Skip to main content
PeerJ logoLink to PeerJ
. 2026 Apr 13;14:e21132. doi: 10.7717/peerj.21132

Genome-wide identification of WRKY gene family members in Populus trichocarpa and their response to biotic stresses

Yue Sun 1, Hanxi Li 2, Yao Chi 1, Yanlin Liu 1, Xinxin Zhang 1,, Xiyang Zhao 1,
Editor: Dagmara Żyła
PMCID: PMC13102011  PMID: 42028129

Abstract

Background

WRKY transcription factors (TFs) are key regulators of plant stress resistance. Despite their importance, the regulatory mechanisms of WRKYs in Populus trichocarpa under biotic stress remain insufficiently explored. This study presents a comprehensive bioinformatic characterization of the WRKY gene family in P. trichocarpa.

Methods

The most recent P. trichocarpa genome was employed to identify all WRKY genes in the species. Detailed analyses, including molecular characterization, phylogenetic relationships, gene structure, motif and promoter composition, chromosomal localization, and syntenic relationships, were conducted. Real-time quantitative polymerase chain reaction (RT-qPCR) was utilized to assess the expression profiles of PtWRKY genes under insect stress.

Results

A total of 139 WRKY genes were identified, unevenly distributed across 18 chromosomes and classified into three principal groups. Conserved motif analysis showed that all PtWRKY proteins contained motifs 1, 2, and 4, with members of the same subgroup exhibiting highly similar motif architectures. Collinearity analysis identified 91 homologous gene pairs within the PtWRKY family, suggesting potential functional redundancy. Examination of the 2,000 bp upstream promoter regions revealed diverse cis-acting elements associated with light responsiveness, phytohormone signaling, and stress regulation. Moreover, several PtWRKY genes responded to feeding stress caused by Hyphantria cunea.

Conclusion

Collectively, these findings elucidate the genomic organization and potential regulatory roles of the WRKY gene family in P. trichocarpa, highlighting their involvement in insect-induced defense and offering insights for future agricultural improvement strategies.

Keywords: Populus trichocarpa, WRKY gene family, Genome-wide identification, Hyphantria cunea

Introduction

Herbivorous insects are significant pests in agriculture and forestry, causing substantial economic and ecological losses. In response to herbivory, plants activate signaling pathways that trigger specific defense mechanisms critical for their survival. Extensive research has established transcription factors (TFs) as key regulators of gene expression, playing pivotal roles in plant defense against herbivores (Romani & Moreno, 2021; Jiang et al., 2017; Phukan, Jeena & Shukla, 2016). By binding to cis-regulatory elements in the promoter regions of target genes, TFs modulate gene expression and facilitate coordinated crosstalk among signal transduction pathways (Javed & Gao, 2023; Priest, Filichkin & Mockler, 2009; Shrestha, Khan & Dey, 2018), ultimately strengthening plant resistance to stress. Given their role as master regulators of defense-related genes, TFs present promising candidates for genetic engineering applications (Chen et al., 2017). Consequently, understanding the mechanistic actions of TFs is vital for advancing insect resistance research.

The WRKY TF was first identified in sweet potato (Ipomoea batatas) (Ishiguro & Nakamura, 1994). Subsequent systematic analysis of the WRKY gene family have been conducted in various plants, including Arabidopsis, rice, and maize (Dong, Chen & Chen, 2003; Ross, Liu & Shen, 2007; Hu et al., 2021). The WRKY family represents one of the largest groups of transcriptional regulators in plants (Mangelsen et al., 2008), characterized by the highly conserved WRKY domain. Each WRKY protein contains one or two conserved domains of approximately 60 amino acids, featuring a highly conserved WRKYGQK heptapeptide at the N-terminus and, in some cases, a zinc finger structure at the C-terminus, either C-X4–5-C-X22–23-HXH (C2H2) or C-X7-C-X23-HXC (C2HC) (Rushton et al., 2010). The WRKY domain exhibits a strong affinity for the conserved W-box (C/TTGACT/C) binding site, which is also present in multiple defense-related genes, highlighting its critical biological functions (Ulker & Somssich, 2004; Yamasaki et al., 2012). As versatile regulators, WRKY genes are involved in nearly all aspects of plant life, from growth and development to tolerance of various abiotic and biotic stresses (Wang et al., 2023). Overexpression of the PtoWRKY60 gene in poplar plants can significantly enhance their resistance to Dothiorella gregaria Sacc (Ye et al., 2014). However, this also leads to adverse phenotypes such as slowed growth, premature leaf senescence and shedding. Several studies have highlighted the role of WRKY genes in herbivore-induced plant defense. For instance, silencing the SlWRKY70 gene in tomato (Lycopersicon esculentum) inhibited the Mi-1 gene-mediated anti-aphid pathway, increasing the susceptibility of mutant plants to aphids (Atamian, Eulgem & Kaloshian, 2012). Overexpression of the OsWRKY89 gene enhanced rice resistance to the white-backed planthopper (Wang et al., 2007). However, despite these advancements, research on the defense mechanisms of PtWRKY genes targeting herbivorous insects remains limited, revealing a significant gap in current knowledge.

Populus trichocarpa serves as a model species for woody plants, with its genome sequence widely utilized in genetic studies since its sequencing and publication in 2006 (Tuskan et al., 2006). It is a key model plant for research on stress resistance in Populus due to its rapid growth, well-defined genetic background, and ease of genetic transformation (Liu et al., 2022; Xu et al., 2021). Although the WRKY gene family in P. trichocarpa has been previously analyzed, with subgroup III gene expression patterns studied under cold, drought, salinity, and salicylic acid stresses (He et al., 2012), a comprehensive analysis of PtWRKY genes under insect stress remains unexplored. In this study, the most recent P. trichocarpa genome was employed to identify all WRKY genes in the species. Detailed analyses, including molecular characterization, phylogenetic relationships, gene structure, motif and promoter composition, chromosomal localization, and syntenic relationships, were conducted. Real-time quantitative polymerase chain reaction (RT-qPCR) was utilized to assess the expression profiles of PtWRKY genes under insect stress. This research enhances the functional characterization (physicochemical properties, domains, evolutionary relationships, regulatory elements, and expression patterns under insect stress conditions). of PtWRKY genes and identifies key candidate genes for improving poplar resistance to pest stress.

Materials and Methods

Plant and insect materials and stress treatment

Three 2-month-old P. trichocarpa seedlings with consistent growth were selected for the experiment. The plants were randomly assigned to either a control or a treatment group. For each group, three independent plants were established as biological replicates. From the same node position (the 3rd–5th nodes) of each plant, three healthy and uniformly growing leaves were selected. Hyphantria cunea were provided by the Chinese Academy of Forestry Sciences, were incubated in an artificial climate chamber (L:D = 14:10; temperature 25 ± 1 °C; humidity 70 ± 5%) until the second instar. Prior to treatment, H. cunea larvae were subjected to a starvation protocol, with nine larvae starved for 12 h and placed evenly on the leaves. P. trichocarpa samples were collected 12 h after treatment. To ensure independence across time points, each sampling event used entirely new plants. All experiments were performed in triplicate, and the collected samples were immediately frozen in liquid nitrogen and stored at −80 °C for total RNA extraction. The samples collected at 0 h post-treatment served as the control group.

Identification of PtWRKY genes

Genomic sequences, coding sequences, and protein sequences of P. trichocarpa were retrieved from the National Center for Biotechnology Information (GCF_000002775.5) database (https://www.ncbi.nlm.nih.gov). The 71 WRKY protein sequences from A. thaliana were downloaded from the TAIR (GCF_000001735.4) website (https://www.arabidopsis.org) as reference sequences. Using the WRKY protein sequence from A. thaliana as a query, the BLAST program was employed to compare sequences in the P. trichocarpa genome. Duplicates were merged and removed to obtain the candidate WRKY TF protein sequences of P. trichocarpa. Further identification of PtWRKY genes was carried out using the NCBI CD-search tool (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi) for protein domain analysis, ultimately leading to the identification of all WRKY genes in P. trichocarpa. Basic protein properties, including amino acid length, molecular weight (MW), theoretical isoelectric point (pI), instability index, aliphatic index, and grand average of hydropathicity (GRAVY), were predicted using the ExPASy ProtParam tool (https://web.expasy.org/protparam/). The subcellular localization of PtWRKY proteins was predicted using Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) (Chou & Shen, 2010).

Construction of phylogenetic tree

Phylogenetic trees were constructed using the neighbor joining (NJ) method in MEGA11.0 software with a bootstrap value set to 1,000 (Kumar, Stecher & Tamura, 2016). The evolutionary tree was visualized using the iTOL online tool (http://iTOL.embl.de) (Letunic & Bork, 2019).

Visualization of gene structure and conserved motif of WRKY

Conservative motif analysis of the P. trichocarpa WRKY family protein sequences was conducted using the MEME tool (https://meme-suite.org/meme/tools/meme) (Tang et al., 2008), setting the number of motifs to eight. Based on the P. trichocarpa genome GFF3 annotation file, the gene structure of PtWRKY genes was analyzed and visualized using TBtools software.

Collinearity and chromosomal mapping of WRKY

The DNA sequences of the entire WRKY gene family in P. trichocarpa were mapped across the genome. The distribution of these genes on chromosomes and scaffolds was analyzed using TBtools software. Genome data for A. thaliana, Salix purpurea, and Oryza sativa were downloaded from the Ensembl website, organized, and covariance analysis across species was performed and visualized using TBtools software (Chen et al., 2020).

Predicted co-expression and interaction network

For protein interaction networks, homologous WRKY proteins in Arabidopsis were identified using STRING (https://string-db.org) with a threshold value >0.7. The homologous proteins of the identified interactive P. trichocarpa proteins were determined by reciprocal best BLASTP analysis. The network was then visualized and analyzed using Cytoscape version 3.7.0 (Shannon et al., 2003).

Analysis of cis-regulatory elements

The promoter sequences, extending 2,000 bp upstream of the start codon, were extracted from the P. trichocarpa genome file using TBtools software. Cis-acting elements within the PtWRKY gene promoters were identified using the online tool Plant Care (http://bioinformatics.psb.ugent.be/webtools/plantcare/html) (Lescot et al., 2002).

RNA isolation and RT-qPCR

Total RNA was extracted from P. trichocarpa leaf (the third to fifth healthy and fully expanded leaves) tissues using a plant RNA extraction kit (Tiangen, Beijing, China). The RNA was reverse-transcribed into cDNA using a reverse transcription kit (TaKaRa, Beijing, China). RT-qPCR primers for candidate genes were designed with Primer Premier (version 5.0) (Table 1). Gene expression levels were quantified using the CFX Opus 96 Real-Time PCR system (Bio-Rad, Singapore) and TB Green Premix EX Taq II FAST qPCR (TaKaRa, Beijing, China). The PCR conditions were: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, with melting curve conditions at 65 °C for 5 s and 95 °C for 5 s. The poplar actin gene served as the internal reference. The relative expression levels of each gene were calculated using the 2−∆∆Ct method. It includes three cases of biological replication and three cases of technical replicates.

Table 1. The primer sequence information for RT-PCR.

ID Gene name Forward primer sequence (F) Reverse primer sequence (R)
XM_002297947.4 PtWRKY2 TGAAGATCCCACCGTATTTGAG GTTGTGGAAGTTAAAGAGGGC
XM_002298817.4 PtWRKY3 TCATCCTAAACCACAACCCAG TTGGTTAGGCAGAGATGAAGAC
XM_002303816.4 PtWRKY16 AGTGGAATTGAACCGAGTGAG CTCTCAGAGTGCCCATTCAT
XM_002309030.4 PtWRKY26 TCGGGTTTGGAAGCAATAGG AGGCGGAGAACGGTTGAAGACAC
XM_002309150.4 PtWRKY27 GATCAATTTGTCTTGGACCCG GATTGGAAGGATGTGGTAAAGAATG
XM_002311293.4 PtWRKY30 CAGTTACCCCGAGAAAATCCTC GTACGATGTCCCCAAGCAG
XM_006369831.3 PtWRKY54 GTTCCAGCCACCCCTAATTC TCCTCTGGCTTTTCTGGTTG
XM_024583529.2 PtWRKY76 GATCCCTACACATTCGAGGTG AATTCCAGCCATCTAGCGAG
XM_024585451.2 PtWRKY80 TCAAGTACAATCACAGAACCCC TTCTTTCAACGAGACCTCCAC
XM_024601099.2 PtWRKY101 AGCGGATATAGTGGTGCAAC TGTGGGCTGTTCTTGACTG
XM_024604661.2 PtWRKY107 GCTCTGAAACGACAAGGAAATG TTTCCACTTGCCCATCCC
XM_024606501.2 PtWRKY112 CAGCTTCTATCTCTTCCTCTTCG GTCATGAAAGCAAATCTCGGC
Actin AATACCCCATTGAGCACGG ACTCACACCATCACCAGAATC

Results

Identification and physicochemical property analysis of PtWRKY genes

Conserved domains were identified using NCBI-CDD and Pfam, resulting in the identification of 139 PtWRKY genes. Based on their chromosomal arrangement, these genes were renamed PtWRKY1 through PtWRKY139 (Table 2). Physicochemical property analysis revealed that the length of WRKY proteins ranged from 157 amino acids (PtWRKY18) to 739 amino acids (PtWRKY81), with significant variation in the number of amino acids. The MW varied between 17,992.37 Da (PtWRKY18) and 79,601.83 Da (PtWRKY81). The pI ranged from 4.98 (PtWRKY129) to 9.86 (PtWRKY25). All PtWRKY genes were hydrophilic, with a mean hydrophilicity index ranging from −1.1 to −0.493. Predicted subcellular localization indicated that all 139 PtWRKY genes are located in the nucleus.

Table 2. Physical and chemical properties of PtWRKKY.

Name Gene ID Family WRKY area Number of amino acid Molecular weight/Da Theoretical pI Subcellular location
PtWRKY1 rna-XM_002297587.4 Group II-d WRKYGQK 314 35,189.87 9.45 Nucleus
PtWRKY2 rna-XM_002297947.4 Group III WRKYGQK 338 37966.72 5.79 Nucleus
PtWRKY3 rna-XM_002298817.4 Group I WRKYGQK 557 60,421.64 6.53 Nucleus
PtWRKY4 rna-XM_002300084.4 Group II-c WRKYGQK 186 21,227.88 9.44 Nucleus
PtWRKY5 rna-XM_002300560.4 Group I WRKYGQK 731 78,739.83 6.16 Nucleus
PtWRKY6 rna-XM_002301130.4 Group II-d WRKYGQK 358 39,612.68 9.51 Nucleus
PtWRKY7 rna-XM_002301201.4 Group II-c WRKYGQK 203 23,424.71 7.64 Nucleus
PtWRKY8 rna-XM_002301341.4 Group II-c WRKYGQK 193 21,894.03 9.06 Nucleus
PtWRKY9 rna-XM_002301478.4 Group II-d WRKYGQK 245 27,692.54 5.71 Nucleus
PtWRKY10 rna-XM_002301488.4 Group II-c WRKYGQK 317 35,402.53 6.67 Nucleus
PtWRKY11 rna-XM_002302034.4 Group II-d WRKYGQK 351 38,916.09 9.74 Nucleus
PtWRKY12 rna-XM_002302104.4 Group II-c WRKYGQK 325 36,596.37 7.65 Nucleus
PtWRKY13 rna-XM_002302584.4 Group III WRKYGQK 363 40,939.24 5.82 Nucleus
PtWRKY14 rna-XM_002302772.4 Group II-b WRKYGQK 506 54,489.39 7.56 Nucleus
PtWRKY15 rna-XM_002303574.4 Group II-e WRKYGQK 330 37,033.59 5.49 Nucleus
PtWRKY16 rna-XM_002303816.4 Group II-a WRKYGQK 319 35,674.03 8.49 Nucleus
PtWRKY17 rna-XM_002304513.4 Group III WRKYGQK 342 38,391.23 5.25 Nucleus
PtWRKY18 rna-XM_002304705.4 Group II-c WRKYGQK 157 17,992.37 9.58 Nucleus
PtWRKY19 rna-XM_002305235.4 Group II-e WRKYGQK 432 47,090.98 5.08 Nucleus
PtWRKY20 rna-XM_002305694.4 Group II-d WRKYGQK 262 29,293.51 5.56 Nucleus
PtWRKY21 rna-XM_002306707.4 Group II-c WRKYGQK 322 36,311.07 7.19 Nucleus
PtWRKY22 rna-XM_002306787.4 Group II-d WRKYGQK 347 38,556.76 9.64 Nucleus
PtWRKY23 rna-XM_002308502.3 Group II-c WRKYGQK 165 18,800.72 5.48 Nucleus
PtWRKY24 rna-XM_002308668.3 Group II-a WRKYGQK 320 35,415.62 8.27 Nucleus
PtWRKY25 rna-XM_002308962.4 Group II-d WRKYGQK 301 32,898.03 9.86 Nucleus
PtWRKY26 rna-XM_002309030.4 Group II-a WRKYGQK 304 34,029.43 5.52 Nucleus
PtWRKY27 rna-XM_002309150.4 Group III WRKYGQK 333 37,705.54 6.04 Nucleus
PtWRKY28 rna-XM_002310008.4 Group II-c WRKYGKK 233 26,378.91 9.32 Nucleus
PtWRKY29 rna-XM_002310086.4 Group II-d WRKYGQK 335 36,803.7 9.65 Nucleus
PtWRKY30 rna-XM_002311293.4 Group II-c WRKYGQK 293 32,254.6 5.85 Nucleus
PtWRKY31 rna-XM_002312231.4 Group I WRKYGQK 492 54,144 8.7 Nucleus
PtWRKY32 rna-XM_002312282.4 Group II-c WRKYGQK 368 40,893.57 7.06 Nucleus
PtWRKY33 rna-XM_002314926.4 Group II-c WRKYGQK 374 41,381.84 6.2 Nucleus
PtWRKY34 rna-XM_002314988.4 Group I WRKYGQK 499 54,536.98 8.57 Nucleus
PtWRKY35 rna-XM_002317361.4 Group II-d WRKYGQK 268 30,051.11 5.78 Nucleus
PtWRKY36 rna-XM_002318337.4 Group III WRKYGQK 371 41,419.78 5.56 Nucleus
PtWRKY37 rna-XM_002318711.4 Group II-c WRKYGQK 186 21,494.98 8.9 Nucleus
PtWRKY38 rna-XM_002319046.4 Group II-d WRKYGQK 354 40,094.08 9.79 Nucleus
PtWRKY39 rna-XM_002319843.4 Group III WRKYGQK 324 36,719.84 5.38 Nucleus
PtWRKY40 rna-XM_002319923.4 Group I WRKYGQK 591 64,943.87 7.2 Nucleus
PtWRKY41 rna-XM_002320124.4 Group II-c WRKYGQK 189 21,456.47 9.22 Nucleus
PtWRKY42 rna-XM_002320816.4 Group III WRKYGQK 365 41,209.55 5.1 Nucleus
PtWRKY43 rna-XM_002320931.4 Group II-c WRKYGQK 319 35,894.11 7.06 Nucleus
PtWRKY44 rna-XM_002322238.4 Group II-c WRKYGQK 178 20,390.76 9.42 Nucleus
PtWRKY45 rna-XM_002323601.4 Group I WRKYGQK 579 63,971.87 6.2 Nucleus
PtWRKY46 rna-XM_002323803.4 Group II-b WRKYGQK 538 58,374.23 6.26 Nucleus
PtWRKY47 rna-XM_002324292.4 Group II-a WRKYGQK 271 30,475.4 7.59 Nucleus
PtWRKY48 rna-XM_002324346.4 Group II-d WRKYGQK 338 36,823.47 9.45 Nucleus
PtWRKY49 rna-XM_002325212.4 Group II-d WRKYGQK 300 33,025.26 9.81 Nucleus
PtWRKY50 rna-XM_002326057.4 Group I WRKYGQK 603 66,358.41 6.69 Nucleus
PtWRKY51 rna-XM_006368449.3 Group II-a WRKYGQK 318 35,131.43 8.85 Nucleus
PtWRKY52 rna-XM_006368706.3 Group II-e WRKYGQK 325 36,713.96 5.69 Nucleus
PtWRKY53 rna-XM_006368806.3 Group II-c WRKYGQK 160 18,342.73 9.58 Nucleus
PtWRKY54 rna-XM_006369831.3 Group II-c WRKYGQK 312 34,893.44 6.31 Nucleus
PtWRKY55 rna-XM_006371700.3 Group II-a WRKYGQK 320 35,569.97 9.03 Nucleus
PtWRKY56 rna-XM_006372308.3 Group II-e WRKYGQK 412 45,622.66 5.65 Nucleus
PtWRKY57 rna-XM_006373154.3 Group II-c WRKYGQK 186 21,250.89 9.61 Nucleus
PtWRKY58 rna-XM_006375106.3 Group II-c WRKYGQK 228 26,409.89 6.26 Nucleus
PtWRKY59 rna-XM_006375289.3 Group II-e WRKYGQK 349 38,367.88 6.16 Nucleus
PtWRKY60 rna-XM_006375493.3 Group I WRKYGQK 485 53,397.61 5.98 Nucleus
PtWRKY61 rna-XM_006375494.3 Group I WRKYGQK 485 53,397.61 5.98 Nucleus
PtWRKY62 rna-XM_006377952.3 Group I WRKYGQK 725 78,446.32 5.83 Nucleus
PtWRKY63 rna-XM_006380631.3 Group II-d WRKYGQK 334 36,716.62 9.65 Nucleus
PtWRKY64 rna-XM_006381457.3 Group I WRKYGQK 475 51,973.49 9.12 Nucleus
PtWRKY65 rna-XM_006382750.3 Group II-d WRKYGQK 353 39,696.51 9.69 Nucleus
PtWRKY66 rna-XM_006383468.3 Group II-d WRKYGQK 331 36,663.4 9.38 Nucleus
PtWRKY67 rna-XM_006386554.3 Group II-e WRKYGQK 354 38,846.56 6.15 Nucleus
PtWRKY68 rna-XM_006389516.2 Group II-b WRKYGQK 590 64,185.08 6.61 Nucleus
PtWRKY69 rna-XM_024581109.2 Group II-c WRKYGQK 306 34,030.86 8.16 Nucleus
PtWRKY70 rna-XM_024581374.2 Group I WRKYGQK 725 78,446.32 5.83 Nucleus
PtWRKY71 rna-XM_024581375.2 Group I WRKYGQK 725 78,446.32 5.83 Nucleus
PtWRKY72 rna-XM_024581376.2 Group I WRKYGQK 708 76,572.32 5.92 Nucleus
PtWRKY73 rna-XM_024581601.2 Group I WRKYGQK 560 60,801.21 6.97 Nucleus
PtWRKY74 rna-XM_024581602.2 Group I WRKYGQK 507 55,043.94 6.94 Nucleus
PtWRKY75 rna-XM_024583061.2 Group I WRKYGQK 716 78,369.07 6.62 Nucleus
PtWRKY76 rna-XM_024583529.2 Group III WRKYGQK 364 40,549.27 6.09 Nucleus
PtWRKY77 rna-XM_024584301.2 Group II-b WRKYGQK 502 54,065.41 6.9 Nucleus
PtWRKY78 rna-XM_024584519.2 Group I WRKYGQK 485 53,397.61 5.98 Nucleus
PtWRKY79 rna-XM_024585445.2 Group I WRKYGQK 739 79,601.83 6.16 Nucleus
PtWRKY80 rna-XM_024585451.2 Group I WRKYGQK 739 79,601.83 6.16 Nucleus
PtWRKY81 rna-XM_024585457.2 Group I WRKYGQK 739 79,601.83 6.16 Nucleus
PtWRKY82 rna-XM_024585466.2 Group I WRKYGQK 732 78,906 6.23 Nucleus
PtWRKY83 rna-XM_024585549.2 Group II-d WRKYGQK 361 39,868.07 9.36 Nucleus
PtWRKY84 rna-XM_024585550.2 Group II-d WRKYGQK 360 39,780.99 9.36 Nucleus
PtWRKY85 rna-XM_024587515.2 Group I WRKYGQK 469 51,535.26 9.34 Nucleus
PtWRKY86 rna-XM_024587516.2 Group I WRKYGQK 469 51,535.26 9.34 Nucleus
PtWRKY87 rna-XM_024587806.2 Group I WRKYGQK 556 60,364.59 6.53 Nucleus
PtWRKY88 rna-XM_024588647.2 Group I WRKYGQK 532 58,247.79 7.75 Nucleus
PtWRKY89 rna-XM_024590285.2 Group I WRKYGQK 527 57,897.46 5.69 Nucleus
PtWRKY90 rna-XM_024590287.2 Group I WRKYGQK 523 57,483.05 5.82 Nucleus
PtWRKY91 rna-XM_024590516.2 Group II-c WRKYGQK 511 56,542.75 9.13 Nucleus
PtWRKY92 rna-XM_024590518.2 Group II-c WRKYGQK 422 46,295.02 9.26 Nucleus
PtWRKY93 rna-XM_024594046.2 Group II-d WRKYGQK 357 39,525.6 9.51 Nucleus
PtWRKY94 rna-XM_024594979.2 Group II-c WRKYGQK 261 29,161.58 9.18 Nucleus
PtWRKY95 rna-XM_024596020.2 Group II-d WRKYGQK 245 27,692.54 5.71 Nucleus
PtWRKY96 rna-XM_024596958.2 Group II-d WRKYGQK 304 34,405.91 9.47 Nucleus
PtWRKY97 rna-XM_024598510.2 Group I WRKYGQK 543 59,495.25 7.27 Nucleus
PtWRKY98 rna-XM_024598865.2 Group II-d WRKYGQK 223 25,044.07 6.08 Nucleus
PtWRKY99 rna-XM_024600078.2 Group II-b WRKYGQK 602 65,078.08 6.29 Nucleus
PtWRKY100 rna-XM_024600511.2 Group II-d WRKYGQK 332 36,750.48 9.38 Nucleus
PtWRKY101 rna-XM_024601099.2 Group II-c WRKYGKK 206 22,873.15 6.06 Nucleus
PtWRKY102 rna-XM_024602206.2 Group II-d WRKYGQK 347 38,556.76 9.64 Nucleus
PtWRKY103 rna-XM_024602795.2 Group II-e WRKYGQK 448 48,448.32 5.63 Nucleus
PtWRKY104 rna-XM_024602932.2 Group I WRKYGQK 546 60,333.25 8.9 Nucleus
PtWRKY105 rna-XM_024603986.2 Group I WRKYGQK 475 51,973.49 9.12 Nucleus
PtWRKY106 rna-XM_024603990.2 Group I WRKYGQK 475 51,973.49 9.12 Nucleus
PtWRKY107 rna-XM_024604661.2 Group I WRKYGQK 522 56,833.44 6.32 Nucleus
PtWRKY108 rna-XM_024604662.2 Group I WRKYGQK 518 56,419.02 6.57 Nucleus
PtWRKY109 rna-XM_024605234.2 Group II-c WRKYGKK 192 21,887.15 7.63 Nucleus
PtWRKY110 rna-XM_024606155.2 Group II-c WRKYGQK 293 32,254.6 5.85 Nucleus
PtWRKY111 rna-XM_024606156.2 Group II-c WRKYGQK 293 32,254.6 5.85 Nucleus
PtWRKY112 rna-XM_024606501.2 Group II-c WRKYGQK 318 35,270.42 7.01 Nucleus
PtWRKY113 rna-XM_024609281.2 Group II-d WRKYGQK 313 35,033.68 9.39 Nucleus
PtWRKY114 rna-XM_024610899.2 Group II-b WRKYGQK 523 57,025.65 6.09 Nucleus
PtWRKY115 rna-XM_024611133.2 Group II-c WRKYGQK 293 32,595.97 6.4 Nucleus
PtWRKY116 rna-XM_024611531.2 Group II-b WRKYGQK 593 64,574.49 6.61 Nucleus
PtWRKY117 rna-XM_024611532.2 Group II-b WRKYGQK 592 64,446.32 6.48 Nucleus
PtWRKY118 rna-XM_024611533.1 Group II-b WRKYGQK 589 64,056.91 6.48 Nucleus
PtWRKY119 rna-XM_052445140.1 Group II-e WRKYGQK 461 49,731.65 5.71 Nucleus
PtWRKY120 rna-XM_052445501.1 Group I WRKYGQK 541 59,246.01 7.95 Nucleus
PtWRKY121 rna-XM_052445816.1 Group II-c WRKYGQK 185 21,338.79 8.68 Nucleus
PtWRKY122 rna-XM_052446276.1 Group III WRKYGQK 324 36,719.84 5.38 Nucleus
PtWRKY123 rna-XM_052447277.1 Group II-d WRKYGQK 262 29,899.11 5.26 Nucleus
PtWRKY124 rna-XM_052447278.1 Group II-d WRKYGQK 235 26,838.72 5.07 Nucleus
PtWRKY125 rna-XM_052447365.1 Group II-b WRKYGQK 636 68,314.18 6.49 Nucleus
PtWRKY126 rna-XM_052449326.1 Group III WRKYGQK 381 41,276.09 6.1 Nucleus
PtWRKY127 rna-XM_052450880.1 Group II-d WRKYGQK 245 27,917.09 5.96 Nucleus
PtWRKY128 rna-XM_052450881.1 Group II-d WRKYGQK 245 27,917.09 5.96 Nucleus
PtWRKY129 rna-XM_052450883.1 Group II-d 209 23,823.39 4.98 Nucleus
PtWRKY130 rna-XM_052452687.1 Group II-c WRKYGQK 232 26,308.64 9.08 Nucleus
PtWRKY131 rna-XM_052452688.1 Group II-c WRKYGQK 232 26,308.64 9.08 Nucleus
PtWRKY132 rna-XM_052453559.1 Group I WRKYGQK 475 51,973.49 9.12 Nucleus
PtWRKY133 rna-XM_052453560.1 Group I WRKYGQK 475 51,973.49 9.12 Nucleus
PtWRKY134 rna-XM_052453561.1 Group I WRKYGQK 475 51,973.49 9.12 Nucleus
PtWRKY135 rna-XM_052453562.1 Group I WRKYGQK 475 51,973.49 9.12 Nucleus
PtWRKY136 rna-XM_052454988.1 Group I WRKYGQK 731 78,739.83 6.16 Nucleus
PtWRKY137 rna-XM_052455199.1 Group II-c WRKYGQK 293 32,254.6 5.85 Nucleus
PtWRKY138 rna-XM_052455200.1 Group II-c WRKYGQK 293 32,254.6 5.85 Nucleus
PtWRKY139 rna-XM_052456799.1 Group II-c WRKYGQK 293 32,595.97 6.4 Nucleus

Phylogenetic analysis and multiple sequence alignment of PtWRKY genes

Phylogenetic analysis was conducted using the 139 WRKY protein sequences from P. trichocarpa and 71 known WRKY protein sequences from A. thaliana. The analysis revealed that the 139 P. trichocarpa WRKY TFs could be classified into three major groups (Fig. 1). Group I contained 40 WRKY proteins, group II contained 88 WRKY proteins, and group III contained 10 WRKY proteins. Group II was further subdivided into five subclasses: IIa (six members), IIb (10 members), IIc (36 members), IId (28 members), and IIe (eight members). Based on evolutionary relationships, the WRKY family in higher plants can be divided into three subclasses: IIa + IIb, IIc, and IId + IIe, consistent with the phylogenetic tree results. Multiple sequence alignment (Table 2) showed that 135 of the 139 PtWRKY proteins contained the signature WRKYGQK conserved domain. Four proteins deviated: PtWRKY129 (subgroup IIc) lacked the WRKY domain, while PtWRKY28, PtWRKY101, and PtWRKY109 exhibited mutations in the conserved domain, replacing WRKYGQK with WRKYGKK.

Figure 1. Phylogenetic tree of WRKY proteins.

Figure 1

Conserved motif and exon–intron structure analyses of PtWRKY genes

To investigate the structural diversity of the PtWRKY genes, a rootless evolutionary tree was constructed to analyze conserved motifs and gene structures (Fig. 2). Gene structure analysis revealed that all PtWRKY genes contain introns, with the number of exons ranging from two (PtWRKY26, PtWRKY18, PtWRKY53, PtWRKY57, PtWRKY4, PtWRKY44, PtWRKY8, PtWRKY37, PtWRKY121, PtWRKY41) to six (PtWRKY73, PtWRKY3, PtWRKY87, PtWRKY68, PtWRKY119, PtWRKY118, PtWRKY117, PtWRKY99, PtWRKY14, PtWRKY77, PtWRKY125). The number of introns varied between one and five in the PtWRKY genes. Notably, most PtWRKY genes within the same group exhibited similar exon-intron structures (Figs. 2B and 2C).

Figure 2. PtWRKY conserved motifs and gene structure.

Figure 2

To further explore the structural features and conduct optimal functional analyses of PtWRKY proteins, conserved motifs in the 139 PtWRKY proteins were examined using the MEME online software. This analysis identified eight highly correlated conserved motifs (Fig. 3). The frequency with which each motif occurred within WRKY proteins indicates its significance in the sequence. Notably, motifs 1 and 3 correspond to the conserved WRKYGQK heptapeptide segment. All PtWRKY proteins in the family possess motifs 1, 2, and 4, which represent the core conserved domains of the PtWRKY genes. These motifs play a critical role in maintaining the fundamental characteristics and functional integrity of the gene family.

Figure 3. Conserved motifs of the PtWRKY protein.

Figure 3

Collinearity analysis of WRKY gene family members in P. trichocarpa

During evolution, segmental duplication, whole-genome duplication (WGD), and tandem duplications have played key roles in gene family expansion in plants. In the case of PtWRKY genes, intra-species collinearity analysis revealed fourteen pairs of tandem duplication events, primarily located on chromosomes Chr01, Chr02, Chr06, Chr11, Chr13, Chr14, and Chr18. Evolutionary analysis of the 139 PtWRKY genes identified 91 genes originating from WGD events (Fig. 4), suggesting that WGD was the major contributor to the expansion of the WRKY gene family in Populus.

Figure 4. Distribution of WRKY genes.

Figure 4

To further investigate the phylogenetic relationship of WRKY genes between P. trichocarpa and three other species, interspecific collinearity analysis was performed (Fig. 5). The numbers of orthologous WRKY pairs between P. trichocarpa and S. purpurea, A. thaliana, and O. sativa were 235, 123, and 75, respectively. These results indicate stronger collinearity between P. trichocarpa and S. purpurea, followed by A. thaliana, and finally O. sativa.

Figure 5. Synteny analysis of WRKY genes between P. trichocarpa and three representative plant species.

Figure 5

Chromosome mapping of PtWRKY genes

Using TBtools software, the PtWRKY genes were mapped to P. trichocarpa chromosomes (Fig. 6). The results revealed that these genes are distributed across 18 chromosomes (excluding Chr09), though the distribution and density across chromosomes are uneven. Specifically, the highest number of genes (18) is located on Chr01, while the lowest (only two genes) is found on Chr19. These results confirm the uneven distribution and density of PtWRKY genes across the chromosomes, despite their presence on 18 chromosomes.

Figure 6. Chromosomal location of the WRKY gene family in P. trichocarpa.

Figure 6

Prediction of co-regulatory and interaction networks of PtWRKYs

WRKY TFs represent one of the largest families of transcriptional regulators in plants, integral to signaling networks that modulate various plant processes. To explore the potential regulatory networks among PtWRKY genes, co-expression patterns for the 139 PtWRKY proteins were predicted using the STRING protein-protein interaction database, revealing that 32 genes are involved in interactions (Fig. 7). Notably, PtWRKY55 and PtWRKY122 occupy central positions in the network, displaying extensive connections with numerous other PtWRKY proteins. In contrast, peripheral nodes such as PtWRKY94, PtWRKY131, and PtWRKY129 exhibit relatively fewer connections. These results suggest that PtWRKY55 and PtWRKY122 likely play pivotal roles in regulating the PtWRKY protein network, potentially acting as hub regulators that mediate interactions among a wide range of WRKY family members to coordinate various plant biological processes.

Figure 7. Protein-protein interaction (PPI) network of important genes.

Figure 7

Cis-acting elements analysis of WRKY gene family members in P. trichocarpa

To further investigate the transcriptional regulation and potential functions of PtWRKY genes, PlantCARE was used to predict the cis-acting elements in their promoters. The analysis revealed that, in addition to promoter-related elements and WRKY binding site motifs, three types of cis-regulatory elements were highly concentrated in the PtWRKY gene promoters: light-responsive elements, plant hormone response elements, and environmental stress response-related elements (Fig. 8). Among these, the environmental stress-related elements included low-temperature (LTR), drought (MBS), defense and stress (Tc-rich repeats), and anaerobic induction (ARE) response elements. Light-responsive elements, such as Box4 and G-box, were the most abundant, with all 139 PtWRKY genes containing these motifs. Plant hormone response elements included methyl jasmonate-responsive elements (CGTCA-Motif and TGACG-Motif), abscisic acid-responsive elements (ABRE), auxin responsiveness (AuxRR-core), salicylic acid-responsive elements (TCA-element), and gibberellin-responsive elements (p-box and GARE-motif). These results suggest that the majority of cis-acting elements in PtWRKY genes are associated with stress responses. Analyzing these elements can provide valuable insights into how PtWRKY genes mediate stress responses, particularly under biotic stress conditions.

Figure 8. Cis-acting elements of the Pt WRKY gene family.

Figure 8

Expression analysis of PtWRKY genes under H. cunea feeding

Jasmonic acid (JA) and salicylic acid (SA) are key regulators of plant defense mechanisms against insect herbivores, while abscisic acid (ABA) also plays a role in responding to various stresses, including biotic stresses induced by insects. Based on the central roles of JA, SA, and ABA in plant defense against herbivorous insects, we analyzed the 2,000-bp promoter sequences of the 139 PtWRKY genes using PlantCARE. We specifically prioritized genes containing cis-acting elements responsive to all three hormones, as these genes are likely regulated by multi-hormonal signals and involved in the defense of P. trichocarpa against H. cunea. (Fig. 9). To explore the role of the WRKY gene family in plant defense against H. cunea, the expression of 12 PtWRKY genes was analyzed using RT-qPCR (Fig. 10). Differences between the H. cunea feeding treatment and the control group were assessed using Test statistics (t-values) (* 0.01< p < 0.05; **p < 0.01). Except for PtWRKY2, PtWRK3 and PtWRKY101, which exhibited significant differences, all the other genes showed extremely significant differences (Table 3). The results showed varied expression patterns, which may be attributed to their distinct regulatory functions or the complex interactions of TFs. After H. cunea feeding, the expression levels of PtWRKY2 and PtWRKY3 did not change significantly. In contrast, PtWRKY16 and PtWRKY76 were upregulated in response to insect feeding compared to the control (Fig. 10). The expression of other genes, including, PtWRKY26, PtWRKY80, PtWRKY107, and PtWRKY112, was significantly downregulated following insect feeding.

Figure 9. Plants of Populus trichocar, Hyphantria cunea larvae feeding leaves.

Figure 9

Figure 10. Relative expression levels of all WRKYs under H.cunea treatments.

Figure 10

Table 3. Test statistics.

Gene T-value p-value
PtWRKY2 3.826 0.019
PtWRKY3 4.011 0.016
PtWRKY16 6.61 0.003
PtWRKY26 30.575 0.000
PtWRKY27 5.846 0.004
PtWRKY30 9.420 0.002
PtWRKY54 5.597 0.005
PtWRKY76 −25.022 0.000
PtWRKY80 11.753 0.000
PtWRKY101 3.933 0.017
PtWRKY107 8.417 0.001
PtWRKY112 5.623 0.005

Discussion

WRKY TFs are critical regulators, forming one of the largest families of transcriptional regulators with broad involvement in biotic stress responses. P. trichocarpa possesses a notably higher number of WRKY family members compared to several other plant species, including A. thaliana (Dong, Chen & Chen, 2003), G. hirsutum (Dou et al., 2014), Nelumbo nucifera (Li et al., 2019), Prunus persica (Chen et al., 2016), and Ananas comosus (Xie et al., 2018). This variation is likely attributed to P. trichocarpa’s large genome size and the high frequency of repeat events. Using genome data, 139 PtWRKY genes were identified and subjected to comprehensive bioinformatics analysis. Evolutionary analysis classified the PtWRKY genes into three primary groups, with group II further divided into five subgroups (Fig. 1), consistent with classifications observed in other plant species (Huang et al., 2012; Liu et al., 2017; Yang et al., 2015).

Structural analysis revealed that the amino acid sequences of most PtWRKY genes contained the conserved heptapeptide sequence (WRKYGQK), although a few exhibited heptapeptide variants (WRKYGKK, WRAYGGK, and WKKHGEK). These mutations could potentially result in functional changes. In this study, the conserved motif WRKYGQK in the PtWRKY28, PtWRKY101, and PtWRKY109 proteins, belonging to group IIc, was altered to WRKYGKK. Notably, the tobacco (Nicotiana tabacum) NtWRKY12, which contains a WRKYGKK motif, recognizes a downstream binding sequence (TTTTCCAC) that deviates significantly from the W-box (van Verk et al., 2008). Similarly, GmWRKY6 and GmWRKY21 in soybean (Zhou et al., 2008), also containing the WRKYGKK motif, exhibit abnormal binding to the W-box. It is hypothesized that these PtWRKY heptapeptide variants of P. trichocarpa may impair the WRKY protein’s ability to bind to DNA, or potentially enable recognition of novel motifs, leading to the emergence of new functions.

The creation of introns is a significant event in genomic evolution, contributing to species adaptation over time (Zhou et al., 2008; Bong-Seok & Choi, 2015; Patthy, 1999). Gene structure plays a pivotal role in the evolution of multigene families (Penny et al., 2009; Gaba et al., 2023). The number of introns influences plant responses to different developmental stages and environmental stimuli (Ohta, 2013; Liu et al., 2023). In this study, gene structure analysis of PtWRKY genes was integrated with phylogenetic evolution results. Evolutionary studies often classify proteins based on gene structure and motif arrangement relationships (Wiegmann et al., 2019; Hwarari et al., 2023). In this context, motifs 1, 2, and 4, which contain the WRKY domain, are identified as essential components of PtWRKY proteins. Additionally, PtWRKY proteins were categorized based on gene structure and motif configurations. The PtWRKY genes varied in exon count, ranging from two to six exons, and the exon-intron arrangements were consistent within each subfamily. The conserved structural motifs in PtWRKY proteins within the same subgroup were largely identical, suggesting that these proteins are relatively conserved during evolution. However, differences in the conserved motifs between subgroups indicate functional differentiation of PtWRKY proteins in each group.

A significant number of PtWRKY genes were located in duplicated genomic regions, highlighting the importance of large-scale duplication events in the expansion of the PtWRKY gene family. Ninety-one collinearity PtWRKY gene pairs were identified in the P. trichocarpa genome, emphasizing the role of segmental duplication in the expansion of these genes. Evolutionary analysis also revealed substantial synteny between P. trichocarpa, A. thaliana, O. sativa, and S. purpurea, indicating a shared ancestry prior to the divergence of these lineages. Interspecies collinearity analysis further showed that more WRKY gene pairs are present in P. trichocarpa and S. purpurea, suggesting closer genetic similarities between these two tree species. Consequently, the PtWRKY gene family is more closely related to S. purpurea, followed by A. thaliana, while O. sativa is the most distantly related. These findings collectively suggest that the WRKY gene family has undergone varying degrees of expansion across different plant species, aiding their adaptation to diverse environments.

In response to stress, plants adapt to adverse environments through signal transduction and molecular regulation mechanisms. TFs play a critical role in signal transduction by activating or inhibiting the transcription of downstream genes, specifically binding to gene promoter regions, thus modulating the expression of related functional genes (Schwechheimer, Zourelidou & Bevan, 1998). WRKY proteins bind to W-box elements ((C/T)TGAC(T/C)) or other cis-acting elements in the promoter regions of target genes, subsequently regulating the expression of downstream genes (Sun et al., 2003). Analysis of the PtWRKY gene promoters revealed several cis-acting elements responsive to plant hormones and various stresses, including W-box (WRKY TF-binding element), ABRE, ARE (auxin response element), SARE, and MeJARE. These findings suggest that PtWRKY genes may encode key regulators in P. trichocarpa’s stress response mechanisms, mediated through plant hormone pathways.

WRKY proteins are essential in mitigating stress-induced damage and enhancing stress tolerance by activating defense-related genes via signal transduction pathways. These pathways involve key hormones such as ABA (Lim et al., 2022; Liu et al., 2015; Rushton et al., 2012), JA (Hou et al., 2019; Huang et al., 2022; Nguyen, Goossens & Lacchini, 2022), and SA (Cui et al., 2020; van Verk, Bol & Linthorst, 2011). To investigate whether PtWRKY genes are involved in P. trichocarpa defense against the insect herbivore H. cunea via these hormonal pathways, we analyzed the promoter regions of all 139 PtWRKY genes sing PlantCARE. The analysis revealed that a significant subset harbors cis-acting elements responsive to JA, SA, and ABA, providing basics that their expression may be modulated by these defense-related signals. In this study, the analysis of the promoter region of the PtWRKY genes revealed that a part of genes contained cis-acting elements responsive to JA, SA, and ABA. This is consistent with the established role of JA in anti-herbivore defense—where it can be upregulated by WRKY proteins, JA is upregulated by WRKY3 and WRKY6 in Nattemata during insect attacks (Skibbe et al., 2008). BpWRKY6 expression was induced by JA treatment, and the JA content of BpWRKY6-overexpressing birch was also greater than that of the control. Furthermore, Y1H, EMSA, LUC, and ChIP–qPCR results verified that BpWRKY6 can bind to the promoters of JA synthesis genes to promote their expression (Xie et al., 2025). With the documented interplay between SA (Lortzing et al., 2019), ABA (Dinh, Baldwin & Galis, 2013), and JA (Bruce & Pickett, 2007) in enhancing plant resistance.

In this study, the expression levels of 12 PtWRKY genes were analyzed following 12 h of exposure to H. cunea feeding. Notably, PtWRKY16and PtWRKY76 were upregulated in response to insect feeding, compared to the control. Other WRKY genes exhibited low expression after 12 h of exposure to H. cunea. This divergence in expression profiles occurred despite all candidate genes containing cis-elements for JA, SA, and/or ABA, suggesting they are subject to distinct hormonal regulation—where specific signals may dominate or be suppressed—during the early defense response. Several key candidate PtWRKY genes were identified in this study, which could have practical applications in enhancing insect resistance in P. trichocarpa in the field. Further experimentation involving transgenic plants that either silence or overexpress these candidate WRKY genes is necessary to directly identify the transcriptional targets of key WRKY genes. This will provide deeper insights into their roles in P. trichocarpa’s defense responses to H. cunea.

Conclusions

This study identified a total of 139 WRKY gene family members in P. trichocarpa. These genes were classified into five subgroups based on phylogenetic relationships and primarily contained conserved Motifs 1, 2, and 4. The cis-acting elements in the promoters of these WRKY genes were associated with hormone signaling (JA, SA, ABA, etc.), light response, and defense and stress responses. Collinearity analysis revealed a stronger WRKY gene collinearity between P. trichocarpa and S. purpurea, highlighting conserved WRKY evolution within the Salicaceae family. Following H. cunea feeding, PtWRKY16 and PtWRKY76 were upregulated, indicating their role in biotic stress. In summary, this study provides valuable insights into the functional characteristics of PtWRKY genes and contributes to the identification of key stress response genes involved in P. trichocarpa’s defense against H. cunea in this field.

Supplemental Information

Supplemental Information one. RT-PCR Data.
peerj-14-21132-s001.xlsx (11.6KB, xlsx)
DOI: 10.7717/peerj.21132/supp-1
Supplemental Information 2. MIQE checklist.
DOI: 10.7717/peerj.21132/supp-2

Acknowledgments

Our gratitude extends to the College of Forestry and Grassland at Jilin Agriculture University for providing the experimental sites and equipment.

Funding Statement

We received funding from the Technological Innovation 2030-Major Project of Agricultural Biological Breeding (2022ZD0401504). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Contributor Information

Xinxin Zhang, Email: zxx2023@163.com.

Xiyang Zhao, Email: xiyangz@jlau.edu.cn.

Additional Information and Declarations

Competing Interests

The authors declare that they have no competing interests.

Author Contributions

Yue Sun conceived and designed the experiments, performed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Hanxi Li analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Yao Chi analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Yanlin Liu analyzed the data, prepared figures and/or tables, and approved the final draft.

Xinxin Zhang conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Xiyang Zhao analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Data Availability

The following information was supplied regarding data availability:

The data is available in the Supplemental File and at NCBI: GCF_000002775.5.

References

  • Atamian, Eulgem & Kaloshian (2012).Atamian S, Eulgem T, Kaloshian I. SlWRKY70 is required for Mi-1-mediated resistance to aphids and nematodes in tomato. Planta. 2012;235(2):299–309. doi: 10.1007/s00425-011-1509-6. [DOI] [PubMed] [Google Scholar]
  • Bong-Seok & Choi (2015).Bong-Seok J, Choi SS. Introns: the functional benefits of introns in genomes. Genomics and Informatics. 2015;13(4):112–118. doi: 10.5808/gi.2015.13.4.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Bruce & Pickett (2007).Bruce TJ, Pickett JA. Plant defence signalling induced by biotic attacks. Current Opinion in Plant Biology. 2007;10(4):387–392. doi: 10.1016/j.pbi.2007.05.002. [DOI] [PubMed] [Google Scholar]
  • Chen et al. (2020).Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular Plant. 2020;13(8):1194–1202. doi: 10.1016/j.molp.2020.06.009. [DOI] [PubMed] [Google Scholar]
  • Chen et al. (2017).Chen F, Hu Y, Vannozzi A, Wu K, Cai H, Qin Y, Mullis A, Lin Z, Zhang L. The WRKY transcription factor family in model plants and crops. Critical Reviews in Plant Sciences. 2017;36(5–6):311–335. doi: 10.1080/07352689.2018.1441103. [DOI] [Google Scholar]
  • Chen et al. (2016).Chen M, Tan Q, Sun M, Li D, Fu X, Chen X, Xiao W, Li L, Gao D D. Genome-wide identification of WRKY family genes in peach and analysis of WRKY expression during bud dormancy. Molecular Genetics and Genomics. 2016;291(3):1319–1332. doi: 10.1007/s00438-016-1171-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Chou & Shen (2010).Chou KC, Shen HB. Plant-mPLoc: a top-down strategy to augment the power for predicting plant protein subcellular localization. PLOS ONE. 2010;5(6):11335. doi: 10.1371/journal.pone.0011335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Cui et al. (2020).Cui X, Zhao P, Liang W, Cheng Q, Mu B, Niu F, Yan J, Liu C, Xie H, Kav NNV, Deyholos MK, Jiang YQ, Yang B. A rapeseed WRKY transcription factor phosphorylated by CPK modulates cell death and leaf senescence by regulating the expression of ROS and SA-synthesis-related genes. Journal of Agricultural and Food Chemistry. 2020;68:7348–7359. doi: 10.1021/acs.jafc.0c02500. [DOI] [PubMed] [Google Scholar]
  • Dinh, Baldwin & Galis (2013).Dinh ST, Baldwin IT, Galis I. The HERBIVORE ELICITOR-REGULATED1 gene enhances abscisic acid levels and defenses against herbivores in Nicotiana attenuate plants. Plant Physiology. 2013;162(4):2106–2124. doi: 10.1104/pp.113.221150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Dong, Chen & Chen (2003).Dong J, Chen C, Chen Z. Expression profiles of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Molecular Biology. 2003;51(1):21–37. doi: 10.1023/a:1020780022549. [DOI] [PubMed] [Google Scholar]
  • Dou et al. (2014).Dou L, Zhang X, Pang C, Song M, Wei H, Fan S, Yu S. Genome-wide analysis of the WRKY gene family in cotton. Molecular Genetics and Genomics. 2014;289(6):1103–1121. doi: 10.1007/s00438-014-0872-y. [DOI] [PubMed] [Google Scholar]
  • Gaba et al. (2023).Gaba Y, Bhowal B, Pareek A, SinglaPareek SL. Genomic survey of Flavin monooxygenases in wild and cultivated rice provides insight into evolution and functional diversities. International Journal of Molecular Sciences. 2023;24(4):4190. doi: 10.3390/ijms24044190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • He et al. (2012).He HS, Dong Q, Shao YH, Jiang HY, Zhu SW, Cheng BJ, Xiang Y. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa. Plant Cell Reports. 2012;31(7):1199–1217. doi: 10.1007/s00299-012-1241-0. [DOI] [PubMed] [Google Scholar]
  • Hou et al. (2019).Hou Y, Wang Y, Tang L, Tong X, Wang L, Liu L, Huang S, Zhang J. SAPK10-mediated phosphorylation on WRKY72 releases its suppression on jasmonic acid biosynthesis and bacterial blight resistance. iScience. 2019;16:499–510. doi: 10.1016/j.isci.2019.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Hu et al. (2021).Hu W, Ren Q, Chen Y, Xu G, Qian Y. Genome-wide identification and analysis of WRKY gene family in maize provide insights into regulatory network in response to abiotic stresses. BMC Plant Biology. 2021;l21(1):427. doi: 10.1186/s12870-021-03206-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Huang et al. (2012).Huang S, Gao Y, Liu J, Peng X, Niu X, Fei Z, Cao S, Liu Y. Genome-wide analysis of WRKY transcription factors in Solanum lycopersicum. Molecular Genetics and Genomics. 2012;287(6):495–513. doi: 10.1007/s00438-012-0696-6. [DOI] [PubMed] [Google Scholar]
  • Huang et al. (2022).Huang H, Zhao W, Qiao H, Li C, Sun L, Yang R, Ma X, Ma J, Song S, Wang S. SlWRKY45 interacts with jasmonate-ZIM domain proteins to negatively regulate defense against the root-knot nematode Meloidogyne incognita in tomato. Horticulture Research. 2022;9:uhac197. doi: 10.1093/hr/uhac197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Hwarari et al. (2023).Hwarari D, Radani Y, Guan Y, Chen J, Liming Y. Systematic characterization of GATA transcription factors in Liriodendron chinense and functional validation in Abiotic stresses. Plants. 2023;12(12):2349. doi: 10.3390/plants12122349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Ishiguro & Nakamura (1994).Ishiguro S, Nakamura K. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5’upstream regions of genes coding for sporamin and β-amylase from sweet potato. Molecular and General Genetics MGG. 1994;244(6):563–571. doi: 10.1007/bf00282746. [DOI] [PubMed] [Google Scholar]
  • Javed & Gao (2023).Javed T, Gao SJ. WRKY transcription factors in plant defense. Trends in Genetics. 2023;39(10):787–801. doi: 10.1016/j.tig.2023.07.001. [DOI] [PubMed] [Google Scholar]
  • Jiang et al. (2017).Jiang J, Ma S, Ye N, Jiang M, Cao J, Zhang J. WRKY transcription factors in plant responses to stresses. Journal of Integrative Plant Biology. 2017;59(2):86–101. doi: 10.1111/jipb.12513. [DOI] [PubMed] [Google Scholar]
  • Kumar, Stecher & Tamura (2016).Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution. 2016;33(7):1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lescot et al. (2002).Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Research. 2002;30(1):325–327. doi: 10.1093/nar/30.1.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Letunic & Bork (2019).Letunic I, Bork P. Interactive Tree of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Research. 2019;47(W1):W256–W259. doi: 10.1093/nar/gkz239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li et al. (2019).Li J, Mutanda I, Wang K, Yang L, Wang J, Wang Y. Chloroplastic metabolic engineering coupled with isoprenoid pool enhancement for committed taxanes biosynthesis in Nicotiana benthamiana. Nature Communications. 2019;10(1):4850. doi: 10.1038/s41467-019-12879-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lim et al. (2022).Lim C, Kang K, Shim Y, Yoo SC, Paek NC. Inactivating transcription factor OsWRKY5 enhances drought tolerance through abscisic acid signaling pathways. Plant Physiology. 2022;188(4):1900–1916. doi: 10.1093/plphys/kiab492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Liu et al. (2022).Liu HZ, Gao JH, Sun JT, Li S, Zhang BF, Wang ZW, Zhou CG, Sulis DB, Wang JP, Chiang VL, Li W. Dimerization of PtrMYB074 and PtrWRKY19 mediates transcriptional activation of PtrbHLH186 for secondary xylem development in Populus trichocarpa. New Phytologist. 2022;234(3):918–933. doi: 10.1111/nph.18028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Liu et al. (2015).Liu S, Kracher B, Ziegler J, Birkenbihl RP, Somssich IE. Negative regulation of ABA signaling by WRKY33 is critical for Arabidopsis immunity towards Botrytis cinerea 2100. eLife. 2015;4:e07295. doi: 10.7554/elife.07295.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Liu et al. (2017).Liu QN, Liu Y, Xin ZZ, Zhang DZ, Ge BM, Yang RP, Wang ZF, Yang L, Tang BP, Zhou CL. Genome-wide identification and characterization of the WRKY gene family in potato (Solanum tuberosum) Biochemical Systematics and Ecology. 2017;71:212–218. doi: 10.1016/j.bse.2017.02.010. [DOI] [Google Scholar]
  • Liu et al. (2023).Liu L, Xu J, Chen J, Yang B, Yang C, Yang Y, Wang K, Zhuo R, Yao X. The LEA2 gene sub-family: characterization, evolution, and potential functions in Camellia oleifera seed development and stress response. Scientia Horticulturae. 2023;322:112392. doi: 10.1016/j.scienta.2023.112392. [DOI] [Google Scholar]
  • Lortzing et al. (2019).Lortzing V, Oberländer J, Lortzing T, Tohge T, Steppuhn A, Kunze R, Hilker M. Insect egg deposition renders plant defence against hatching larvae more effective in a salicylic acid-dependent manner. Plant, Cell & Environment. 2019;42(3):1019–1032. doi: 10.1111/pce.13447. [DOI] [PubMed] [Google Scholar]
  • Mangelsen et al. (2008).Mangelsen E, Kilian J, Berendzen KW, Kolukisaoglu UH, Harter K, Jansson C. Phylogenetic and comparative gene expression analysis of barley (Hordeum vulgare) WRKY ranscription factor family reveals putatively retained functions between monocots and dicots. BMC Genomics. 2008;9(1):194. doi: 10.1186/1471-2164-9-194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Nguyen, Goossens & Lacchini (2022).Nguyen TH, Goossens A, Lacchini E. Jasmonate: a hormone of primary importance for plant metabolism. Current Opinion in Plant Biology. 2022;67:102197. doi: 10.1016/j.pbi.2022.102197. [DOI] [PubMed] [Google Scholar]
  • Ohta (2013).Ohta T. Evolution and variation of multigene families. Berlin, Heidelberg: Springer; 2013. [Google Scholar]
  • Patthy (1999).Patthy L. Genome evolution and the evolution of exon-shuffling—a review. Gene. 1999;238(1):103–114. doi: 10.1016/s0378-1119(99)00228-0. [DOI] [PubMed] [Google Scholar]
  • Penny et al. (2009).Penny D, Hoeppner MP, Poole AM, Jeffares DC. An overview of the introns-first theory. Journal of Molecular Evolution. 2009;69(5):527–540. doi: 10.1007/s00239-009-9279-5. [DOI] [PubMed] [Google Scholar]
  • Phukan, Jeena & Shukla (2016).Phukan UJ, Jeena GS, Shukla RK. WRKY transcription factors: molecular regulation and stress responses in plants. Frontiers in Plant Science. 2016;7:760. doi: 10.3389/fpls.2016.00760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Priest, Filichkin & Mockler (2009).Priest HD, Filichkin SA, Mockler TC. Cis-regulatory elements in plant cell signaling. Current Opinion in Plant Biology. 2009;12(5):643–649. doi: 10.1016/j.pbi.2009.07.016. [DOI] [PubMed] [Google Scholar]
  • Romani & Moreno (2021).Romani F, Moreno JE. Molecular mechanisms involved in functional macroevolution of plant transcription factors. New Phytologist. 2021;230(4):1345–13536. doi: 10.1111/nph.17161. [DOI] [PubMed] [Google Scholar]
  • Ross, Liu & Shen (2007).Ross CA, Liu Y, Shen QJ. The WRKY gene family in rice (Oryza sativa) Journal of Integrative Plant Biology. 2007;49(6):827–842. doi: 10.1111/j.1744-7909.2007.00504.x. [DOI] [Google Scholar]
  • Rushton et al. (2010).Rushton PJ, Somssich IE, Ringler P, Shen Q. WRKY transcription factors. Trends in Plant Science. 2010;15(5):247–258. doi: 10.1016/j.tplants.2010.02.006. [DOI] [PubMed] [Google Scholar]
  • Rushton et al. (2012).Rushton DL, Tripathi P, Rabara RC, Lin J, Ringler JP, Boken AK, Langum TJ, Smidt L, Boomsma DD, Emme NJ, Chen X, Finer JJ, Shen QJ, Rushton PJ. WRKY transcription factors: key components in abscisic acid signalling. Plant Biotechnology Journal. 2012;10(1):2–11. doi: 10.1111/j.1467-7652.2011.00634.x. [DOI] [PubMed] [Google Scholar]
  • Schwechheimer, Zourelidou & Bevan (1998).Schwechheimer C, Zourelidou M, Bevan MW. Plant transcription factor studies. Annual Review of Plant Physiology and Plant Molecular Biology. 1998;49(1):127–150. doi: 10.1146/annurev.arplant.49.1.127. [DOI] [PubMed] [Google Scholar]
  • Shannon et al. (2003).Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Research. 2003;13(11):2498–2504. doi: 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Shrestha, Khan & Dey (2018).Shrestha A, Khan A, Dey N. Cis-trans engineering: advances and perspectives on customized transcriptional regulation in plants. Molecular Plant. 2018;11(7):886–898. doi: 10.1016/j.molp.2018.05.008. [DOI] [PubMed] [Google Scholar]
  • Skibbe et al. (2008).Skibbe M, Qu N, Galis I, Baldwin IT. Induced plant defenses in the natural environment: Nicotiana attenuata WRKY3 and WRKY6 coordinate responses to herbivory. The Plant Cell. 2008;20(7):1984–2000. doi: 10.1105/tpc.108.058594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Sun et al. (2003).Sun C, Palmqvist S, Olsson H, Borén M, Ahlandsberg S, Jansson C. A novel WRKY transcription factor, SUSIBA2, participates in sugar signaling in barley by binding to the sugar-responsive elements of the iso1 promoter. The Plant Cell. 2003;15(9):2076–2092. doi: 10.1105/tpc.014597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Tang et al. (2008).Tang H, Wang X, Bowers JE, Ming R, Alam M, Paterson AH. Unraveling ancient hexaploidy through multiply-aligned angiosperm gene maps. Genome Research. 2008;18(12):1944–1954. doi: 10.1101/gr.080978.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Tuskan et al. (2006).Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U. The genome of black cottonwood, Populus trichocarpa (Torr. & Gray) Science. 2006;313(5793):1596–1604. doi: 10.1126/science.1128691. [DOI] [PubMed] [Google Scholar]
  • Ulker & Somssich (2004).Ulker B, Somssich IE. WRKY transcription factors: from DNA binding towards biological function. Current Opinion in Plant Biology. 2004;7(5):491–498. doi: 10.1016/j.pbi.2004.07.012. [DOI] [PubMed] [Google Scholar]
  • van Verk, Bol & Linthorst (2011).van Verk MC, Bol JF, Linthorst HJ. WRKY transcription factors involved in activation of SA biosynthesis genes. BMC Plant Biology. 2011;11(1):89. doi: 10.1186/1471-2229-11-89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • van Verk et al. (2008).van Verk MC, Pappaioannou D, Neeleman L, Bol JF, Linthorst HJ. A novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors. Plant Physiology. 2008;146(4):1983–1995. doi: 10.1104/pp.107.112789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wang et al. (2023).Wang H, Chen W, Xu Z, Chen M, Yu D. Functions of WRKYs in plant growth and development Trends. Trends in Plant Science. 2023;28(6):630–645. doi: 10.1016/j.tplants.2022.12.012. [DOI] [PubMed] [Google Scholar]
  • Wang et al. (2007).Wang H, Hao J, Chen X, Hao Z, Wang X, Lou Y, Peng Y, Guo Z. Overexpression of rice WRKY89 enhances ultraviolet B tolerance and disease resistance in rice plants. Plant Molecular Biology. 2007;65(6):799–815. doi: 10.1007/s11103-007-9244-x. [DOI] [PubMed] [Google Scholar]
  • Wiegmann et al. (2019).Wiegmann M, Maurer A, Pham A, March TJ, Al-Abdallat A, Thomas WT, Bull HJ, Shahid M, Eglinton J, Baum M. Barley yield formation under abiotic stress depends on the interplay between flowering time genes and environmental cues. Scientific Reports. 2019;9:6397. doi: 10.1101/488080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Xie et al. (2018).Xie T, Chen C, Li C, Liu J, Liu C, He Y. Genome-wide investigation of WRKY gene family in pineapple: evolution and expression profiles during development and stress. BMC Genomics. 2018;19(1):490. doi: 10.1186/s12864-018-4880-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Xie et al. (2025).Xie Q, Dong W, Wang M, Wang JJ, Sun L, Liu ZY, Gao CQ, Cao CW. BpWRKY6 regulates insect resistance by affecting jasmonic acid and terpenoid synthesis in Betula platyphylla. Plant Biotechnology Journal. 2025;23(9):3682–3696. doi: 10.1111/pbi.70169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Xu et al. (2021).Xu WJ, Cheng H, Zhu SR, Cheng JY, Ji HH, Zhang BC, Cao SQ, Wang C, Tong GM, Zhen C, Mu LQ, Zhou YH, Cheng YX. Functional understanding of secondary cell wall cellulose synthases in Populus trichocarpa via the Cas9/g RNA-induced gene knockouts. New Phytologist. 2021;231(4):1478–1495. doi: 10.1111/nph.17338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yamasaki et al. (2012).Yamasaki K, Kigawa T, Watanabe S, Inoue M, Yamasaki T, Seki M, Shinozaki K, Yokoyama S. Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor. Journal of Biological Chemistry. 2012;287(10):7683–7769. doi: 10.1074/jbc.m111.279844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yang et al. (2015).Yang X, Deng C, Zhang Y, Cheng Y, Huo Q, Xue L. The WRKY transcription factor genes in eggplant (Solanum melongena L.) and turkey berry (Solanum torvum Sw.) International Journal of Molecular Sciences. 2015;16(4):7608–7626. doi: 10.3390/ijms16047608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Ye et al. (2014).Ye SL, Jiang YZ, Duan YJ, Karim A, Fan D, Yang L, Zhao X, Yin J, Luo K, Li CY. Constitutive expression of the poplar WRKY transcription factor PtoWRKY60 enhances resistance to Dothiorella gregaria Sacc. in transgenic plants. Tree Physiology. 2014;34(10):1118–1129. doi: 10.1093/treephys/tpu079. [DOI] [PubMed] [Google Scholar]
  • Zhou et al. (2008).Zhou QY, Tian AG, Zou HF, Xie ZM, Lei G, Huang J, Wang CM, Wang HW, Zhang JS, Chen SY. Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants. Plant Biotechnology Journal. 2008;6(5):46–503. doi: 10.1111/j.1467-7652.2008.00336.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Information one. RT-PCR Data.
peerj-14-21132-s001.xlsx (11.6KB, xlsx)
DOI: 10.7717/peerj.21132/supp-1
Supplemental Information 2. MIQE checklist.
DOI: 10.7717/peerj.21132/supp-2

Data Availability Statement

The following information was supplied regarding data availability:

The data is available in the Supplemental File and at NCBI: GCF_000002775.5.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES