Construction and Biological Characterization of Papaya Leaf Curl Guangdong Virus Infectious cDNA Clone

ABSTRACT

Papaya leaf curl Guangdong virus (PaLCuGDV), a member of the genus Begomovirus, poses a significant threat to passion fruit (Passiflora edulis ) cultivation. A recent field survey in the Rongjiang area of Guizhou Province revealed a high natural infection rate of PaLCuGDV (90.1%; 209/232 plants). From a naturally infected passion fruit plant, the complete genome of a PaLCuGDV isolate was cloned and sequenced. The obtained genome, designated PaLCuGDV‐GZ (GenBank OP901623.1), comprises 2732 nucleotides and shows > 90% similarity to other Chinese PaLCuGDV isolates based on BLAST analysis. To experimentally investigate its pathogenicity, an infectious clone containing a 1.4‐mer of the viral genome was constructed. Agroinoculation using this clone demonstrated that PaLCuGDV infection induced mild leaf wrinkling, curling, and chlorosis in Nicotiana benthamiana, whereas it caused severe leaf curl and mosaic symptoms in passion fruit. The average experimental infection rate reached 46.7% in P. edulis , while it was 96.7% in N. benthamiana at 4 weeks post‐inoculation. Furthermore, transmission electron microscopy of N. benthamiana leaves infected with the infectious clone revealed two key findings: purified virions exhibited a unique “twin icosahedral” structure, and infected cells showed a significant reduction in chloroplast number along with abnormal chloroplast morphology. In summary, this study reports the prevalence of PaLCuGDV in the field and successfully establishes an infectious clone, which provides an essential tool for future research into the gene function, pathogenicity, and virus‐host interactions of this economically important virus.

Viral diseases are important diseases on cash crops such as passion fruit, among which PaLCuGDV is one of the more severe in recent years. We constructed an infectious clone of PaLCuGDV for the first time and confirmed its infectivity through biological assays. The construction of an infectious clone provides a key tool for in‐depth study of viral function, pathogenic mechanisms, and virus‐host interactions.

1. Introduction

Passion fruit ( Passiflora edulis ), a member of the Passifloraceae family, originates from Brazil and Argentina and is now extensively cultivated in tropical and subtropical regions worldwide (Ferreira et al. 2021). This fruit is abundant in organic acids, vitamin C, and more than 160 essential nutrients (Garcia et al. 2025). Additionally, it contains compounds with anti‐cancer, antioxidant, and anti‐inflammatory properties, which may lower the risk of cancer, cardiovascular diseases, and metabolic diseases. (Qiu et al. 2020). Passion fruit is a globally sought‐after fruit, prized for its distinctive flavour profile and exceptional nutritional attributes. Its commercial viability is evidenced by the steadily expanding cultivation area and yield over time, underscoring its advantageous position in the international market. Although the passion fruit industry is thriving globally, the outbreak of viral diseases has become a major bottleneck limiting its yield and quality. PaLCuGDV, a geminivirus with a broad host range and high variability, has caused increasingly severe viral diseases in passion fruit. Its frequent occurrence in major production areas can lead to significant yield reductions or even total crop failure, resulting in substantial economic losses for growers. However, little is currently known about how PaLCuGDV infects passion fruit, about its pathogenic mechanisms, or about the interactions between the virus and its host. This knowledge gap directly hinders the development of disease‐resistant cultivars and effective disease control strategies. Therefore, constructing an infectious clone of PaLCuGDV and elucidating its pathogenic mechanisms at the molecular level are of critical importance for filling this knowledge void and ensuring the sustainable development of the passion fruit industry.

PaLCuGDV is classified within the family Geminiviridae, specifically in the genus Begomovirus (Huang et al. 2020). Begomovirus is one of the largest genera in Geminiviridae (Inoue‐Nagata et al. 2016). Bemisia tabaci is one of the principal vectors of this virus, transmitting it in a circulative persistent manner (Hanley‐Bowdoin et al. 2013). According to the differences in the genomic structure of begomoviruses, they can be divided into two types: bipartite begomoviruses and monopartite begomoviruses. Bipartite begomoviruses have two circular DNA components (DNA‐A and DNA‐B), each ranging in size from 2.5 kb to 3.0 kb. Monopartite begomoviruses only contain the DNA‐A genome, often accompanied by a betasatellite, and some also carry an alphasatellite molecule (Ha et al. 2008). PaLCuGDV is a monopartite begomovirus; the viral genome contains six major open reading frames (ORFs): two on the virion‐sense strand (V1 and V2) and four on the complementary‐sense strand (C1–C4) (Nehra et al. 2019). These encoded proteins are the coat protein (ORF AV1, CP), which are associated with viral encapsulation and vector transmission (Pan et al. 2020); the movement protein (ORF AV2, MP), involved in viral infection and pathogenesis (Wang et al. 2019); the replication‐associated protein (ORF AC1, Rep), responsible for initiating DNA replication (Nair et al. 2020); the transcriptional activator protein (ORF AC2, TrAP), which activates transcription of certain genes (Veluthambi and Sunitha 2021); the replication enhancer protein (ORF AC3, Ren), involved in increasing viral accumulation in the host (Pasumarthy et al. 2011); and the C4 protein (ORF AC4, C4), which determines symptom development in monopartite viruses but has little to no effect in bipartite viruses (Kumar and Dasgupta 2023). PaLCuGDV is one of the pathogens that widely affect fruit, vegetable, and flower cultivation in tropical and subtropical regions. It possesses high environmental adaptability and variable host infectivity. This virus can cross species boundaries to infect a wide range of plants from different families and genera, including Carica papaya , Euphorbia pulcherrima , Nicotiana tabacum , Passiflora edulis and Eustoma grandiflorum (Huang et al. 2020). It also exhibits varying degrees of infectivity among different cultivated varieties of the same host. Disease symptoms vary significantly with environmental conditions and commonly include typical geminivirus symptoms such as leaf curling, malformation, vein swelling, mosaic patterns, and mottling. Research indicates that environmental temperature can directly affect viral activity or modulate the occurrence and spread of the PaLCuGDV by influencing its transmission vectors (Canto et al. 2010). Furthermore, co‐infection of PaLCuGDV with other viruses such as Euphorbia leaf curl virus (EuLCV), East Asian passiflora virus (EAPV), and telosma mosaic virus (TeMV) can lead to more severe disease, resulting in significant economic losses to the passion fruit industry (Li et al. 2023).

The construction of an infectious clone involves inserting the viral genomic cDNA into a suitable plasmid vector and then introducing it into permissive host cells. Inside the host, a promoter drives transcription to produce nucleic acids identical to those of the natural virus. By harnessing both host and viral mechanisms, the complete viral replication cycle proceeds, ultimately yielding infectious virus particles (Marano et al. 2020). This technique enables manipulation of RNA viruses at the cDNA level, providing an essential system for studying viral gene function and fundamental aspects of viral biology, including replication, transcription, movement, encapsidation, and pathogenesis (Ward and Flanegan 1992). The milestone of infectious clone technology began with research on positive‐strand RNA viruses. In 1981, Racaniello et al. established the first reverse genetics system for a positive‐strand RNA virus in animal cells. They cloned the full‐length cDNA of poliovirus into the bacterial expression vector pBR322 and successfully recovered infectious poliovirus by transfecting the construct into mammalian cells. This study represented the first breakthrough in the reverse genetics of animal RNA viruses, initiating a new era in infectious clone technology (Racaniello and Baltimore 1981). There are two main strategies for constructing infectious clones: in vitro and in vivo transcription (Boyapalle et al. 2008). The in vitro transcription method for generating infectious viral RNA involves cloning the full‐length viral cDNA into a plasmid, transcribing it into RNA in vitro using polymerases like T7 or SP6, and delivering the RNA into plant cells (e.g., by rub inoculation or gene gun). This approach was first successfully applied in 1984 by Paul Ahlquist and colleagues to create an infectious clone of brome mosaic virus (BMV), which was the first infectious clone for a plant positive‐strand RNA virus (Ahlquist et al. 1984). In the in vivo transcription method, Agrobacterium tumefaciens delivers plasmids containing viral cDNA and a suitable promoter (e.g., cauliflower mosaic virus 35S promoter) into plant cells. Inside the cells, the promoter initiates transcription to directly generate viral RNA. Owing to its simplicity and efficiency, this method finds broad application. For example, it has been used to build infectious clones of RNA viruses like chilli veinal mottle virus (ChiVMV) (Peng et al. 2022), the sida yellow mosaic China virus (SiYMCNV) (Wang et al. 2024), the Potato virus X (PVX) (Yang et al. 2020). A comparable Agrobacterium‐mediated strategy, wherein a strong promoter directly transcribes the viral genome, is also commonly used to construct infectious clones for geminiviruses (DNA viruses), including cotton leaf curl Multan virus (CLCuMV) (Tang et al. 2016), the beijing isolate of tomato yellow leaf curl virus (TYLCV‐BJ) (Cao et al. 2024), and tomato leaf curl New Delhi virus (ToLCNDV) (Mei et al. 2023). Compared with the in vitro transcription method, Agrobacterium‐mediated (in vivo) delivery systems are generally more convenient and have become the mainstream approach for many plant virus systems. However, the in vitro transcription method retains unique value when precise control over RNA termini or specific biochemical analyses is required (Zhang et al. 2020). Beyond its utility as a functional research tool, the construction of infectious clones holds deeper significance in plant pathology: it provides key evidence for fulfilling Koch's postulates and establishing a causal relationship between obligate parasitic pathogens and the diseases they cause. This approach enables the reproduction of disease symptoms in hosts using a single, well‐defined viral genome, thereby helping to rule out confounding factors such as mixed infections, latent pathogens, or environmental stressors and ultimately confirming the virus's pathogenicity.

In this study, we determined the full‐length genomic sequence of a PaLCuGDV isolate (designated PaLCuGDV‐GZ) obtained from passion fruit plants in Guizhou Province, China. An infectious cDNA clone (designated PCB301‐PaLCuGDV‐GZ) was subsequently constructed using the restriction‐ligation method. The clone proved pathogenic in both passion fruit and N. benthamiana plants. Furthermore, TEM revealed that PaLCuGDV‐GZ has a geminate icosahedral structure. These findings lay a solid foundation for the molecular characterization of PaLCuGDV‐GZ.

2. Materials and Methods

2.1. Extraction of DNA and RNA

Passion fruit leaf samples were collected from Rongjiang County, Qiandongnan Prefecture, Guizhou Province, China, and immediately stored at −80°C. Total DNA or RNA was then extracted using an improved CTAB method (Schenk et al. 2023). The necessary reagents include a 2% CTAB DNA/RNA extraction buffer, β‐mercaptoethanol, phenol:chloroform:isoamyl alcohol (25:24:1, v/v), and chloroform:isoamyl alcohol (24:1, v/v). After determining the DNA/RNA concentration, the sample was stored at −20°C for future use.

2.2. Complete Nucleotide Sequence Sequencing and Phylogenetic Analysis

The full‐length genome of PaLCuGDV‐GZ was amplified using the specific primer pair PaLCuGDV‐F/PaLCuGDV‐R (Table 1). The 25 μL PCR reaction contained 12.5 μL of Primestar Max DNA Polymerase (Takare Bio), 2 μL of infected plant DNA template, 0.5 μL of each primer (10 μM), and 9.5 μL of ddH₂O. The PCR amplification protocol was as follows: an initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 50°C–60°C (depending on the primer Tm) for 30 s, and extension at 72°C for 2 min; and a final extension at 72°C for 10 min. The PCR products were separated by agarose gel electrophoresis, and the target DNA fragments were purified using a DNA gel extraction kit (OMEGA). The purified fragments were ligated into pMD19‐T vectors (TaKaRa). The recombinant plasmid was transformed into DH5α competent cells (Sangon Biotech, Shanghai). Positive clones were identified by colony PCR using the universal M13F/M13R primers. The cloned fragments were sequenced by Sangon Biotech (Shanghai). The PaLCuGDV sequence was assembled using DNAMAN software. A BLAST search was then performed against the GenBank database (Https://www.ncbi.nlm.nih.gov). Finally, a neighbour‐joining (NJ) phylogenetic tree was constructed with MEGA 6.0 software, based on 1000 bootstrap replicates.

TABLE 1.

Sequences and sizes of the primers designed for PCR detection in this study.

Primer name	Sequences (5′–3′)	Size
PaLCuGDV‐F	ATGTGGGATCCACTTATGAATG	2.8 kb
PaLCuGDV‐R	GTGGATCCCACATTTTTGAAG
uPaLCuGDV‐f	TACATGGTTTCAGGTGTATGC	1230 bp
uPaLCuGDV‐r	CCAAATCCCCTTTATTTCAAG
pCB301‐F	ACTAGATCGGGAATTCGATATC	200 bp
pCB301‐R	GCGCTCACTGCCCGCTTTC
CMV‐F	ATGGACAAATCTGRATCWMCC	300 bp
CMV‐R	CTGGATGGACAACCCGTTC	300 bp
EAPV‐F	AATGGWAATYTTGTNTGGG	1.5 kb
EAPV‐R	CTTCTGCAACTTTCTCTGTCAAAG	1.5 kb
TeMV‐F	GCACAATTGGTACACTCAAATGG	750 bp
TeMV‐R	CTGAAGAGAGCATCACTTCTTTCAG	750 bp
qNb‐PPA2‐F	GACCCTGATGTTGATGTTCGCT	150 bp
qNb‐PP2A‐R	GAGGGATTTGAAGAGAGATTTC	150 bp
qPe‐EF‐1α‐F	GATTGGTGGTATTGGAACTGTC	150–180 bp
qPe‐EF‐1α‐R	AGCTTCGTGGTGCATCTC	150–180 bp
qPaLCuGDV‐CP‐F	CGGAAGCCCAGAATTTACA	150 bp
qPaLCuGDV‐CP‐R	CCATTACCACGAGTGACAT	150 bp

2.3. Construction of an Infectious Clone of PaLCuGDV‐GZ

The pMD19‐T‐PaLCuGDV‐GZ plasmid was digested with BamH I and Sal I (sites located within the PaLCuGDV‐GZ sequence). The released insert was ligated into a similarly digested pCB301 vector, generating pCB301‐0.4GZ, which harbours approximately 0.4 copies of the viral genome. The pMD19‐T‐PaLCuGDV‐GZ plasmid was subjected to single digestion with BamH I to release the full‐length viral genome. This fragment was then ligated into the BamH I‐linearized pCB301‐0.4GZ vector, yielding the construct pCB301‐1.4GZ, which contains 1.4 copies of the viral genome. The ligation product was transformed into DH5α competent cells (Sangon Biotech, Shanghai) and plated on LB agar plates containing 50 mg/L kanamycin, followed by incubation at 37°C for 12 h. Colony PCR and restriction enzyme digestion analysis were performed using the pCB301‐F/R primers (Table 1). The resulting recombinant plasmid, designated pPaLCuGDV‐GZ, was verified by sequencing and subsequently transformed into Agrobacterium tumefaciens strain EHA105 via the freeze–thaw method.

2.4. Agroinfiltration of Infectious Clone on N. Benthamiana, Potato, Tomato, Pepper and Passion Fruit

The A. tumefaciens EHA105 strain carrying the full‐length nucleotide sequence of PaLCuGDV was cultured overnight at 28°C in LB medium supplemented with kanamycin and rifampicin (each at 50 mg/L). After being collected, the bacterial cells were resuspended in an inoculation buffer (containing 10 mmol/L MgCl₂, 10 mmol/L MES, and 200 μmol/L AS). The bacterial concentration was adjusted to an OD₆₀₀ of 0.8–1.0, and the suspension was left to stand at room temperature in the dark for approximately 2 h. Using 1 mL medical syringes with the needles removed, we inoculated an appropriate amount of the resuspension onto 3–4 leaves of 3‐week‐old plants of N. benthamiana, potato, tomato, and pepper, as well as onto the leaves of 4‐week‐old passion fruit plants. A. tumefaciens carrying the empty pCB301 vector was used as a mock‐inoculation control. The biological experiments were repeated three times, with more than three replicate samples in each group. To systematically evaluate the infectivity of the virus in N. benthamiana and passion fruit, we conducted three independent biological replicates. In each replicate, the following treatment groups were established for each plant species: a mock‐inoculated control group (inoculated with an equal volume of buffer, 4 plants) and a virus‐inoculated group (10 plants). All plants were cultivated in a climate‐controlled growth chamber. Leaf samples were collected at 28 days post‐inoculation (dpi), and DNA was extracted for virus‐specific PCR detection. All mock‐inoculated control plants tested negative by PCR, confirming the absence of background contamination and the reliability of the experimental procedures. In the virus‐inoculated groups, plants were considered infected based on a positive PCR result. The infection rate for each replicate was calculated as (number of positive plants/total number of inoculated plants) ×100%. Finally, the infection rate for each species was expressed as the mean of the three replicates.

2.5. PCR and qRT‐PCR Detection of PaLCuGDV

To assess the infectivity of PaLCuGDV, DNA was extracted from systemic leaves of N. benthamiana, potato, tomato, pepper, and passion fruit plants that had been inoculated with the virus. The pCB301‐PaLCuGDV plasmid was used as a positive control, and healthy plants of the same species served as negative controls. We then performed PCR with the specific primers uPaLCuGDV‐F and uPaLCuGDV‐R. In addition, total RNA was extracted from the systemic leaves of N. benthamiana and passion fruit plants successfully inoculated with PaLCuGDV‐GZ to quantify viral gene expression by quantitative real‐time PCR (qRT‐PCR). The amplification program was as follows: initial denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 50°C–60°C (depending on primer Tm values) for 15 s, and extension at 72°C for 20 s. Melt curve analysis was performed as follows: 95°C for 15 s, 60°C for 1 min, followed by a gradual increase in temperature to 95°C. qRT‐PCR was performed using SYBR Green qPCR Master Mix. Relative expression levels were calculated using the 2^−ΔΔCt method. The primers used in this study are listed in Table 1. Symptoms exhibited by the PaLCuGDV‐GZ‐infected plants were also recorded and photographed.

2.6. Crude Purification of PaLCuGDV Particles

The steps for the crude purification of PaLCuGDV are as follows (Lu et al. 2019): 100 g of PaLCuGDV‐infected N. benthamiana leaves were homogenized with 200 mL of pre‐cooled buffer (0.1 M K₂HPO₄: 0.1 M ascorbic acid = 4:1, pH 7.0). The homogenate was filtered through gauze. A mixture of 5% n‐butanol and 10% chloroform was added to the filtrate, followed by shaking for 15 min and centrifugation at 8000× g for 20 min at 4°C. Then, 10% PEG and 1% sodium chloride were added to the supernatant, and the mixture was stirred until the PEG was completely dissolved. After incubation at 4°C for 4 h, the solution was centrifuged at 15,000× g for 30 min at 4°C. The pellet was resuspended in buffer (0.01 M phosphate buffer, pH 7.0, containing 0.001 M EDTA) and kept overnight at 4°C, followed by centrifugation at 15,000× g for 10 min. The resulting supernatant, containing the crude virus preparation, was used to prepare slides for observation under a transmission electron microscope.

2.7. Morphological Observation by Transmission Electron Microscopy (TEM)

TEM was performed on systemic leaves of N. benthamiana that had been inoculated with PaLCuGDV‐GZ for 21 days to observe the morphological characteristics of virus particles. Leaf samples (1 × 1 cm) from the inoculated plants were fixed in 2.5% glutaraldehyde and sent to Chengdu Lilai Biotechnology Co. Ltd. for subsequent sample preparation and TEM observation. The specific steps are as follows: Fix the samples, then refix with 1% osmium tetroxide. Subsequently, the fixed samples were dehydrated with acetone, followed by infiltration with mixtures of acetone and Epon‐812 embedding agent in ratios of 3:1, 1:1, and 1:3, respectively. After infiltration, the samples were embedded in pure Epon‐812 resin. Following embedding, ultrathin sections (60–90 nm) were cut using an ultramicrotome and mounted on copper grids. The sections were then stained with uranyl acetate for 10–15 min and with lead citrate for 1–2 min. Finally, the samples were observed using a transmission electron microscope.

2.8. Data Analysis

All data were subjected to statistical analysis via a one‐way analysis of variance (ANOVA) or a Student's t‐test utilizing GraphPad Prism Software (version 9.0, GraphPad Software Inc., San Diego, CA, USA). Statistical significance was established at p < 0.05. Data compiled from three independent repeated experiments were collectively analysed, as the interaction between treatment and experiment did not constitute a significant variable.

3. Results

3.1. Detection and Analysis of Viral Symptoms in Passion Fruit Fields

In August 2023, passion fruit plants exhibiting suspected viral symptoms such as leaf wrinkling, curling, and yellowing were observed across multiple cultivation sites in Rongjiang County, Qiandongnan Prefecture, Guizhou Province (Figure 1a) The aforementioned passion fruit samples were tested using specific primers for PaLCuGDV, cucumber mosaic virus (CMV), East Asian Passiflora virus (EAPV), and telosma mosaic virus (TeMV) (Table 1) via PCR and RT‐PCR. The results showed that PaLCuGDV and TeMV were detected in the samples (Figure 1b), with detection rates of approximately 90% (209/232) and 70% (36/50), respectively, while CMV and EAPV were not detected (Figure S1).

FIGURE 1.

Symptoms and Detection Analysis of Passion Fruit Viral Diseases. (a) Symptoms of viral disease in passion fruit in the field. H: Leaf from a healthy plant; I: Leaf from a plant infected with a viral disease. (b) PCR detection of PaLCuGDV and TeMV. Lane CK: Healthy passion fruit control plant; Lanes 1–6: Passion fruit samples infected with PaLCuGDV (top panel). Lanes 2–5: Passion fruit samples infected with TeMV (bottom panel). Lane M: DL2000 DNA marker. Scale bars a: 2 cm.

3.2. Genome Organization and Phylogenetic Analysis of PaLCuGDV‐GZ

We sequenced and analysed the complete genome of the PaLCuGDV‐GZ isolate, which spans 2732 nucleotides and encodes six open reading frames (ORFs) (Figure 2a). Sequence alignment showed that PaLCuGDV‐GZ shared a nucleotide sequence similarity of 99.6% with Korean isolates (MK070465.1, KY884675.1, MG257886.1), indicating a very close genetic relationship (Figure 2b). In contrast, it shared approximately 93% similarity with isolates from Taiwan, China (LC089766.1, LC089014.1, JN703795.1), and 81%–89% similarity with other Begomovirus species. Amino acid sequence alignment revealed that the movement protein (MP) and coat protein (CP) of PaLCuGDV‐GZ shared 75%–95% and 89%–95% identity, respectively, with those of other begomoviruses. The higher sequence conservation of CP suggests a closer evolutionary relationship between PaLCuGDV‐GZ and other begomoviruses in this protein (Table 2).

FIGURE 2.

Genome structure and phylogenetic tree analysis of PaLCuGDV‐GZ. (a) Schematic diagram of PaLCuGDV‐GZ gene structure. (b) Phylogenetic analysis based on PaLCuGDV‐GZ and other PaLCuGDV isolates.

TABLE 2.

Nucleotide sequence identities (%) among PaLCuGDV‐GZ and other PaLCuGDV isolates and other Begomovirus.

Virus name	Accession number	Genome a (%)	MP b (%)	CP b (%)
PaLCuGDV‐JJ17‐PF8	MK070465.1	99.60	100	99.82
PaLCuGDV‐GH15‐BP6	KY884675.1	99.56	100	99.82
PaLCuGD‐GH15‐10	MG257886.1	99.52	100	99.82
PaLCuGDV‐CN17‐PF11	MK070448.1	99.49	100	99.82
PaLCuGDV‐GH14‐5	MG257887.1	99.45	100	98.44
PaLCuGDV‐CN17‐PF12	MK070449.1	99.41	100	98.44
PaLCuGDV	KT266873.1	99.38	100	97.66
PaLCuGDV‐FJ02	ON012800.1	99.34	100	99.22
PaLCuGDV‐JN17‐PF16	MK070464.1	99.27	100	98.05
PaLCuGDV‐BY‐1	MZ130306.1	99.23	100	95.64
PaLCuGDV‐CB17‐PF4	MK070450.1	99.19	100	98.83
PaLCuGDV‐BG‐2	LC089766.1	93.24	95.69	94.55
PaLCuGDV‐FY‐2	LC089014.1	92.84	93.97	93.77
PaLCuGDV‐PT‐9	JN703795.1	92.30	95.69	97.67
PaLCuGDV‐GD2	NC005844.1	91.77	96.55	96.50
MLCuGV	NC008316.1	88.7	94.83	94.55
ToLCNaV‐NT19T58	MW248597.1	86.6	96.55	95.33
AYVCNV‐SN3	KF785751.1	82.26	77.59	89.88
TYLCYnV‐YN2013	KC686710.1	81.55	71.67	93.77
AYVCNV‐YN4356	KU975393.1	81.49	75.86	89.66

^a Nucleotide sequence.

^b Amino acid sequences.

3.3. Generation of the PaLCuGDV‐GZ Infectious Clone

An infectious clone of the PaLCuGDV GZ isolate was constructed by inserting a 1.4× genome‐length fragment (containing one complete genome plus a partial duplication) downstream of the 2 × 35S promoter in the binary vector pCB301, generating the recombinant clone pCB301‐1.4 GZ (Figure 3a). The construct was verified by restriction digestion. Double digestion with BamH I and Sal I produced fragments of approximately 1100 bp (0.4 GZ), 1600 bp (0.6 GZ), and 3600 bp (pCB301 vector) (Figure 3b). Single digestion with BamH I yielded a 2700 bp linearized fragment (1.0 GZ) and a 4700 bp fragment corresponding to pCB301 + 0.4 GZ, which matches the theoretical total plasmid size (Figure 3c). These results demonstrate the successful construction of the infectious clone pCB301‐1.4 GZ.

FIGURE 3.

Schematic diagram and restriction analysis of the infectious clone construction of PaLCuGDV‐GZ. (a) Schematic of the pCB301‐1.4 GZ infectious clone construction. (b) Restriction digestion analysis of pCB301‐1.4 GZ was performed with BamH I and Sal I. (c) The pCB301‐1.4 GZ clone was analysed by single‐enzyme digestion with BamH I. Lane M: DL5000 DNA marker.

3.4. The Pathogenicity of the PaLCuGDV‐GZ Infectious Clone to Passion Fruit

As PaLCuGDV‐GZ was isolated from passion fruit, we evaluated the infectivity of the cloned pPaLCuGDV‐GZ on its natural host. The experimental results showed that at 21 dpi with pPaLCuGDV‐GZ, the passion fruit plants developed obvious wrinkling, curling, and slight yellowing in newly emerged leaves. By 60 dpi, the entire plants exhibited severe leaf curling and wrinkling (Figure 4a). Meanwhile, we compared the plant height of passion fruit plants at 21 dpi with that of healthy plants and found no significant difference (Figure S2). To verify whether the symptoms were caused by PaLCuGDV‐GZ, we extracted DNA from leaves of systemically infected passion fruit plants at 21 and 60 dpi for PCR analysis. The results showed that pPaLCuGDV‐GZ was detected at both time points (Figure 4b). To further analyse the accumulation dynamics of PaLCuGDV‐GZ during infection, we extracted total RNA from the leaves of healthy passion fruit plants and those systemically infected at 21 and 60 dpi. Using EF‐1α as the reference gene, we detected the transcriptional levels of the viral coat protein (CP) gene by qRT‐PCR. The results showed that the expression level of the viral CP gene at 21 dpi was significantly higher than that at 60 dpi, indicating that the virus exhibits higher transcriptional activity during the early stage of infection (Figure 4c).

FIGURE 4.

Symptoms and Detection of PaLCuGDV‐GZ in Passion Fruit Infected with Agrobacterium tumefaciens . (a) Symptoms of passion fruit plants inoculated with pPaLCuGDV‐GZ at 21 and 60 dpi. (b) At 21 and 60 dpi, systemic leaves were harvested from passion fruit plants. Subsequent DNA extraction and PCR analysis, employing virus‐specific primers (1230 bp), were conducted to detect pPaLCuGDV‐GZ. The molecular weight marker M is DL5000. The negative control N is healthy Passion Fruit plants, and the positive control P is the pPaLCuGDV‐GZ plasmid. Mock: Plants inoculated with Agrobacterium tumefaciens carrying PCB301. Scale bars a: 8 cm. (c) At 21 and 60 dpi, the expression levels of PaLCuGDV‐GZ in inoculated passion fruit were analysed using qRT‐PCR. Error bars represent the mean ± standard deviation (n = 3). Statistical significance was evaluated using one‐way ANOVA (*p < 0.05, **p < 0.01, *** p < 0.001).

3.5. Pathogenicity Analysis of the PaLCuGDV‐GZ Infectious Clone in N. benthamiana, Potato, Pepper and Tomato

PaLCuGVD successfully infected the experimental host N. benthamiana. By 15 dpi, systemic leaves showed mild curling symptoms. Furthermore, PCR amplification using DNA from these leaves produced the expected target band for PaLCuGDV‐GZ‐inoculated plants, which verified systemic infection (Figure 5a,b). PaLCuGVD‐GZ can infect N. benthamiana. To further explore whether PaLCuGVD‐GZ has a broader host range among solanaceous crops, we inoculated potato, pepper, and tomato plants using Agrobacterium tumefaciens ‐mediated agroinfiltration. The results showed that at 21 dpi, none of the inoculated plants exhibited obvious symptoms (Figure 5c,e,g). DNA extracted from systemic leaves was used as a template for PCR detection. The results indicated that PaLCuGVD‐GZ was not detected in pepper or tomato plants (Figure 5f,h), while the corresponding target band was amplified from potato (Figure 5d), suggesting that PaLCuGVD‐GZ can infect potato.

FIGURE 5.

Symptoms and Detection of PaLCuGDV‐GZ in N. benthamiana, potato, pepper, and tomato Infected with Agrobacterium tumefaciens . (a) Symptoms of passion N. benthamiana inoculated with pPaLCuGDV‐GZ at 15 dpi. (b) PCR detection of the pPaLCuGDV‐GZ construct in inoculated N. benthamiana plants at 15 dpi. (c, e, g) Phenotypic observations were made on potato, pepper, and tomato plants at 21 dpi after inoculation with pPaLCuGDV‐GZ. (d, f, h) PCR detection of the pPaLCuGDV‐GZ construct in inoculated potato, pepper, and tomato plants at 21 dpi. The molecular weight marker M is DL2000. The negative control N is healthy N. benthamiana, potato, pepper, and tomato plants, and the positive control P is the pPaLCuGDV‐GZ plasmid. Mock: Plants inoculated with Agrobacterium tumefaciens carrying PCB301. Scale bars a, e, g: 4.5 cm. Scale bar c: 8 cm (upper part of C); 3 cm (lower part of C).

We assessed the infectivity of pPaLCuGDV‐GZ (delivered via Agrobacterium tumefaciens ) on N. benthamiana and passion fruit plants (Table 3). The virus had an average infection rate of 96.7% on N. benthamiana, but only about 46.7% on passion fruit. In conclusion, we have successfully constructed an infectious clone of pPaLCuGDV‐GZ, which demonstrates pathogenicity and effectively infects both N. benthamiana and passion fruit.

TABLE 3.

Infection efficiency of the PaLCuGDV‐GZ infectious clone in two host plants: Passion fruit and N. benthamiana at 28 dpi.

Replicate	Syringe agroinfiltration
	No. of N. benthamian plants infected/inoculated	Infection rate(%)	No. of passion fruit plants infected/inoculated	Infection rate(%)
I Control	10/10	100	5/10	50
	0/4	0	0/4	0
II Control	9/10	90	6/10	60
	0/4	0	0/4	0
III Control	10/10	100	3/10	30
	0/4	0	0/4	0

3.6. Electron Microscopy Revealed the Virion Morphology of PaLCuGDV‐GZ

Compared to the control group, systemic leaves of N. benthamiana plants agroinfiltrated with the infectious clone of PaLCuGDV‐GZ exhibited slight curling and wrinkling symptoms at 15 dpi (Figure 6a). PCR test results indicate that the virus has accumulated in the systemic leaves (Figure 6b). Meanwhile, the transcriptional level of the coat protein (CP) gene of PaLCuGDV‐GZ was detected by real‐time quantitative qRT‐PCR. The results showed that the expression level of the CP gene was extremely significantly up‐regulated at 15 dpi in N. benthamiana (Figure 6c). To understand the morphological characteristics of the virus particles, we performed further crude purification of PaLCuGDV‐GZ using symptomatic systemically infected leaves of N. benthamiana. The crude extract was negatively stained with 2% phosphotungstic acid and observed using a JEOLTEM at an accelerating voltage of 80 kV. The results revealed that the viral particles exhibited a unique “twin icosahedral” composite structure, resembling a “peanut shell,” with a diameter of approximately 20–40 nm (Figure 6d), consistent with the morphological characteristics of the Geminiviridae family.

FIGURE 6.

Pathogenicity and Virion Structure of an Infectious Clone of PaLCuGDV‐GZ. (a) Symptoms on N. benthamiana plants at 15 dpi with pPaLCuGDV‐GZ. (b) PCR detection of pPaLCuGDV‐GZ in N. benthamiana at 15 dpi. The molecular weight marker M is DL2000. The negative control N is healthy N. benthamiana plants, and the positive control P is the pPaLCuGDV‐GZ plasmid. Mock: Plants inoculated with Agrobacterium tumefaciens carrying PCB301. (c) At 15 dpi, the expression levels of PaLCuGDV‐GZ in inoculated N. benthamiana were analysed using qRT‐PCR. Statistical significance was evaluated by the t‐test (*p < 0.05, **p < 0.01, ***p < 0.001). (d) Transmission electron micrograph of viral particles in the systemic leaves of N. benthamiana plants inoculated with pPaLCuGDV‐GZ via agro‐infiltration. Scale bars a: 4.5 cm. Scale bar c: 100 nm.

3.7. PaLCuGDV‐GZ Infection Induces Chloroplast Ultrastructural Alterations

TEM analysis was performed on the systemic leaves of N. benthamiana 21 dpi with PaLCuGDV‐GZ. The results showed that structurally intact chloroplasts were observed in the mesophyll cells of healthy N. benthamiana leaves, displaying clear outer membranes, thylakoid membranes, and tightly stacked grana (Figure 7a,c). In contrast, mesophyll cells of plants infected with PaLCuGDV‐GZ exhibited a significant reduction in chloroplast number (Figure 7e and Figure S4), along with notable structural deformities. While the basic outline of some chloroplasts remains intact, the thylakoid lamellar structure appears indistinct, the quantity of basal granules is diminished, and numerous osmophilic droplets are clustered near the chloroplasts, suggesting potential disintegration of certain chloroplast membrane systems. Furthermore, numerous spherical particles, potentially PaLCuGDV‐GZ virus particles, were observed surrounding the outer membrane of the chloroplasts in the infected plants (Figure 7b,d). In PaLCuGDV‐GZ‐infected mesophyll cells of N. benthamiana, viral particles were suspected to aggregate and form crystalline structures, while no such structures were observed in healthy N. benthamiana mesophyll tissues (Figure S5).

FIGURE 7.

Transmission electron microscopy analysis of PaLCuGDV‐GZ virus morphology and ultrastructural changes in chloroplasts in infected N. benthamiana leaves. (a, c) Chloroplast ultrastructure of healthy N. benthamiana leaves uninfected by PaLCuGDV‐GZ. (b, d) Chloroplast ultrastructure of N. benthamiana infected with PaLCuGDV‐GZ (The black arrows indicate suspected PaLCuGDV‐GZ virus particles). (e) Analysis of differences in chloroplast quantity between PaLCuGDV‐GZ‐infected N. benthamiana and healthy N. benthamiana. Error bars represent mean ± standard deviation (n = 3). Statistical significance was evaluated by the t‐test. The asterisks above the bars indicate significant differences in the number of chloroplasts in mesophyll cells between N. benthamiana systemically infected with PaLCuGDV and the control group (healthy N. benthamiana leaves) (*p < 0.05, **p < 0.01, ***p < 0.001). Scale bars a, b: 2 μm; c, d: 500 nm.

4. Discussion

PaLCuGDV was initially identified on papaya and has been increasingly reported in passion fruit over recent years (Yang et al. 2013). Although PaLCuGDV has caused severe damage to the passion fruit industry in recent years (Huang et al. 2021), research on its pathogenicity and disease mechanisms remains relatively limited. Therefore, constructing infectious clones of the PaLCuGDV is an effective technical approach to study its pathogenicity and host resistance. In this study, PaLCuGDV was detected on passion fruits in Rongjiang, Guizhou Province, without any accompanying DNA‐β satellite molecules, aligning with previous research findings (Qing and Zhou 2009). Phylogenetic analysis revealed that PaLCuGDV‐GZ exhibited the highest homology with PaLCuGDV isolates identified in passion fruit from China, Taiwan, and Korea, suggesting a possible transmission of PaLCuGDV from Taiwan and other regions.

Passiflora edulis , Carica papaya , Euphorbia pulcherrima , and Platycodon grandiflorum serve as natural hosts for PaLCuGDV (Tan et al. 2023). This study demonstrates that the infectious clone PaLCuGDV‐GZ exhibits pathogenicity on N. benthamiana and passion fruit plants and causes characteristic disease symptoms. Furthermore, breeding resistant varieties of passion fruit is key to reducing damage from PaLCuGDV. To achieve this, efficient inoculation and identification methods are in need. At present, traditional plant virus resistance identification methods are mechanical friction and Bemisia tabaci transmission (Vassilakos et al. 2008). Infectious clone technology, a highly efficient and controlled inoculation method, has attracted considerable interest. It effectively addresses the challenge of mechanically transmitting viral isolates that are not sap‐transmissible. This system ensures a genetically uniform and well‐defined virus source, thereby significantly enhancing the reliability and reproducibility of inoculation experiments. As a result, it provides a robust tool for screening plant virus resistance (Zheng et al. 2017). Screening for disease‐resistant passion fruit varieties was not conducted in this study. The primary reason is the low efficiency of virus inoculation, likely due to the thick cuticle and wax layer on the leaves. When using Agrobacterium‐mediated PaLCuGDV inoculation methods (including leaf rubbing and stem/leaf injection), the infection rate achieved was only about 46.7%. This rate is insufficient for systematic and reliable resistance evaluation. Therefore, future research should focus on optimizing inoculation techniques to improve the PaLCuGDV infection rate effectively. This optimization will provide a robust technical foundation for screening resistant passion fruit varieties. In addition, a 1.4‐mer full‐length infectious DNA clone of PaLCuGDV‐GZ was constructed in this study. However, most infectious clone constructs for baculoviruses are 1.6‐mer or 2.0‐mer. Therefore, the genome size of the clone generated here may explain its low infection efficiency in passion fruit and its failure to infect pepper and tomato. This hypothesis warrants further investigation.

TEM revealed that PaLCuGDV‐GZ virus particles have a twinned spherical morphology, similar to that of maize streak virus reported by Zerbini et al. (Zerbini et al. 2017). In summary, TEM observations of the typical geminivirus morphology in PaLCuGDV‐GZ lend support to the infectivity of its clone in passion fruit, N. benthamiana, and potato, as well as to the positive PCR detection results. Using cryo‐electron microscopy, we observed that the systemic leaves of PaLCuGDV‐GZ‐infected N. benthamiana contained numerous spherical virions (20–30 nm), which were clustered around the outer membrane of chloroplasts. Furthermore, a notable decrease in the quantity of chloroplasts was observed in the mesophyll cells of PaLCuGDV infected plants. While a few chloroplasts retained their fundamental shapes, many exhibited a blurred thylakoid lamellar arrangement, with some displaying distinct distortions. This is consistent with the findings of Montasser et al., who reported that the CMV‐KU2 strain caused malformation and disintegration of chloroplast structures in infected tomato tissues (Montasser and El‐Sharkawey 2017). These phenomena suggest that infection by PaLCuGDV‐GZ may disrupt the morphological structure of chloroplasts in plants, leading to impaired physiological functions. Consequently, infected plants display mottled and curled symptoms. However, this hypothesis requires further validation through subsequent research.

The construction of infectious cDNA clones serves as a powerful research tool to study virus‐host interactions, pathogenic mechanisms, viral functional genomics, and viral replication/protein expression, with applications in antiviral studies and the development of novel viral vectors (Wang et al. 2021). Moreover, it allows for the creation of a range of mutants by precisely locating and mutating virus sequences, aiding in the investigation of infection mechanisms, host disease resistance mechanisms, and associated movement mechanisms (Dommes et al. 2019). Given that infectious clones have been widely used to generate mutants and investigate viral pathogenicity and gene functions, the PaLCuGDV infectious clone constructed in this study can serve as a valuable tool in future research. It may be utilized to identify virulence determinants and to explore aspects such as mutant viability, viral movement, and other gene functions.

5. Conclusion

In conclusion, this study identifies a PaLCuGDV isolate as the causative agent of the passion fruit disease in the Rongjiang area, Guizhou, China. Nucleotide sequence analysis indicated that the identified isolate, PaLCuGDV‐GZ, shares the highest sequence identity with isolates from Taiwan, China, and South Korea. An infectious clone of PaLCuGDV‐GZ was successfully constructed. Agrobacterium‐mediated inoculation demonstrated that the clone exhibited high infectivity in N. benthamiana (96.7% efficiency) and induced severe symptoms, including leaf curling, shrinkage, and mosaic patterns on passion fruit plants. Furthermore, TEM revealed that PaLCuGDV‐GZ viral particles have a twin spherical morphology, and that infection causes a significant reduction in chloroplast number along with distinct structural abnormalities in the mesophyll cells of N. benthamiana. Collectively, these findings establish a foundation for future research into the gene function, pathogenicity mechanisms, and virus‐host interactions of PaLCuGDV.

Author Contributions

Sheng Xu: experimentation, data curation, formal analysis, investigation, methodology, visualization, writing – original draft. Gaoli Wu: methodology, validation. Zhaoyao Yu: investigation, methodology, validation. Chengxi Yang: methodology, validation, investigation. Xiangru Chen: conceptualization, project administration, supervision, writing – review and editing. All authors read and approved the final manuscript.

Funding

This work was supported by CARS‐26‐04A and Guizhou Provincial Doctoral Innovation Station at Guizhou Modern Seed Industry Group Co. Ltd. (Grant No. QKXF [2025] 21).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Data S1: mbt270339‐sup‐0001‐DataS1.xlsx.

Figure S1: PCR detection of CMV and EAPV. Lane CK: healthy passion fruit control plant.

Figure S2: Passion fruit plants showed a plant height phenotype at 21 dpi with pPaLCuGDV‐GZ. Scale bars: 16 cm.

Figure S3: Transmission electron microscopy analysis of PaLCuGDV‐GZ virus morphology and ultrastructural changes of chloroplasts in infected N. benthamiana leaves. (a) Chloroplast ultrastructure of healthy N. benthamiana leaves uninfected by PaLCuGDV‐GZ. (b) Chloroplast ultrastructure of N. benthamiana infected with PaLCuGDV‐GZ. Scale bars: (a) 5 μm; (b) 5 μm.

Figure S4: In mesophyll cells of N. benthamiana infected with PaLCuGDV‐GZ, viral inclusion bodies appear as electron‐dense, crystalline structures.

Figure S5: Original images of PCR testing for PaLCuGDV‐GZ (a) and TeMV (b) detection in field‐collected passion fruit samples. (Supplement to Figure 1b).

Figure S6: Original image of restriction digestion verification for pCB301‐PLCGV‐GZ (Supplement to Figure 3b).

Figure S7: Original image of PCR detection for the pPaLCuGDV‐GZ construct in inoculated passion fruit plants at 21 (a) and 60 (b) dpi (Supplement to Figure 4b).

Figure S8: Original image of PCR detection for the pPaLCuGDV‐GZ construct in inoculated N. benthamiana plants at 15 dpi (Supplement to Figure 6b).

Figure S9: Original PCR images for viral infection in N. benthamiana (a) at 15 dpi, tomato (b), pepper (c), and potato (d) plants at 21dpi.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.