Human Primary Mesenchymal Stem Cells Fail to Recover Full Osteogenic Differentiation Potential Following Washout of Electronic Cigarette Aerosol Extracts

Abstract

Introduction

Electronic cigarettes (e-cigarettes) are promoted as safer alternatives to combustible cigarettes. However, the health burden and effects of their long-term use remain unidentified. This study evaluates the extent and reversibility of cellular damage in human bone marrow-derived mesenchymal stem cells (MSCs), following in vitro exposure to cigarette and e-cigarette smoke aerosols.

Methods

Human primary MSCs were seeded and exposed to combustible or e-cigarette smoke aerosol extracts for 2 or 3 weeks. MSCs were then assessed for survival and membrane protein expression and distribution. In addition, osteogenic differentiation potential was examined after addition of a differentiation cocktail made up of dexamethasone, ascorbic acid, and β-glycerophosphate.

Results

MSC-mediated cellular repair, described in terms of MSC proliferation and osteogenic differentiation, was compromised by both cigarette and e-cigarette aerosol extracts. MSCs exhibited partial recovery of their proliferative ability after smoke washout. Their membrane proteins were downregulated, and their distribution was altered on the plasma membrane. MSCs showed signs of early osteogenic differentiation following washout of e-cigarette, but matrix mineralization (indicative of terminal differentiation) was hampered, similarly to combustible cigarette aerosols.

Conclusions

These results provide insights on the safety of e-cigarettes and the potential risks they pose to regenerative health, help explain impaired tissue repair mechanisms in chronic smokers, and can serve to inform future public policies on tobacco control.

Implications

This study provides insight on the impact of electronic cigarettes on repair mechanisms mediated by stem cells. Importantly, it also examines the consequences of discontinuing combustible or electronic cigarette smoking on stem cell outcomes, notably proliferation, cell integrity, and differentiation potential. Findings from this work feed into the growing evidence on the harmful and persistent effects of electronic smoking modalities.

Introduction

Smokers of combustible cigarette (cigarette) are repeatedly advised to quit smoking, given the broad range of benefits that incur on the lungs specifically, but also systemically. Notably, lung physiology and systemic metabolic indicators improve within weeks of smoking cessation, perhaps contributing to the reduction of the cardiovascular risks associated with chronic smoking.^1-4 Although the electronic cigarette (e-cigarette) was originally marketed as a smoking cessation aid and may present a reduced risk compared to traditional cigarettes, it is far from being harmless.^5-11 In fact, studies have reported detrimental effects of e-cigarettes in vitro and in animal models.^8,12-17 Chronic e-cigarette vapers show impaired endothelial functions.^16,18,19 A consensus study report by the National Academies of Science, Engineering, and Medicine in the United States reviewed over 800 studies, concluding that using e-cigarettes causes health risks and e-cigarettes contain and emit potentially toxic substances.²⁰ A recent scoping systematic review of 33 studies assessing the direct health implications of e-cigarettes indicated that e-cigarette smoking has direct cardiovascular, pulmonary, metabolic, and vascular effects. In addition, certain e-cigarette vaping systems may increase blood nicotine levels similarly to or to a more pronounced extent than cigarettes, raising concerns about addiction.²¹

Endogenous stem or progenitor cells residing within mature tissues are part of the body’s repair mechanisms and can be triggered and recruited to repopulate, repair, and/or regenerate injured tissues.²² By impacting stem/ progenitor cells, e-cigarettes, even though potentially to a lesser extent than cigarettes, attenuate body repair mechanisms.¹⁴ E-cigarettes were shown to impact several types of stem/ progenitor cells, including human embryonic stem cells,²³ hematopoietic progenitor stem cells,^24,25 neural progenitor stem cells,²⁶ induced pluripotent stem cells derived from endothelial cells,^27,28 cardiac cells,^29,30 hepatic fibroblast cells,³¹ dental pulp mesenchymal stem cells,³² primary human gingival (GMSCs) and periodontal ligament stem cells,³³ mesenchymal stem cells (MSCs),³⁴ bone marrow-derived mesenchymal stem cells (BM-MSCs),¹⁴ and immortalized human BM-MSC SCP-1 cells.³⁵

MSCs are adult stem cells with the ability of self-renewal and differentiation into a range of specialized cell types and are mobilized to sites of wound injury to assist in the wound-healing process,³⁶ where they can secrete factors that help regenerate and repair damaged tissues.^22,37 In response to signals emanated following tissue injury, MSCs could transport into the blood circulation, and may accumulate at damaged tissue sites, a process known as homing.^22,37-39 As recently reviewed, compromised MSCs can jeopardize repair mechanisms and result in MSCs that are not suitable for use in stem cell-based therapies.⁴⁰

Cigarette smoke is the main inducing factor for emphysema, lung cancer, and chronic obstructive pulmonary disease (COPD). It is suggested that lung repair is defective, inappropriate, delayed, or impaired in COPD.⁴¹ In emphysema, including cigarette smoking-induced emphysema, pulmonary function is irreversibly lost, partly due to disruption of lung repair, the loss or impairment of resident alveolar stem cells, and the inability of MSCs to home to the injured lungs.^42,43 In the case of e-cigarettes, the evidence linking e-cigarette vaping to chronic pulmonary diseases such as emphysema and COPD is evolving.^44-48 Bircan et al. reported that e-cigarette vaping is associated with higher risk of COPD among people who have never smoked a combustible cigarette.⁴⁹ In contrast, Polosa et al. reported that cigarette smokers with COPD who switched to e-cigarettes showed significant and constant improvement in lung functions over a 5-year follow-up period.⁵⁰

In an attempt to understand why chronic smoking seems to impair repair mechanisms and provoke or exacerbate diseases such as COPD and osteoporosis,^1,51 we have previously investigated the effects of cigarette and e-cigarette smoke on MSCs and have shown that MSC viability as well as differentiation potential are compromised upon exposure to cigarette or e-cigarette smoke.¹⁴ At the molecular level, the study showed total loss of connexin 43 (Cx43) expression in MSCs, which translated into loss of gap junction-mediated intercellular communication, a build-up of reactive oxygen species, impaired cell growth, and an impaired ability to undergo osteoblastic differentiation.^14,52,53 Relatedly, data on the reversibility of e-cigarette-induced tissue injury and diseases, such as emphysema and COPD, is still limited. Indeed, studies are lacking on the effect of quitting e-cigarette vaping on pulmonary disease evolution, restoration of body repair systems, and stem/progenitor cells. One study showed that e-cigarette-injured neural stem cells do not fully recover following removal of e-cigarette aerosols.²⁶

Understanding the reversibility of smoke-induced damage to body repair mechanisms and MSCs is essential to assess the long-term impact of e-cigarette use on tissue regeneration and repair. Therefore, the present study models the effect of e-cigarette cessation on the recovery of cellular repair mechanisms by comparing MSCs exposed to combustible cigarettes and to e-cigarettes, followed by a washout period. Additionally, this study looked at the effects of switching MSC exposure from combustible to e-cigarettes. In particular, given the regenerative abilities of MSCs and their involvement in repair mechanisms, this study assessed the reversibility of the effects of smoke exposure on MSCs, in terms of survival and ability to undergo osteogenic differentiation.

Methods

Cells and Cell Culture

Human primary MSCs were isolated from BM aspirates of human subjects attending the American University of Beirut Medical Center and for whom a hematological malignancy was ruled out. The BM aspirates were classified as medical waste and provided anonymously, thus not requiring Institutional Review Board approval. Briefly, BM aspirates were diluted in phosphate-buffered saline (PBS; Sigma-Aldrich Co., St. Louis, MO, United States) and subjected to Ficoll-Paque gradient centrifugation (Ficoll® Paque Plus, Cytiva 17-1440-02, Merck KGaA, Darmstadt, Germany). Nucleated cells collected in the buffy coat were plated onto tissue culture dishes in 1 g/L (low) glucose Dulbecco’s Modified Eagle Medium (DMEM-LG, Sigma-Aldrich Co, St. Louis, MO, United States), supplemented with v/v 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, in a humidified incubator at 5% CO₂ and 37°C. Five to seven days later, the supernatant containing the majority of non-adherent cells was discarded, and the remaining cells attached to plastic were refed with cell culture media. The attached cells had a heterogeneous fibroblastic-like spindle-shaped appearance, and flow cytometry analysis had shown that they expressed cluster of differentiation (CD) 73, CD90, and CD105, characteristic of MSCs. These human primary MSCs were cryopreserved after the second or third passage. For experiments, MSCs were thawed, expanded, and used at passages 4 or 5. Cells were observed regularly using light microscopy with a Zeiss Axiovert A.1 Microscope (Zeiss, Germany) operated by the Zen lite software (Zeiss, Germany). Images were captured to show cell confluence and morphology.

Exposure to Smoke Aerosol Extracts

Combustible and e-cigarette aerosols were generated using the Oro-nasal Respiratory Exposure System (ONARES, CH Technologies, United States), as previously described.¹³ Briefly, combustible cigarette particulate matter was generated from reference 3R4F cigarettes (University of Kentucky, Lexington, KY, United States) containing 9.4 mg tar, and 0.726 mg nicotine per cigarette, following a puffing protocol of one 2-second puff every minute and a volume of 35 mL/puff (ISO standard). E-cigarette particulate matter was obtained from pre-filled V4L CoolCart (strawberry flavor, 3.5 Ohm, 18 mg/mL labeled nicotine concentration) cartomizer cartridges, by 4-second puff duration, 1.2 L/minute flow rate, and 14-second inter-puff interval. Aerosol particles (total particulate matter [TPM]) were trapped onto 47-mm glass fiber filter disks type A/E (Pall Laboratory, United States) and then extracted in cell culture medium using a syringe and sterilized through a 0.22-μm filter (Costar, Corning Inc., NY, USA), as described previously.¹⁴ Smoke aerosol extracts were then diluted to the predetermined concentrations of 0.4 mg/mL cigarette TPM and 4 mg/mL e-cigarette TPM¹⁴ in appropriate cell culture media and applied onto MSCs. During experiments, cells were either left growing for 2 or 3 weeks without smoke exposure, as a control, or exposed to cigarette and e-cigarette smoke aerosol extracts continuously for 2 or 3 weeks, or for 2 weeks followed by a 1-week washout period in smoke-free media.

Cell Viability Assay

Cell growth and survival were assessed using the Trypan Blue dye exclusion assay, and live and dead cells were manually counted using a hemocytometer. MSCs were seeded at 6000 cells/cm² and exposed to 0.4 mg/mL cigarette or 4 mg/mL e-cigarette smoke aerosol extracts for 2 weeks, followed by a 1-week washout (smoke-free recovery). At the predetermined time points, cells were washed with PBS, detached using trypsin (Sigma-Aldrich Co., St. Louis, MO, United States), centrifuged at 500 × g, and resuspended in FBS-containing media. An equal volume of the suspended cells and trypan blue dye was mixed, loaded onto a hemocytometer, and counted. Data are presented as percentages of control from at least three independent experiments run in duplicate.

Gene Expression Analysis

Total RNA was extracted and digested out of contaminating genomic DNA from control or experimental cells grown in 6-well tissue culture plates, using Nucleospin RNA II extraction kit (Macherey-Nagel, Düren, Germany), as per manufacturer’s instructions. Total RNA is eluted in RNase-free water and quantified at 260 nm using a NanoDrop spectrophotometer (DeNovix DS-11 spectrophotometer, DeNovix Inc, Wilmington, United States); a 260/280 absorbance of 1.8-2.0 was considered satisfactorily pure. cDNA was prepared from 1 μg of extracted total RNA as a template, using the iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, United States) as per manufacturer’s protocol. Quantitative real-time-PCR was performed using the iQ SYBR Green Supermix (BioRad) in a CFX96 Real-time C1000 thermal cycler (BioRad). cDNA amplification was performed using the primers listed in Table 1 at the following PCR cycling conditions: a pre-cycle at 95°C for 5 minutes, 40 cycles (each consisting of a denaturation step at 95°C for 10 seconds and an annealing step at a temperature dependent on the primers’ annealing temperature for 30 seconds), and a final extension step at 72°C for 5 minutes. The fluorescence threshold cycle (Ct) was obtained for each gene and normalized to that of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase. The comparative Ct (ΔΔCt) method was used to describe the fold change in target gene expression of experimental conditions compared to control cells.

Table 1.

Primer sequence

Primer	Sequence (5’3’)		Annealing temperature
Cx43 (GJA1)	F: CTTCTACTTTTAAGCAAAAGAG	R: TCCCTCCAGCAGTTGAG	58°C
ZO-1 (TJP1)	F: CAGCCGGTCACGATCTCCT	R: TCCGGAGACTGCCATTGC	58°C
N-Cadherin (CDH2)	F: GGTGGAGGAGAAGACCAG	R: CGGTGGGGTTGAGGATCT	58°C
GAPDH	F: TGGTGCTCAGTGTAGCCCAG	R: GGACCTGACCTGCCGTCTAG	52-62°C

CDH2 = cadherin 2; Cx43 = connexin 43; F = Forward; GAPDH = glyceraldehyde 3-phosphate dehydrogenase; GJA1 = gap junction protein alpha 1; N-cadherin = neuronal cadherin; R = reverse; TJP1 = tight junction protein 1; ZO-1 = zonula occludens 1.

Immunofluorescence Staining

MSCs were seeded onto sterile glass coverslips in 24-well plates and exposed to cigarette or e-cigarette smoke aerosol extracts for 2 weeks continuously or for 2 weeks, followed by a 1-week washout period in smoke-free cell culture medium. A set of MSCs was also left as a control (not exposed to smoke aerosol extracts). At the end of the experimental duration, cells were washed in PBS and permeabilized and fixed in ice-cold absolute ethanol. Non-specific binding sites were blocked with 3% (v/v) non-immune goat serum in PBS for one hour at room temperature. Primary antibodies, diluted in 1% (v/v) non-immune goat serum in PBS to a concentration of 1 μg/mL, were added onto the cells overnight at 4°C in a humidified chamber. Labeling was achieved by the addition of Alexa Fluor 488- or Texas Red-labeled fluorescent secondary antibodies. Cell nuclei were stained with 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI). Finally, ProLong Antifade reagent (P36930, Molecular Probes, NY, United States) was used to mount the cells on a glass slide. Images were acquired using the laser scanning confocal microscope LSM710 (Zeiss, Jena, Germany) operated by the Zen software (Zeiss, Germany).

Osteogenic Differentiation

In order to induce the differentiation of MSCs into osteoblast-like cells, an osteogenic differentiation cocktail, beta-glycerophosphate, hereafter referred to as DAG, was prepared and applied to MSCs at the following working concentrations: 50 nM dexamethasone (DEXAMED, Medochemie, Limassol, Cyprus), 50 μM ascorbic acid, and 10 mM beta-glycerophosphate.¹⁴ MSCs were exposed to DAG and smoke aerosol extracts for 2 weeks (continuously) or for 2 weeks followed by a washout period in smoke-free media containing DAG only. Cells were incubated with DAG for another 2 or 3 weeks, depending on the experimental assays.

Alkaline Phosphatase Activity

Undifferentiated MSCs show a weak alkaline phosphatase (ALP) activity that is significantly elevated in MSCs differentiated into osteoblast-like cells.⁵⁴ At the end of the experiment (2 weeks of DAG exposure post-smoke aerosol extract washout), cells were washed in PBS, fixed in citrate-acetone-formaldehyde, and stained for ALP activity using the Leukocyte Alkaline Phosphatase Kit (86R, Sigma-Aldrich Co., St. Louis, MO, United States), according to the manufacturer’s instructions, where pink-purple staining is indicative of ALP activity. Wells were photographed to show differences between smoke-exposed and control cells. Images shown are representative of at least three independent experiments. The ImageJ tool (US National Institutes of Health, Bethesda, MD, United States) was used to quantify ALP activity across experimental conditions, and data are presented in arbitrary units relatively to control (% control).

Alizarin Red S Staining

One week after ALP activity assessment (3 weeks of DAG exposure post-smoke aerosol extract washout), cells were evaluated for their ability to deposit a mineralized matrix. Cells were washed in PBS, fixed in 75% ethanol, rinsed once with PBS, and twice with distilled water. Cells were then stained with Alizarin Red S (40 mM, pH 4.4) solution with gentle rocking for 20 minutes at room temperature, washed with distilled water, and left to air dry. Dark orange-red stain patches around MSCs indicate calcium phosphate-rich deposits, indicative of MSC differentiation into osteoblasts. Wells were photographed to show differences in experimental conditions, and images shown are representative of at least three independent experiments. The ImageJ tool (US National Institutes of Health, Bethesda, MD, United States) was used to quantify Alizarin Red S stain (orange-red patches) across experimental conditions, and data are presented in arbitrary units relatively to control (% control).

Statistical Analysis

Quantitative data represent the averages of data ± SD of at least 3 independent experiments. The two-tailed unpaired Student t-test was used to evaluate statistical significance between two groups (either control versus experimental or continuous exposure versus washout conditions). Analyses were performed using Microsoft Office Excel. The threshold for statistical significance was set at 0.05.

Results

MSC Viability Is Irreversibly Compromised by Cigarette, but Not E-Cigarette Aerosols

MSCs were exposed to cigarette or e-cigarette smoke aerosol extracts continuously for 2 or 3 weeks, or for 2 weeks, followed by a 1-week washout period in smoke-free media. In addition, MSCs were grown unexposed to smoke aerosol extracts as a control. Cell growth and viability were assessed by light microscopy as well as trypan blue cell exclusion assay. Figure 1A shows that, compared to control MSCs, the confluence of cells exposed to cigarette smoke aerosol extracts for 2 or 3 weeks continuously, or for 2 weeks followed by washout, was very low. MSCs exposed to e-cigarette smoke aerosol extracts also exhibited limited growth after 2 or 3 weeks of continuous exposure, but their cell numbers recovered after the 1-week washout. The morphological observations were also reflected by cell counts, expressed as percentages of control (Figure 1B). Compared to control cells, MSCs exposed continuously to either cigarette or e-cigarette smoke aerosol extracts exhibited a highly significant inhibition of cell viability, with 30% and <60% of MSCs surviving the 2-week cigarette and e-cigarette smoke aerosol extract exposure (p < .0001), respectively. This effect was exacerbated at 3 weeks (p < .0001). Following the washout, cigarette-exposed cell survival remained significantly lower than that of control cells (p < .0001) and similar to the viability of MSCs continuously exposed to cigarette smoke aerosol extracts (p > .05). In contrast, after e-cigarette washout, MSCs recovered their proliferation potential to levels comparable to those of control cells (difference was not statistically significant with p > .05). These cells had significantly improved cell counts compared to MSCs continuously exposed to e-cigarette smoke aerosol extracts (p < .01).

Figure 1.

Mesenchymal stem cell (MSC) proliferation and cell morphology are irreversibly compromised when exposed to cigarette, but not e-cigarette aerosol extracts. MSCs were exposed to either cigarette or e-cigarette aerosol extracts for 2 or 3 weeks (continuously) or for 2 weeks, followed by a 1-week washout period. MSCs were grown unexposed to smoke aerosols as a control. (A) Representative light microscopy images showing that cigarette-exposed MSCs fail to recover, whereas e-cigarette-exposed MSCs seem to recover regular cell morphology and proliferation rate, comparable to that of control MSCs. (B) The bar graphs show average cell counts following smoke exposure and replenishing with smoke-free media compared to control cells continuously growing in smoke-free media. Error bars represent SD. Experiments were run three times in duplicates. NS = not significant, ^**p < .01 and ^****p < .0001.

Cigarette Smoke Aerosol Extract-Induced Downregulation of MSC Membrane Proteins Expression Is Irreversible, Whereas E-Cigarette Aerosol Extract Effects Are Reversible

MSCs were either unexposed to smoke aerosols as a control or exposed to cigarette or e-cigarette smoke aerosol extracts for 2 weeks continuously or for 2 weeks followed by a 1-week washout period before total RNA was extracted and qRT-PCR performed. Figure 2 shows that the transcriptional levels of Cx43 (GJA1) dropped by 32% (p < .01) and 30% (p < .05) in cigarette and e-cigarette aerosol extract-exposed cells, respectively. Cx43 mRNA levels kept dropping to 32% even after 1 week of cigarette aerosol extract washout, significantly lower than the values recorded in the control cells (p < .001) and cells continuously exposed to cigarette aerosol extracts for 2 weeks (p < .05). Conversely, Cx43 mRNA levels increased to almost control levels (95% of control) after e-cigarette aerosol extract washout. Similar trends were observed for ZO-1 (TJP1), where mRNA levels kept decreasing after cigarette aerosol extract washout (p < .01). However, the decrease in the transcriptional levels of those genes upon e-cigarette aerosol extract exposure was not significant. Transcriptional levels of N-cadherin (CDH2) dropped by 52% in cigarette aerosol extract-exposed MSCs and did not recover after washout (p < .001). N-cadherin mRNA levels in e-cigarette aerosol extract-exposed cells were significantly reduced to 53% of control levels (p < .01), and recovered to 70% of control levels, even though the recovered mRNA levels were not significantly different from the levels observed in cells that did not undergo the e-cigarette aerosol extract washout.

Figure 2.

Exposure to cigarette and e-cigarette smoke aerosol extracts modulates the transcriptional expression of mesenchymal stem cell (MSC) membrane proteins. MSCs were exposed to smoke aerosol extract-containing media either for 2 weeks, replaced with smoke-free media for a 1-week washout period, or for 2 weeks continuously. Cells continuously unexposed to smoke-containing media were used as a control. Bar graphs represent normalized gene expression of results from qRT-PCR of Cx43, ZO-1, and N-cadherin. qRT-PCR of glyceraldehyde 3-phosphate dehydrogenase was performed for normalization. Bar graphs represent averages ± SD of three independent experiments run in duplicates. Cx43 = Connexin 43; NS = non-significant; ZO-1 = zonula occludens 1. ^*p < .05; ^**p < .01; ^***p < .001.

Furthermore, the expression and localization of membrane proteins in smoke aerosol extract-exposed MSCs (continuous exposure and after a 1-week washout) were evaluated by immunofluorescence (Figure 3). Overall, protein levels of Cx43 decreased in MSCs exposed to cigarette or to e-cigarette smoke aerosol extracts and lost their plaque-forming phenotype. ZO-1 did not seem to be downregulated in smoke aerosol extract-exposed cells, and both cigarette and e-cigarette aerosol extract-exposed MSCs had enhanced membrane localization of ZO-1. N-cadherin stained more intensely in control MSCs, compared to MSCs exposed to cigarette smoke aerosol extracts and, to a lesser extent, to MSCs exposed to e-cigarette smoke aerosol extracts. Washing out the smoke insult did not markedly change membrane protein expression levels or distribution on MSC membrane.

Figure 3.

Exposure to cigarette and e-cigarette smoke aerosol extracts disrupts membrane architecture in mesenchymal stem cells (MSCs). MSCs were exposed to smoke aerosol extract-containing media either for 2 weeks and then replaced with smoke-free media for a 1-week washout period or for 2 weeks continuously. Cells continuously unexposed to smoke-containing media were used as a control. Representative immunofluorescence micrographs showing the localization of membrane proteins. The green color indicates Alexa Fluor 488, the red color refers to Texas red fluorescence, and the blue color is the DAPI staining used to counterstain nuclei. Images were captured using the Zeiss LSM710 microscope (63x/1.46 oil plan-apochromatic objective) and represent at least 2 experiments. Cx43 = Connexin 43; DAPI = 4′,6-diamidino-2-phenylindole; ZO-1 = zonula occludens 1.

Collectively, these data show that Cx43 and N-cadherin expression is significantly impaired at the transcriptional and translational levels in MSCs exposed to cigarette and e-cigarette aerosol extracts, while ZO-1 levels are relatively preserved. Smoke washout did not markedly affect gene expression or localization of membrane proteins.

Cigarette and E-Cigarette Smoke Aerosol Extracts Compromise MSC Differentiation Potential

MSCs were exposed to smoke aerosol extracts and to DAG for induction of osteogenic differentiation. MSCs were exposed to DAG and cigarette or e-cigarette smoke aerosol extracts for two consecutive weeks or for 2 weeks followed by a washout period. During this washout period, cells were incubated with DAG alone for 2 weeks for ALP activity or 3 weeks for Alizarin Red S staining. Figure 4A shows that control MSCs (smoke-free), when exposed to DAG for 2 weeks, display a high ALP activity (visible as pink stain), which decreases to 10% upon simultaneous exposure to cigarette aerosol extracts (p < .0001) and to around 40% upon simultaneous exposure to e-cigarette aerosol extracts (p < .05). When smoke aerosol extracts are washed out after 2 weeks and MSCs are incubated in DAG-containing media for another 2 weeks, ALP activity levels increase by 5 folds in cells exposed to cigarette aerosol extracts (p < .0001) and by 2 folds in cells exposed to e-cigarette aerosol extracts (p < .001). However, the difference in ALP activity remains significantly lower in cigarette aerosol extract-exposed cells (around 50% of control) compared to e-cigarette aerosol extract-exposed cells (>90% of control, p < .001).

Figure 4.

Mesenchymal stem cells (MSCs) irreversibly lose their osteogenic differentiation potential when exposed to cigarette or e-cigarette aerosol extracts. MSCs were exposed simultaneously to DAG, for induction of osteogenic differentiation, and smoke aerosol extracts continuously for 2 weeks or for 2 weeks followed by a smoke washout period. MSCs treated with DAG only in smoke-free media were used as a control. (A) Micrographs of ALP-stained MSCs, 2 weeks into the recovery (washout) period. The bar graph displays ALP activity relative to control in arbitrary units, as quantified by the ImageJ tool. (B) Matrix mineralization of DAG-differentiated MSCs was evaluated by alizarin red S staining. Micrographs of alizarin red S-stained MSCs, 3 weeks into the recovery (washout) period. The bar graph displays alizarin red S stain relative to control in arbitrary units, as quantified by the ImageJ tool. Experiments were performed at least three times, and quantification was performed on several regions of interest on the micrographs. ^*p < .05; ^***p < .001; ^****p < .0001. NS = non-significant.

Figure 4B displays deposition of mineralized matrix, visible as orange-red patches, in control DAG-differentiated MSCs, 3 weeks after exposure to DAG. However, cells exposed to smoke aerosol extracts fail to continue the osteogenic differentiation process: cigarette aerosol extract-exposed cells achieved less than a 5% matrix deposition (p < .0001) compared to control cells, and e-cigarette aerosol extract-exposed cells no more than 20% matrix deposition (p < .001). After washout of the smoke aerosol extract-containing media and incubation in DAG-containing media, cells in neither experimental condition recover and pursue osteogenic differentiation and matrix mineralization.

Together, these data show that MSCs exposed to cigarette aerosol extracts do not respond to DAG signals and they fail to engage in osteogenic differentiation. On the other hand, MSCs exposed to e-cigarette aerosol extracts might engage in early differentiation into osteoblast-like cells (as shown by ALP-positive cells), but they do not progress into matrix-depositing cells.

Discussion

This study provides novel evidence that cigarette smoke aerosol extract-induced MSC damage tends to be irreversible, aligning with outcomes of a recent and extensive review.⁵⁵ In contrast, while E-cigarette aerosol extracts compromise the proliferative and osteogenic differentiation potential of human MSCs, partial functional recovery might be possible after cessation of exposure to smoke aerosol extracts. These findings extend previous reports on the toxicity of tobacco products on the regenerative potential of a critical player of tissue repair, MSCs.^{14,23-32,34,35,56-66}

Chronic smokers of combustible tobacco inevitably develop health problems, which motivated the innovation of electronic smoking devices, marketed as safer alternatives to conventional smoking. However, a growing body of evidence contests this fact, and the safety of e-cigarettes has repeatedly been challenged.^67-70 While smoking cessation is the best approach, switching from conventional smoking to e-cigarettes might hamper the acute effects of smoking on human health. Nevertheless, e-cigarettes are not harm-free substitutes to cigarettes, particularly among initially non-smokers.^1,5-11,71,72

Research studies have been instrumental in assessing, predicting, and explaining potential vaping risks to human health.^5-11 In fact, certain e-cigarette-associated hazards observed clinically are now mapped to cellular and molecular changes.^{12-15,33,73-75} Repair mechanisms and tissue regeneration are essential functions carried out by stem cells, including MSCs, to restore and maintain homeostasis tissues.^22,36-39 E-cigarette use attenuates body repair mechanisms, MSCs included, even though potentially to a lesser extent than cigarettes.^{14,23-32,34,35}

Furthermore, there is evidence that cigarette smoke-induced tissue damage is irreversible, whereas the evidence on the reversibility of e-cigarette-induced damage is a knowledge gap that has undergone limited investigation. Indeed, a significant gap exists in the research on the impact of quitting e-cigarette vaping on pulmonary disease progression, restoration of body repair systems, and stem/progenitor cells, except for one study that showed that e-cigarette-injured neural stem cells do not fully recover following the removal of the e-cigarette insult.²⁶

In this study, MSCs were evaluated for their ability to reverse damage induced by combustible cigarette or e-cigarette aerosol extracts. For experimental demonstration, after 2 weeks of continuous exposure to smoke aerosol extracts followed by a washout period, MSCs were evaluated for alterations in morphology, viability, membrane protein integrity, and ability to undergo osteogenic differentiation. Guided by our previous work,¹⁴ which has determined the proper cigarette and e-cigarette aerosol extract concentrations to use in the cell culture settings and showed transcriptional and translational changes, culminating in a compromised ability of MSCs to differentiate when exposed to smoke insult,¹⁴ this study investigated the effects of withdrawing the smoke insult on MSC viability and differentiation potential. Findings indicated that after washout, MSCs exposed to cigarette aerosol extracts do not recover their proliferative ability, but MSCs exposed to e-cigarette aerosol extracts seem to divide again. It has been proposed that necrotic cells (perhaps upon the cytotoxic effect of e-cigarette aerosol extracts) lose their membrane integrity and secrete pro-inflammatory cytokines, which amplify repair mechanisms and lead to proliferation.⁷⁶

This finding is in accordance with the study by El Mouelhy et al. (2022), who reported that gingival MSCs exposed to e-cigarettes maintain an ability to form viable colonies comparable to control cells.³³ Future studies may focus on mechanisms underpinning restoration of proliferation and on the compounds that are present in cigarette but not e-cigarette smoke aerosols, leading to impaired proliferative ability of MSCs, noting that stem cell populations seem to be more sensitive than differentiated cells to different brands and compositions of e-cigarettes.⁷⁷

E-cigarettes have been shown to affect bodily repair mechanisms, including MSCs, in vitro and in vivo^{14,23-32,34,35} through different mechanisms. We have previously reported reactive oxygen species accumulation in MSCs exposed to cigarette and e-cigarette aerosol extracts, potentially contributing to the loss of survival and proliferation potential.¹⁴ Long-term exposure of mice to e-cigarettes has resulted in the suppression of BM hematopoietic stem and progenitor cells.²⁴ The study by El-Mouelhy et al. has indeed reported milder effects of the e-cigarette on the survival and viability of gingival fibroblast/gingival MSCs, compared to conventional cigarettes or to cannabis-containing e-cigarettes.³³ It was also shown that neural stem cells exposed to e-cigarettes present stress-induced mitochondrial hyperfusion, accompanied by oxidative stress, autophagy, and premature cellular aging.²⁶ It was also reported that cytotoxicity of e-cigarettes in human periodontal ligament stem cells is linked to apoptosis mediated by the ROS/JNK/caspase 3 axis.⁷⁸ The mechanisms behind the reduced viability of MSCs exposed to e-cigarette aerosols or their recovery were not examined in the present study, necessitating future investigation. Uncovering these mechanisms may give insights about irreversible cigarette-induced loss of proliferative ability or the compounds responsible for this effect.

Furthermore, findings from the current study indicated that transcriptional levels of membrane markers (gap junction-forming Cx43, N-cadherin, and, to a lesser extent, ZO-1) were also irreversibly decreased in cigarette-exposed MSCs, but they seem to recover to control levels after withdrawing of the e-cigarette exposure. However, Cx43, ZO-1, and N-cadherin protein levels and localization seem to be irreversibly changed both in cigarette and e-cigarette-exposed MSCs. Previous studies have implicated Cx43, the major connexin encountered in human MSCs, in osteogenic differentiation,^79,80 including an earlier study from our group associating smoke-induced loss of Cx43 expression and gap junction-mediated intercellular communication with failure of MSCs to engage in the early stages of osteogenesis.¹⁴ Here, we confirm this observation and show that even when Cx43 transcriptional levels are somewhat restored in MSCs after e-cigarette (but no cigarette) washout, osteogenic differentiation remains limited. A study showed that the cardiac differentiation of human embryonic stem cells exposed to cigarettes and e-cigarettes in vitro was impaired and accompanied by aberrant N-cadherin localization and increased proportion of immature cells, positive for smooth muscle alpha-actin.²³ While ZO-1 has been described in MSCs induced into epithelial differentiation,^81,82 ZO-1 function in undifferentiated MSCs or in MSCs induced into osteogenic (mesodermal) differentiation warrants further investigation.

E-cigarettes have proven detrimental to bone health, and while other studies have used bone cell lines with limited use of human osteoblasts or osteoclasts,⁸³ we have evaluated the ability of primary human MSCs to transition into osteoblast-like cells, following the natural scenario of bone formation and repair, circumventing the shortcomings of exposing bone cells to smoke aerosols. The impaired MSC-to-osteoblast differentiation was also corroborated in a model of dental implants, where e-cigarette aerosols led to macrophage activation, an inflammatory state and failure of MSCs to express osteogenic markers.⁸⁴

Using this primary MSC model, we have functionally described MSC differentiation potential to evaluate the integrity of their repair and tissue regeneration potential. Cigarette-exposed MSCs fail to respond to osteogenic differentiation stimuli (DAG), confirming earlier findings¹⁴; even after withdrawing the smoke insult. E-cigarette-exposed MSCs also failed to undergo full osteogenic differentiation even after withdrawal of the smoke insult. Cigarette and e-cigarette exposure inhibited both the early (ALP activity) and later stages (deposition of mineralized matrix) of the MSC osteogenic differentiation process. However, following smoke aerosols washout, e-cigarette-exposed MSCs, but not cigarette-exposed MSCs, seem to still respond to DAG by upregulating their ALP activity; both cigarette- and e-cigarette-induced MSCs fail to deposit mineralized matrix. These results indicate that the early stages of the osteogenic differentiation process may be initiated in e-cigarette- but not cigarette-induced MSCs, opening new avenues for research of this differential behavior and identification of the cigarette-specific compounds that inhibit the late MSCs osteogenic differentiation steps.

Collectively, we show that both cigarette and e-cigarette aerosols irreversibly impair MSC survival and function. We also show that with the experimental setting employed, e-cigarettes might cause less pronounced molecular changes, but still result in irreversibly compromised MSC osteogenic differentiation potential. This can, at least partially, explain loss of repair mechanisms observed in chronic smokers, including smokers of e-cigarettes, even after cessation of the smoke insult.

Limitations

This study presents certain limitations. Firstly, the in vitro design of the study might not fully recapitulate the human or animal exposure and response to smoking. Secondly, the standard e-cigarette cartridges used are not representative of all e-cigarette liquids available, as a large variation is identified within brands and manufacturers, as recently reviewed.⁸⁵ Thirdly, we only describe the effects of the TPM in the aqueous aerosol extracts (in cell culture media), and some additional effects are expected from the fat-soluble components that may be absent in the media-soluble TPM. Fourthly, MSCs used in this study were isolated from excess BM aspirates of subjects free of BM pathologies, but other medical histories and smoking statuses are unknown.

Conclusions

This study provides evidence that e-cigarettes are not harmless substitutes to conventional smoking, and that, comparably to combustible cigarettes, they inflict damage to stem cell populations and their differentiation potential. This is of particular importance in the regenerative medicine context and to public health, where messaging and policy-making should reflect these biological risks and reinforce the importance of cessation of all forms of smoking.

Author Contributions

Abdullah Shaito (Conceptualization [equal], Data curation [supporting], Formal analysis [equal], Funding acquisition [supporting], Writing—original draft [equal]), Mira Abou Daher (Data curation [equal], Investigation [equal]), Nadine El Hajj (Data curation [equal]), Rawya Hijazi (Data curation [equal], Investigation [equal]), Fouad Al Feghaly (Data curation [equal], Investigation [equal]), Ahmad Husari (Funding acquisition [supporting], Methodology [equal], Writing—review & editing [equal]), Marwan El-Sabban (Conceptualization [equal], Investigation [equal], Supervision [equal], Writing—review & editing [equal]), and Jessica Saliba (Conceptualization [lead], Data curation [equal], Formal analysis [equal], Funding acquisition [lead], Methodology [lead], Project administration [equal], Supervision [equal], Writing—original draft [equal])

Funding

This study was supported by a grant from the University of Balamand, Lebanon (RGA/FHS/22-23/002 – Major contribution) and from Qatar University (QU collaborative grant QUCG-BRC-23/24-125). The study also received partial support from the Hamdi El Zaim Interstitial Lung Diseases Center at the American University of Beirut.

Declaration of Interests

None declared.

Data Availability

Data are available upon reasonable request from the corresponding author.