press (do not smash or grind) to preserve cell viability.
-
24
Collect the 10 ml cell suspension and filter it through a 70‐µm cell strainer into a labeled collection tube.
Tip: Before filtering, pipette the suspension up and down inside the mortar to break up clumps and maximize marrow recovery.
-
25
Pipette an additional 5 ml RPMI‐C into the mortar to rinse the bones and mortar.
-
26
Collect and filter the rinse into the same collection tube.
-
27
Repeat steps 23 to 24 two more times (total of 3 rinses).
Tip: Bones should appear white when marrow is fully extracted.
Cell processing and counting
-
28
Centrifuge the filtered suspension for 5 min at 0.3 × g, room temperature, using a swinging‐bucket rotor.
-
29
Aspirate the supernatant carefully without disturbing the pellet.
-
30
Resuspend the pellet in 10 ml of macrophage growth medium (MGM).
-
31
Dilute 15 µl of cells into 135 µl MGM for a 1:10 dilution.
-
32
Count the cells using a hemocytometer and tissue culture microscope.
If seeding bone marrow cells immediately
-
33
Seed cells at a density of 250,000 cells/ml into a 100‐mm untreated Petri dish, then incubate for 5 days in an incubator set to 37°C, 5% CO2. Then, proceed to Basic Protocol 2, “Day 5” time point.
Macrophages are naturally adherent. Using non‐tissue culture‐treated dishes prevents issues with detachment during passaging.
Cryopreservation
-
34
Divide the total cell count by 1.2 × 10⁷ to determine the resuspension volume and number of cryovials needed to add 1 ml to each tube.
-
35
Label cryovials with genotype, mouse age (in weeks), and harvest date.
-
36
Prepare a freezing solution in a sterile 15 ml or 50 ml conical tube by mixing 90% cold FBS with 10% DMSO.
Adjust volume based on the number of cryovials required.
-
37
Centrifuge the cells again for 5 min at 0.3 × g, room temperature, using a swinging‐bucket rotor.
-
38
Aspirate the supernatant carefully without disturbing the pellet.
-
39
Resuspend the cells in the appropriate volume of freezing solution to reach a final concentration of 1.2 × 10⁷ cells/ml.
-
40
Aliquot 1 ml into each cryogenic vial using a serological pipet controller and a sterile 5‐ml serological pipette, then store at –80°C.
Basic Protocol 2. THAWING AND PLATING CRYOPRESERVED MURINE BONE MARROW FOR MACROPHAGE DIFFERENTIATION
This protocol describes the differentiation of murine bone marrow hematopoietic cells (stem cells and leukocytes) into macrophages for use in an in vitro model of macrophage senescence. The procedure begins on day 0 with the thawing of cryopreserved bone marrow cells (see Basic Protocol 1 for cryopreservation details), followed by a medium change on day 5, and continues through a 7‐ to 8‐day culture period in medium supplemented with L929 conditioned medium that contains M‐CSF. L929‐conditioned medium is prepared in advance as described in STAR Protocols (Rawat et al., 2023). The differentiation process typically yields approximately 1.2–1.5 × 10⁷ adherent macrophages per 10‐cm dish. These cells express canonical macrophage markers, including F4/80⁺, CD11b⁺, and CD68, which can be validated by flow cytometry and/or quantitative PCR (qPCR) (see Support Protocols 1 and 2). The protocol concludes with steps for harvesting and plating fully differentiated macrophages for downstream applications in senescence studies.
Materials
70% ethanol (see recipe)
RPMI‐C medium (warmed to 37°C; see recipe)
Vial of cryopreserved bone marrow cells (see Basic Protocol 1)
MGM medium (warmed to 37°C; see recipe)
60/40 medium (warmed to 37°C; see recipe)
Cell dissociation buffer (see recipe)
Phosphate‐buffered saline (PBS), sterile and cold (4°C) (Current Protocols, 2006)
Trypan blue (Thermo Fisher, cat. no. 15250061)
Biological safety cabinet (BSC; Nuaire Class II Type 2, or equivalent)
15‐ml sterile conical tubes (Thermo Fisher, cat. no. 339650)
Conical tube rack
Bead or water bath, 37°C
Centrifuge (Sorvall ST40R centrifuge with TX‐1000 rotor, or equivalent)
100‐mm untreated Petri dishes (VWR, cat. no. 25384‐342)
Tissue culture incubator 37°C, 5% CO2
Tissue culture microscope (Nikon or equivalent)
1.5‐ml microcentrifuge tube
1.5‐ml tube rack
Serological pipet controller (Drummond, or equivalent)
5‐, 10‐, and 25‐ml filtered, individually wrapped serological pipettes
50‐ml conical tubes (Thermo Fisher, cat. no. 339653)
Biological material vaccum aspiration system (inside of BSC)
Aspirating pipettes
10‐, 20‐, and 200‐µl pipettes and filtered pipette tips
Macrophage differentiation
Day 0: Thawing cells (10 to 15 min)
-
1
Prepare BSC by sterilizing with 70% ethanol, then transfer a sterile 15‐ml conical tube into the hood.
-
2
Add 9 ml of warm RPMI‐C to the 15‐ml conical tube.
-
3
Thaw cryopreserved cells by retrieving a vial of cryopreserved bone marrow cells from the –80°C freezer. Immediately place the vial in a 37°C water bath and thaw until a small ice pellet (pea‐sized) remains.
DMSO in the cryopreservation medium is toxic to cells and must be diluted promptly after thawing.
-
4
Spray the outside of the vial with 70% ethanol and transfer it to the BSC.
-
5
Dilute cells by transferring 1 ml of the thawed DMSO/cell suspension to the 15‐ml conical tube containing 9 ml of pre‐warmed RPMI‐C medium (final volume: 10 ml). Gently invert the tube to mix.
-
6
Centrifuge the cell suspension for 5 min at 0.3 × g, room temperature, using a swinging‐bucket rotor.
-
7
Return the tube to the BSC. Carefully aspirate the supernatant. Resuspend the cell pellet in 10 ml of warm MGM by gently pipetting up and down.
MGM should contain 25% M‐CSF to support macrophage differentiation.
-
8
Add 5 ml of warm MGM to each of two 100‐mm untreated Petri dishes. Then, add 5 ml of the cell suspension to each dish.
-
9
Incubate the dishes at 37°C and 5% CO2 for 5 days.
Most bone marrow cells will remain non‐adherent during the first 5 days. Cells will gradually adhere and begin differentiating. Inspect daily for contamination.
Day 5: Feeding BMDMs (10 to 20 min)
-
10
Warm MGM to 37°C.
-
11
Inspect cultures under a brightfield microscope to check for contamination and cell adherence.
50% to 60% of bone marrow cells should be adhered at this point, though some will remain in suspension.
-
12
Add 5 ml of warm MGM to each 10‐cm dish containing differentiating cells.
-
13
Return dishes to a humidified incubator at 37°C with 5% CO2 for an additional 2 to 3 days.
Inspect daily for contamination.
Day 7 or 8: Harvesting and plating BMDMs (45 to 60 min)
Harvest can be performed on day 7 or 8, depending on confluence. Cultures ready for harvesting and plating should be 80% to 90% confluent with fully differentiated macrophages.
-
14
Warm RPMI‐C and MGM to 37°C.
-
15
Prepare 100 ml of 60/40 medium (60% RPMI‐C, 40% MGM).
This dilution reduces M‐CSF exposure post‐differentiation.
-
16
Label a 1.5‐ml microcentrifuge tube for cell counting.
-
17
Set up a 50‐ml conical tube to collect harvested cells.
-
18
Chill sterile PBS and cell dissociation buffer on ice or store at 4°C.
-
19
Inspect cultures with a brightfield microscope to confirm viability and absence of contamination.
Viable cells will be adhered to the culture dish. Contaminated cultures will appear turbid.
-
20
Aspirate spent medium from each 10‐cm dish.
-
21
Wash cells with 5 ml of cold, sterile PBS.
-
22
Add 5 ml of cold cell dissociation buffer to each dish and incubate for 10 min at room temperature.
-
23
Tilt the dish slightly towards you and aspirate ∼3 ml of cell dissociation buffer using a serological pipet controller and sterile 5 ml serological pipette, then forcefully dispense across the dish to slough cells off the surface.
Tip: Work in quadrants to maximize cell recovery.
-
24
Transfer the cell suspension to a sterile 50‐ml conical tube.
Tip: Rinse the plate with an additional 5 ml of cell dissociation buffer and combine with initial suspension.
-
25
Centrifuge cells for 5 min at 0.3 × g, room temperature, using a swinging‐bucket rotor.
-
26
Aspirate the supernatant using a biological material vacuum aspiration system and resuspend the cell pellet in 20 ml of 60/40 medium.
-
27
Transfer 15 µl of the resuspended cells to a 1.5‐ml tube using a 20‐µl pipette.
-
28
Add 15 µl trypan blue to the sample tube (outside the hood) and mix gently.
-
29
Count cells using a hemocytometer and calculate total cell number.
-
30
Determine the resuspension volume required to seed cells at a density of 250,000 cells/ml.
For example, if the total cell number is 20,000,000, then (20,000,000 cells)/(250,000 cells/ml) = 80 ml total volume. Since cells are already in 20 ml medium, add 60 ml of 60/40 medium to reach the appropriate density.
-
31
Adjust cell suspension volume with 60/40 medium to achieve the desired density.
Use only sterile, non‐tissue culture‐treated dishes or plates, as macrophages are highly adherent.
Tip: Most experiments are done in 6‐well plates, but 12‐well plates or 10‐cm dishes can also be used depending on the assay and cell number requirements.
Tip: Seed all wells for experimental conditions at this point. For controls, seed only the wells needed at this point; additional wells can be expanded throughout senescent induction timeline to attain number of senescent samples.
-
32
Verify cell presence under a brightfield microscope.
Cells will appear suspended and not yet attached after plating.
-
33
Incubate plated cells overnight at 37°C with 5% CO2.
Support Protocol 1. FLOW CYTOMETRY VALIDATION OF MACROPHAGE SURFACE MARKERS
This protocol will allow for use flow cytometry to validate macrophage differentiation by assessing expression of surface markers F4/80 and CD11b.
Materials
Senescent and non‐senescent control macrophages
Phosphate‐buffered saline (PBS), sterile and cold (4°C) (Current Protocols, 2006)
Cell dissociation buffer (see recipe)
Flow cytometry buffer (see recipe)
-
Fluorophore‐conjugated antibodies:
F4/80 (rat‐monoclonal F4/80 BUV661, BD Biosciences, cat no. 750643)
CD11b (rat‐monoclonal anti CD11b BV650, BioLegend, cat. no. 101239)
Viability dye, e.g., Zombie Aqua (Biolegend, cat no. 423101), optional
1.7‐ml tubes
Centrifuge (Sorvall ST40R centrifuge with TX‐1000 rotor, or equivalent)
Flow cytometer
-
1
After 7 to 8 days of differentiating macrophages, aspirate and discard medium.
-
2
Assuming in a 6‐well plate: Wash cells with 2 ml cold PBS. Aspirate and discard PBS.
-
3
Add 1 ml cold cell dissociation buffer and incubate at room temperature for 10 min.
-
4
Lift cells using shear force by pipetting cell dissociation buffer against well.
-
5
Transfer cell suspension into 1.7‐ml tubes.
-
6
Centrifuge for 5 min at 400 × g, room temperature. Wash with flow cytometry buffer and then resuspend in 100 µl buffer per sample.
-
7
Stain cells by directly adding conjugated antibodies against F4/80 and CD11b to sample tubes.
-
8
Incubate for 30 min at 4°C, protected from light.
-
9
Centrifuge for 5 min at 400 × g, room temperature.
-
10
Wash cells twice with flow cytometry buffer, resuspend in 200 to 300 µl flow cytometry buffer, and analyze by flow cytometry.
-
11
Gate on single, live cells and quantify the percentage of F4/80⁺CD11b⁺ cells.
Support Protocol 2. GENE EXPRESSION ANALYSIS VIA RT‐qPCR
This protocol will detail how to measure expression of macrophage‐specific genes, such as Adgre1 (F4/80) and Cd68, using RT‐qPCR to validate macrophage differentiation.
Materials
Phosphate‐buffered saline (PBS), sterile and cold (4°C) (Current Protocols, 2006)
Senescent and non‐senescent control macrophages
RNA STAT‐60 (Tel‐Test, cat. no. CS‐502)
Reverse transcription kit (Thermo Fisher, cat. no. 4368814)
SYBR Green master mix (Thermo Fisher, cat. no. A46109)
-
Primers for (see Table 1):
Adgre1 (F4/80)
Cd68
Reference gene (e.g., Hprt)
Thermocyclers (BioRad C1000 Touch thermocycler and BioRad CFX Opus 384 real time PCR system or equivalent)
Table 1.
Primers Used in This Study
| Gene Name | Manufacturer | Forward sequence | Reverse sequence |
|---|---|---|---|
| Adgre1 (F4/80) | IDT | TGACTCACCTTGTGGTCCTAACT | CCAAACTTCCCAGAATCCAGTCTTT |
| Cd68 | IDT | CTGTGTGTCTGATCTTGCTAGG | TGAAGGATGGCAGGAGAGTA |
| Hprt (reference gene) | IDT | TTTCCCTGGTTAAGCAGTACAGCCC | TGGCCTGTATCCAACACTTCGAGA |
| Cdkn1a (p21) | IDT | TTGCCAGCAGAATAAAAGGTG | TTTGCTCCTGTGCGGAAC |
| Cdkn2a (p16) | IDT | AACTCTTTCGGTCGTACCCC | TCCTCGCAGTTCGAATCTG |
| Il1b | IDT | GGGCAACCACTTACCTATTT | TCTAGAGAGTGCTGCCTAAT |
| Il6 | IDT | ACAAAGCCAGAGTCCTTCAGAGAG | AGAACTGATGAGAGGGAGGCCATT |
-
1
Wash differentiated cells with cold PBS. Lyse directly in wells using RNA STAT‐60.
-
2
Extract RNA.
-
3
Quantify and assess quality (e.g., A260/A280).
-
4
500 ng to 1 µg RNA as template for reverse transcription. Convert RNA to cDNA by following the manufacturer's protocol.
-
5
Set up and run qPCR reactions containing SYBR Green master mix, cDNA made in step 4 and macrophage or reference gene primers. Include appropriate controls.
-
6
Normalize target gene Ct values to reference gene and calculate fold‐change compared to undifferentiated bone marrow cells.
Basic Protocol 3. INDUCING SENESCENCE IN MACROPHAGES USING DOXORUBICIN OR IRRADIATION
This protocol outlines the induction of senescence in murine macrophages using either doxorubicin treatment or ionizing radiation. On day 0 (24 hr post‐plating, obtained at the end of Basic Protocol 2), cells are exposed to the senescence‐inducing stimulus. On Day 1, treated cells receive a medium change, while control cells are passaged at a 1:2 or 1:3 ratio, depending on confluency. The protocol includes maintenance steps from days 3 to 10 (see Alternate Protocol). Successful completion of this protocol yields macrophages that exhibit multiple senescence hallmarks, including SA‐β‐galactosidase activity, cell cycle arrest, morphological changes, and upregulation of senescence‐associated markers. Details for validating these endpoints are provided in Support Protocols 3 to 5.
Materials
Fully differentiated macrophages
70% ethanol (see recipe)
60/40 medium (warmed to 37°C; see recipe)
Doxorubicin (MedChemExpress, cat. no. HY‐15142), reconstituted in DMSO (Sigma‐Aldrich, cat. no. D2438) and protected from light (500 nM final concentration)
RPMI‐C medium (warmed to 37°C; see recipe)
MGM medium (warmed to 37°C; see recipe)
Cell dissociation buffer, sterile and cold (4°C) (see recipe)
Phosphate‐buffered saline (PBS), sterile and cold (4°C) (Current Protocols, 2006)
Biological safety cabinet (BSC; Nuaire Class II Type 2, or equivalent)
37°C humidified incubator with 5% CO2
Irradiator capable of delivering 10 Gy (for irradiation‐based senescence induction)
Water bath, set to 37°C
Tissue culture microscope (Nikon or equivalent)
6‐well non‐tissue culture treated plates
5‐, 10‐, and 25‐ml filtered, individually wrapped serological pipettes
Serological pipet controller (Drummond, or equivalent)
15‐ml sterile conical tubes (Thermo Fisher, cat. no. 339650)
Centrifuge (Sorvall ST40R centrifuge with TX‐1000 rotor, or equivalent)
CAUTION: Doxorubicin is a chemotherapeutic agent. It may cause cancer and is harmful if swallowed. Follow appropriate safety precautions for handling, storage, and disposal.
Day 0: Senescence induction (24 hr post‐plating)
-
1
Confirm that cells are free of contamination and that control wells are 80% to 90% confluent and fully adhered. Cells are induced to be senescent by either doxorubicin or irradiation treatment as described below.
Doxorubicin treatment
-
2
Thaw a vial protected from light.
-
3
BSC by sterilizing with 70% ethanol, then aliquot pre‐warmed 60/40 medium sufficient for replenishing wells (3 ml/well) receiving doxorubicin.
-
4
Add doxorubicin to the aliquot of 60/40 medium to reach a final concentration of 500 nM.
Spiking the medium in bulk minimizes potential variability from pipetting doxorubicin directly into each well.
-
5
Transfer all plates, including controls to the BSC to expose them to identical conditions minus the treatment. Aspirate spent media in wells receiving treatment, and add 3 ml of 60/40 medium spiked with 500 nM doxorubicin. Incubate cells for 24 hr.
Irradiation treatment
-
6
Set the irradiator to deliver 10 Gy of radiation and incubate cells for 10 days with medium changes as described below. Perform mock irradiation on control plates under the same handling conditions, without turning the irradiator on. Incubate cells for 24 hr.
Day 1: Post‐treatment handling (24 hr post‐treatment)
-
7
Warm RPMI‐C and MGM to 37°C.
-
8
Prepare fresh 60/40 medium (60% RPMI‐C, 40% MGM).
-
9
Chill sterile cell dissociation buffer.
-
10
Confirm cell viability and absence of contamination using a brightfield microscope. Control wells should be ∼100% confluent.
Assuming cells are in 6‐well plates
-
11
Aspirate spent medium from all control wells.
-
12
Wash wells with 2 ml of cold PBS and aspirate again.
-
13
Add 2 ml of cold cell dissociation buffer to each control well and incubate for 10 min at room temperature.
-
14
While control cells incubate, aspirate and discard medium from treated wells (doxorubicin or irradiated).
-
15
Add 3 ml of warm, fresh 60/40 medium to each treated well.
-
16
Lift control cells by pipetting up and down to detach them and transfer the suspension to a sterile 15‐ml conical tube.
-
17
Centrifuge the cells for 5 min at 0.3 × g, room temperature, using a swinging‐bucket rotor.
-
18
Aspirate and discard the supernatant and resuspend the pellet in an appropriate volume of 60/40 medium to allow a 1:2 split.
-
19
Add 2 ml of warm 60/40 medium to each new well.
-
20
Add 1 ml of the resuspended cells to each well.
-
21
Inspect wells under a brightfield microscope to confirm the presence of cells.
-
22
Incubate plates at 37°C in a humidified incubator with 5% CO2 for 9 days for treated cells, changing medium at day 4 and 8. For control cells we follow Alternate Protocol: Maintenance and Expansion of Control Macrophages.
MAINTENANCE AND EXPANSION OF CONTROL MACROPHAGES
Over the course of the senescence induction timeline (up to day 10 to 12), control macrophages require periodic passaging to maintain optimal confluency. In contrast, senescent macrophages are no longer proliferative and therefore do not require passaging. Instead, only medium replacement is performed to maintain consistent culture conditions. This protocol outlines the maintenance of both control and senescent macrophage populations, ensuring uniform handling and medium changes throughout the experimental timeline.
Additional Materials (also see Basic Protocol 3)
Cold PBS (Gibco, cat no. 14190144)
Cold cell dissociation buffer (see recipe)
Warm 60/40 medium (see recipe)
15‐ml sterile conical tubes
Brightfield microscope (for assessing confluency and morphology)
-
1
Prepare the BSC by sterilizing with 70% ethanol, then transfer a 15‐ml sterile conical tube, cold sterile PBS, cold sterile cell dissociation buffer and all plates into the hood. Aspirate spent medium from control wells, then wash each with 2 ml cold PBS. Aspirate, then add 2 ml cold cell dissociation buffer and incubate at room temperature for 10 min.
2 to 3 passages are typically performed over the full 10‐day period in 1:3 ratio unless stated otherwise, whenever cells reach 80% to 90% confluency.
-
2
During 10 min incubation, refresh the 60/40 medium in wells containing senescent macrophages by aspirating and discarding spent medium, then add 3 ml of fresh, warmed 60/40 medium.
-
3
After 10 min incubation, collect cells into the sterile 15‐ml conical tube, then pellet cells by centrifugation for 5 min at 0.3 × g, room temperature.
-
4
Transfer tube containing cell pellet back to the BSC, aspirate supernatant and resuspend cell pellet in warm 60/40 medium to achieve desired 1:3 split.
-
5
Return cells to incubator. Monitor daily using a brightfield microscope to assess confluency and to ensure sterility of cultures.
-
6
For the final passage, perform a 1:2 split instead of 1:3, as proliferation slows down at later timepoints.
-
7
Perform a final 60/40 medium refresh on all control and senescent macrophage wells 24 hr prior to final collection at day 10 to 12.
Support Protocol 3. BRIGHTFIELD MICROSCOPY AND SA‐β‐GALACTOSIDASE STAINING TO ASSESS SENESCENCE‐ASSOCIATED MORPHOLOGY
This protocol describes the use of brightfield microscopy and SA‐β‐galactosidase staining to assess morphological features and enzymatic markers associated with senescence in murine macrophages. Senescent macrophages typically appear larger, flatter, and exhibit increased granularity compared to non‐senescent controls (Fig. 2A). In addition, senescent cells exhibit elevated β‐galactosidase activity at pH 6.0, which can be detected using a commercial staining kit (Fig. 2C).
Figure 2.

Validation of senescence in macrophages. (A) Represenative brightfield microscopy image 20× magnficiation of passaged non‐senescent control, and senescent (irradiated or doxorubicin treated) macrophages. (B) Flow cytometery plots for ClickIT Edu labeling cell cycle assay. (C) Represenative brightfield microscopy image 10× magnficiation of SA‐betagalacotsidase staining on passaged non‐senescent control, and senescent (irradiated) macrophages. (D) Quantification of mean fluorescence intensity for SA‐betagalacotsidase activity in passaged non‐senescent control, and senescent (irradiated) macrophages. (E) Quantification of senescent and SASP marker gene expression using RT‐qPCR. Data is represented as ± SEM, unpaired t‐tests.
Materials
Culture plates containing senescent and/or control macrophages
Phosphate‐buffered saline (PBS), sterile and cold (4°C) (Current Protocols, 2006)
SA‐β‐galactosidase staining kit (Cell Signaling, cat. no. 9860)
Parafilm
Incubator set to 37°C (without CO2)
Brightfield microscope
-
1
Wash cells once with sterile PBS.
-
2
Fix cells according to SA‐β‐galactosidase staining kit instructions.
-
3
Rinse cells with PBS.
-
4
Stain cells according to kit instructions. Seal plates using parafilm around edges to prevent evaporation of staining solution to prevent crystal fomation.
-
5
Incubate at 37°C in a dry incubator (no CO2) for 12 to 16 hr.
-
6
Observe and image cells using a brightfield microscope.
Support Protocol 4. QUANTIFYING SENESCENCE AND SASP MARKER EXPRESSION BY qPCR AND/OR WESTERN BLOT
This protocol describes the evaluation of senescence‐associated and SASP‐related gene and protein expression in treated macrophages. Typical markers include Cdkn1a (p21) for senescence, and cytokines such as Il1b and Il6 for the SASP (see Table 1). Senescent macrophages will have increased p21 and SASP marker expression as compared to their non‐senescent controls (Fig. 2E).
Materials
Senescent and non‐senescent control macrophages
RIPA buffer (Thermo Fisher, cat. no. 89900)
BCA assay kit (Thermo Fisher, cat. no. A55861)
SDS‐PAGE reagents and apparatus
Primary antibodies for p21, p16, IL‐6, IL‐1β
Secondary HRP‐conjugated antibodies
ECL detection reagents
PVDF or nitrocellulose membrane
Western blot imaging system
qPCR
-
1
See Support Protocol 2 for required materials and steps.
Western blot (overview)
-
2
Lyse cells using RIPA buffer and quantify protein concentration using the BCA assay kit.
-
3
Run equal amounts of protein on SDS‐PAGE.
-
4
Transfer to membrane and block.
-
5
Incubate with primary antibodies overnight.
-
6
Incubate with secondary antibody and develop using ECL.
-
7
Quantify band intensity using imaging software.
Support Protocol 5. ASSESSMENT OF CELL CYCLE ARREST USING EdU LABELING WITH OPTIONAL DNA CONTENT STAINING
This protocol describes the assessment of cell cycle arrest in macrophages via Click‐iT EdU incorporation and optional propidium iodide (PI) DNA content analysis. Senescent macrophages are expected to arrest in G1 and/or G2, show minimal EdU incorporation (∼80% reduction in S phase as compared to non‐senescent controls), and display an increased proportion of cells with >4N DNA content (Fig. 2B).
Materials
Senescent and non‐senescent macrophages
Click‐iT EdU Alexa Fluor 647 flow cytometry assay kit (Thermo Fisher, cat. no. C10419)
1% bovine serum albumin (BSA; Gemini Bio, cat. no. 700‐100P) in PBS (Current Protocols, 2006)
Propidium iodide (PI) (Thermo Fisher, cat. no. P3566), optional
RNase A (Thermo Fisher, cat. no. R1253), optional
Biological safety cabinet (BSC; Nuaire Class II Type 2, or equivalent)
Microcentrifuge tubes
10‐, 20‐, and 200‐µl pipettes and filtered pipette tips
Serological pipet controller (Drummond, or equivalent)
5‐, 10‐, and 25‐ml filtered, individually wrapped serological pipettes
Flow cytometer
-
1
Transfer senescent and non‐senescent macrophages into BSC.
-
2
Incubate cells with EdU for 2 hr by adding EdU directly into each appropriate well. Swirl gently.
Final concentration per kit instructions. Unstained control is recommended.
-
3
After 2 hr incubation, aspirate spent medium, then wash cells with 2 ml of 1% BSA in PBS.
-
4
Aspirate 1% BSA in PBS, then lift cells with 1 ml of cell dissociation buffer.
-
5
Incubate for 10 min at room temperature, then collect cells in 1.7‐ml microcentrifuge tubes.
-
6
Aspirate, then resuspend in 100 µl of Click‐IT fixative (Component D)
-
7
Fix, permeabilize and Perform the Click‐iT reaction on cells as per kit protocol.
-
8
Optional: Stain with PI and treat samples with RNase A to assess DNA content.
-
9
Analyze EdU incorporation and/or DNA content via flow cytometry.
REAGENTS AND SOLUTIONS
60/40 medium
60% final volume filter sterilized RPMI‐C (see recipe)
40% final volume filter sterilized MGM (see recipe)
Mix all components in a sterile, single‐use Erlenmeyer flask
Store up to 1 month at 4°C
BMDM cryopreservation solution
Sterile DMSO (10% final volume; Sigma‐Aldrich, cat. no. D2438)
Sterile, cold fetal bovine serum (FBS) (90% final volume; Gibco, cat. no. A5256801)
Mix components in a sterile conical tube in a BSC
Prepare fresh and use immediately
Cell dissociation buffer
500 ml sterile DPBS (Gibco, cat. no. 14190144)
5 ml EDTA (0.5 M stock concentration, 5 mM final concentration; Invitrogen cat. no. 15575‐020)
Add EDTA directly to new bottle of sterile DPBS and pipette up and down to mix
Store up to 1 month at 4°C
Ethanol, 70%
70% reagent alcohol (Fisher Scientific, cat. no. A962‐4)
30% ddH2O
Store up to 2 weeks at room temperature
Flow cytometry buffer
498 ml DPBS (Gibco, cat. no. 14190144)
2.5 g bovine serum albumin (BSA) (Gemini Bio, cat. no. 700‐100P)
2 ml EDTA (2 mM final; Invitrogen, cat. no. 15575‐020)
Mix components together in a sterile glass bottle
Store up to 6 months at 4°C
Macrophage growth medium (MGM; complete medium supplemented with M‐CSF)
305 ml RPMI 1640 with l‐glutamine (61% final volume; Corning, cat. no. 10‐040‐cv)
125 ml L929 conditioned medium (25% final volume; see STARS protocol by Rawat et al. (2023 for conditioned medium production)
50 ml FBS (10% final volume; Gibco, cat. no. A5256801)
5 ml HEPES (10 mM final; Gibco, cat. no. 15630080)
5 ml l‐glutamine (2 mM final; Gibco, cat. no. 25030081)
5 ml penicillin‐streptomycin (P/S) (100 U final; Gibco, cat. no. 15140‐122)
5 ml sodium pyruvate (1 mM final; Gibco, cat. no. 11360070)
1.8 µl of 2‐mercaptoethol (BME) (Sigma‐Aldrich, cat. no. M3148)
Mix all components in a sterile, single‐use Erlenmeyer flask
Filter sterilize using a 500‐ml complete vacuum filtration unit (VWR, cat. no. 10040‐436)
Store up to 1 month at 4°C
RPMI‐C (complete medium)
430 ml RPMI 1640 with l‐glutamine (86% final volume; Corning, cat. no. 10‐040‐cv)
50 ml FBS (10% final volume; Gibco, cat. no. A5256801)
5 ml HEPES (10 mM final; Gibco, cat. no. 15630080)
5 ml l‐glutamine (2 mM final; Gibco, cat. no. 25030081)
5 ml penicillin‐streptomycin (P/S) (100 U final; Gibco, cat. no. 15140‐122)
5 ml sodium pyruvate (1 mM final; Gibco, cat. no. 11360070)
1.8 µl of 2‐mercaptoethol (BME) (Sigma‐Aldrich, cat. no. M3148)
Mix all components in a sterile, single‐use Erlenmeyer flask
Filter sterilize using a 500‐ml complete vacuum filtration unit (VWR, cat. no. 10040‐436)
Store up to 1 month at 4°C
COMMENTARY
Critical Parameters
Basic Protocol 1: Mouse dissection and bone marrow harvest
Harvest bone marrow from 8‐ to 10‐week‐old C57BL/6 mice. Using younger mice may result in lower yields due to underdeveloped bone marrow, while older mice may have reduced hematopoietic activity or altered immune profiles that can impact bone marrow cell quality and quantity.
Ensure complete removal of skeletal muscle to reduce contamination.
Do not snap or cut through the femur bone at the hip joint, as this decreases yield.
Always keep harvested bones and cell suspensions on ice to maintain cell viability.
Confirm ethanol is fully removed with ≥3 rinses of sterile RPMI‐C before crushing bones.
Freeze cells at –80°C in appropriate cryopreservation containers; rapid temperature changes can reduce viability.
Basic Protocol 2: Thawing and plating cryopreserved murine bone marrow for macrophage differentiation
Minimize the amount of time thawed cells are in BMDM cryopreservation solution post thaw, as DMSO can be toxic to cells.
Perform all centrifugation steps at low speed (e.g., 5 min at 0.3 × g) to minimize cell loss.
Use only non‐tissue culture treated dishes to ensure proper macrophage adherence without over‐attachment.
Ensure that M‐CSF is added at the correct volume as specified in the protocols, as it is essential for both the differentiation of bone marrow into macrophages and the maintenance of macrophage identity. M‐CSF concentrations in L929‐CM can vary with culture conditions and passage history, typically 20 to 50 ng/ml (Rawat et al., 2023). In this protocol, L929‐CM makes up 25% of the final culture medium, reliably supporting macrophage differentiation. Because levels are not standardized, batch‐to‐batch variation may occur; differentiation should be validated using the Support Protocols. Alternatively, recombinant murine M‐CSF (50 ng/ml) can be used to achieve comparable differentiation.
Basic Protocol 3: Inducing senescence in macrophages using doxorubicin or irradiation
To minimize variability between samples and across cultures, prepare a doxorubicin stock solution in 60/40 medium rather than pipetting the drug directly into wells.
Refresh 60/40 medium 24 hr after irradiation or doxorubicin treatment to remove dead cells and ensure consistent exposure to stimuli across cultures.
Alternate Protocol: Maintenance and expansion of control macrophages
Avoid over‐confluence when culturing control cells; overgrown cultures may alter bone marrow behavior and yield.
Ensure that M‐CSF is added at the correct concentrations as specified in the protocols, as it is essential for both the differentiation of bone marrow cells into macrophages and the maintenance of macrophage identity.
Support Protocol 3: Brightfield microscopy and SA‐β‐galactosidase staining to assess senescence‐associated morphology
Ensure the SA‐β‐Gal staining solution is adjusted to a pH of 6.0, as this pH is critical for selectively detecting β‐galactosidase activity associated with senescent cells. At pH 6.0, endogenous β‐galactosidase activity in non‐senescent cells is minimal, reducing background staining and allowing for specific visualization of senescence‐associated β‐gal activity.
Troubleshooting
See Table 2 for a troubleshooting guide for mouse dissection and bone marrow harvest. See Table 3 for a troubleshooting guide for inducing senescence in macrophages using doxorubicin or irradiation. See Table 4 for a troubleshooting guide for SA‐β‐gal staining.
Table 2.
Troubleshooting Guide for Mouse Dissection and Bone Marrow Harvest
| Problem | Possible Cause | Solution |
|---|---|---|
| Low bone marrow yield | Incomplete removal of muscle tissue; improper bone dissection | Remove all muscle thoroughly and extract the femur cleanly from the hip joint without breaking the bone |
| Low viability after cryopreservation | Improper freezing medium or rapid freezing | Use freshly prepared 90% FBS + 10% DMSO; freeze gradually using a controlled‐rate freezing container before storing at –80°C |
Table 3.
Troubleshooting Guide for Inducing Senescence in Macrophages Using Doxorubicin or Irradiation
| Problem | Possible cause | Solution |
|---|---|---|
| Inconsistent senescence induction | Uneven doxorubicin delivery or variable irradiation dosage | Prepare a doxorubicin stock in 60/40 medium; ensure consistent and calibrated irradiation conditions |
Table 4.
Troubleshooting Guide for SA‐β‐Gal Staining
| Problem | Possible cause | Solution |
|---|---|---|
| Poor SA‐β‐Gal staining | Incorrect pH of staining solution | Adjust and maintain staining solution at pH 6.0 to specifically detect senescence‐associated β‐galactosidase activity |
Understanding Results
This protocol yields macrophages that exhibit canonical features of senescence following genotoxic stress.
Morphology and SA‐β‐Gal activity (Fig. 2A and C‐D)
Senescent macrophages display enlarged, flattened morphology and strong SA‐β‐galactosidase activity, visualized by brightfield microscopy (Fig. 2A and 2C, respectively) and quantified using the SPiDER‐Gal flow cytometery based assay (Fig. 2D). Inconsistent staining may indicate suboptimal pH or insufficient induction time.
Gene expression (Fig. 2E)
RT‐qPCR shows robust upregulation of Cdkn1a (p21), Il1b, Il6, Pla2g7, Mmp9, and Mmp12, confirming senescence and SASP activation by day 10.
Cell cycle arrest (Fig. 2B)
EdU incorporation is markedly reduced in senescent cells, consistent with permanent growth arrest. Partial G2/M accumulation may be observed via PI staining.
Non‐quantitative protocols
Bone marrow harvest yields ∼2–2.4 × 10⁸ bone marrow cells/mouse.
Differentiation produces ∼1.2–1.5 × 10⁷ macrophages per 10‐cm dish, validated by morphology and F4/80⁺ CD11b⁺ expression.
The results confirm that the described protocols produce primary murine macrophages that robustly exhibit morphological, molecular, and functional hallmarks of senescence following DNA damage. Figures and Tables (e.g., Fig. 2A‐E) serve as benchmarks that users can refer to when validating their own replicates. Variability in SASP gene expression, or incomplete SA‐β‐Gal staining, are possible and can be mitigated through timing adjustments and medium consistency.
This in vitro system provides a reliable, reproducible foundation for studying macrophage senescence biology with clear checkpoints for assessing successful protocol execution.
Time Considerations
See Table 5 for time considerations.
Table 5.
Protocol Time Considerations
| Protocol | Hands‐on time | Incubation/waiting time | Total duration |
|---|---|---|---|
| Mouse dissection and bone marrow harvest | 2.5‐3 hr | — | 1 day |
| Macrophage differentiation: day 0 (thaw and plate) | 2 hr | 5 days | 7‐8 days |
| Macrophage differentiation: day 5 (medium change) | 30‐45 min | Continue to day 7‐8 | — |
| Macrophage differentiation: day 7‐8 (Harvest/Plate) | 1.5‐2 hr | — | — |
| Support Protocol 1: Flow cytometry | 2.5‐3 hr | ∼1 hr antibody incubation | Same day |
| Support Protocol 2: RT‐qPCR validation | 4‐5 hr | — | Same day |
| Senescence induction: day 0 (treatment) | 2 hr | 24 hr (doxorubicin); immediate (IR) | 10‐12 days total |
| Senescence induction: day 1 (medium change) | 1‐1.5 hr | Continue to day 10‐12 | — |
| Senescence induction: days 3‐10 (maintenance) | 15‐30 min per timepoint | — | — |
| SA‐β‐gal staining and morphology | 3 hr | 4‐16 hr (varies by kit) | Same day or overnight |
| qPCR/western for senescence/SASP | 4‐6 hr | — | Same day |
| EdU/PI flow cytometry | 3‐4 hr | 1‐2 hr EdU incubation | Same day |
Author Contributions
Grasiela Torres: Data curation; formal analysis; investigation; writing—original draft; writing—review and editing. Utkarsh Tripathi: Writing—original draft; writing—review and editing. Ivan Salladay‐Perez: Data curation; formal analysis; validation. Itzetl Avila: Data curation; visualization. Anthony Covarrubias: Conceptualization; funding acquisition; methodology; project administration; supervision; validation; writing—review and editing.
Conflict of Interest
The authors declare no conflict of interest.
Acknowledgments
The research reported in this publication was supported by the National Institute of General Medical Sciences of the National Institutes of Health Maximizing Investigators' Research Award (MIRA) award number 1R35GM156893‐01. This project was supported by funds provided by the Glenn Foundation for Medical Research and American Federation of Aging Research, Junior Faculty Award (20225528), and the UCLA‐UCSD Diabetes Research Center Award funded by the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) grant P30DK063491, and also supported by the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), the Office of Disease Prevention (ODP), the Office of Nutrition Research (ONR), the Chief Officer for Scientific Workforce Diversity (COSWD), and the Office of Behavioral and Social Sciences Research (OBSSR) of the National Institutes of Health under award number U24DK132746‐01, UCLA LIFT‐UP (Leveraging Institutional Support for Talented, Underrepresented Physicians and/or Scientists). G.T. is supported by the NIH Ruth L. Kirschstein National Research Service Award AI007323, T32 training grant 2T32AI007323‐31. I.S.P. was supported by the National Institute of General Medical Sciences of the National Institutes of Health under Award Number T32GM145388.
Torres, G. , Tripathi, U. , Salladay‐Perez, I. , Avila, I. , & Covarrubias, A. J. (2026). An In Vitro Model of Macrophage Senescence. Current Protocols, 6, e70230. doi: 10.1002/cpz1.70230
Published in the Immunology section
Data Availability Statement
Raw data is available upon request.
Literature Cited
- Behmoaras, J. , & Gil, J. (2020). Macrophage senescence: The intimate interplay between aging and inflammation. Journal of Cell Biology, 219(7), e202006017. 10.1083/jcb.202006017 [DOI] [Google Scholar]
- Current Protocols (2006). Commonly Used Reagents. Current Protocols in Microbiology, 00, A.2A.1–A.2A.15. 10.1002/9780471729259.mca02as00 [DOI] [Google Scholar]
- Geng, Y. , Qiu, Y. , Zhang, J. , Liu, L. , Wei, H. , & Zhang, W. (2022). Senescence in macrophages: Mechanisms and relevance to disease. Frontiers in Immunology, 13, 915110. 10.3389/fimmu.2022.915110 [DOI] [Google Scholar]
- Liu, W. , Tang, Y. , Wang, D. , Yu, L. , Zhang, F. , & Shao, L. (2022). Dysregulation of p53 in cancer‐derived macrophage models limits insight into senescence biology. Cell Death & Disease, 13, 739. 10.1038/s41419-022-05089-y 36030251 [DOI] [Google Scholar]
- Mijit, M. , Caracciolo, V. , Melillo, A. , Amicarelli, F. , & Giordano, A. (2020). Role of p53 in the regulation of cellular senescence. Biomolecules, 10(3), 420. 10.3390/biom10030420 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rawat, A. , Jha, M. K. , & Morrison, B. M. (2023). Adoptive cell transfer of macrophages following peripheral nerve injury in mice. STAR Protocols, 4(4), 102624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Salladay‐Perez, I. A. , Avila, I. , Estrada, L. , Alexandru, A. C. , Ponce, C. , Dhingra, A. , Torres, G. , Deng, C. Y. , Hegde, R. , Gensheimer, J. , Kale, A. , Heckenbach, I. , Hui, S. , Edillor, C. , Soto, J. A. , Napior, A. J. , Little, I. , Larsen, M. , Rose, J. , … Covarrubias, A. J. (2026). p21+TREM2+ senescent macrophages fuel inflammaging and metabolic dysfunction-associated steatotic liver disease. Nature Aging. 10.1038/s43587-026-01101-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Salladay‐Perez, I. A. , & Covarrubias, A. J. (2026). Cholesterol‐induced senescent macrophages and evaluation of cellular senescence phenotypes. Current Protocols, 6, e70355. 10.1002/cpz1.70355 [DOI] [Google Scholar]
- Su, X. , Xu, Y. , Yu, H. , Xiao, Y. , & Zhou, X. (2021). Distinguishing senescence from polarization in macrophage subtypes. Cell Communication and Signaling, 19, 45. 10.1186/s12964-021-00718-4 33882943 [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Raw data is available upon request.
