SGK2 mediates apoptosis in herpes simplex keratitis by suppressing protective autophagy via the mTOR pathway

Abstract

Background

Herpes simplex virus type 1 (HSV-1) is a common human pathogen of herpes simplex keratitis (HSK), one of the leading causes of infectious blindness worldwide. Antiviral therapies remain limited by their dependence on active viral replication and rising drug resistance. This study aimed to explore the role of serum and glucocorticoid-regulated kinase 2 (SGK2) in regulating apoptosis and autophagy in HSV-1 infected corneal epithelial cells (CECs).

Methods

Human corneal epithelial cells (HCECs) and mouse corneas were infected with HSV-1 to evaluate HSV-1 replication and apoptosis. RNA sequencing of uninfected and HSV-1 infected HCECs was performed to identify differentially expressed genes associated with infection. SGK2 expression was assessed in vitro and in vivo via RT-qPCR, western blot, and immunofluorescence staining. SGK2 was pharmacologically inhibited with GSK 650,394, and genetically knocked down using shRNA, and autophagy was activated with rapamycin (RAPA). The regulatory roles of the SGK2/TSC2/mTOR pathway in apoptosis and autophagy were investigated using western blot, immunofluorescence staining, flow cytometry, and in cell western assay.

Results

HSV-1 infection significantly increased apoptosis and SGK2 expression in HCECs and mice CECs. Moreover, upregulation of SGK2 activated the mTOR pathway by promoting TSC2 protein degradation, thereby suppressing protective autophagy, enhancing apoptosis, and promoting HSV-1 replication. Treatment with the SGK2 inhibitor GSK 650,394 or shRNA-mediated SGK2 knockdown markedly attenuated these effects. Furthermore, the activation of autophagy with RAPA effectively suppressed HSV-1 induced apoptosis.

Conclusions

These findings indicate that HSV-1 modulates host autophagy via the SGK2/TSC2/mTOR signaling axis to induce apoptosis in CECs, suggesting SGK2 as a potential molecular target for HSV-1 therapy.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12985-026-03131-3.

Introduction

Herpes Simplex Keratitis (HSK), an ocular infection caused by Herpes Simplex Virus type 1 (HSV-1), represents a leading cause of infectious blindness worldwide [1, 2]. HSV-1 is a neurotropic double-stranded DNA virus with a global seroprevalence ranging from 50% to 80% in the adult population [3, 4]. In 2020, the global annual incidence of HSK was estimated at 24 cases per 100,000 population, affecting approximately 1.7 million individuals [5]. One important feature of HSK is its recurrent episodes which has the potential to lead to permanent corneal damage. Clinically, HSK is classified into three distinct subtypes: epithelial, stromal, and endothelial keratitis. Among these, epithelial keratitis is the most common subtype and exhibits the highest recurrence rate [6]. Current therapeutic approaches for HSK primarily rely on antiviral agents combined with corticosteroids to control inflammation [7]. However, these therapies show limited efficacy and prolonged administration may lead to drug resistance and severe ocular complications [8]. Therefore, there is an urgent need to identify novel and more effective therapeutic targets.

In our transcriptomic sequencing and differential gene expression analysis, we observed a significant upregulation of serum and glucocorticoid-regulated kinase 2 (SGK2) in HSV-1 infected human corneal epithelial cells (HCECs). SGK2 is a member of the SGK family within the AGC kinase superfamily, which comprises three isoforms: SGK1, SGK2, and SGK3. These isoenzymes share similar biochemical properties and structural features, exhibiting approximately 80% homology in their kinase domains and 44–68% homology in their noncatalytic C-terminal domains [9]. Members of the SGK family are involved in regulating various physiological processes, including ion transport, cellular metabolism, and hormone signaling [10]. Notably, SGK1 mRNA and protein levels are rapidly induced by corticosteroids, mitogenic signals, and cellular stress in a cell type and stimulus-dependent manner, whereas SGK2, which is expressed primarily in the liver, kidney and pancreas, is not subject to the same regulatory stimuli [11]. Previous research has reported that in macrophages, SGK1 and SGK3 play critical roles in STING-TBK1-IRF3 signaling and type I interferon production in response to HSV-1, while SGK2 expression is undetectable and cannot be induced by STING agonists, indicating that the regulation of SGK proteins by HSV-1 is highly cell type dependent [12]. Currently, most studies on SGK proteins have focused on SGK1 and SGK3, and our previous work reported that HSV-1 induced SGK1 up-regulation promoted viral replication and induced apoptosis through activation of the PI3K/SGK1/Wnt signaling pathway [13]. However, the role of SGK2 in corneal epithelial cells, particularly in the context of HSV-1 infection, remains largely unexplored.

The corneal epithelium, as the outermost barrier of the cornea, plays a crucial role in defending against HSV-1 infection. HSV-1 infection of CECs triggers extensive apoptosis, which compromises epithelial integrity and facilitates viral penetration into deeper corneal layers [14, 15]. Meanwhile, CECs employ autophagy as an intrinsic defense mechanism to degrade viral particles and limit viral replication. Thus, maintaining a balance between apoptosis and protective autophagy is essential for cell survival during HSV-1 infection [16, 17]. However, the precise molecular mechanisms by which HSV-1 regulates cell death and autophagy in CECs remain controversial.

The mammalian target of rapamycin (mTOR) functions as a central regulator of cellular homeostasis by integrating multiple upstream signaling pathways, including PI3K/AKT, TSC1/TSC2/Rheb, LKB1-AMPK, and VAM6/Rag GTPase pathways. Through these networks, mTOR controls downstream transcriptional and translational processes, thereby influencing autophagy, apoptosis, and cell proliferation [18, 19]. As a key component of cell growth signaling and protein synthesis, inhibition of mTOR activity is known to induce autophagy [20]. Previous studies have reported that HSV-1 can activate mTOR through viral infection-related inhibitory proteins to evade autophagic degradation [21]. Furthermore, SGK1 and SGK3 have been shown to stimulate mTOR activity by phosphorylating TSC2 [22, 23], but it remains unclear whether and how SGK2 participates in these processes.

In this study, we demonstrated that SGK2 regulated apoptosis and autophagy in HSV-1 infected CECs through the TSC2/mTOR pathway, suggesting SGK2 as a potential therapeutic target for HSK.

Materials and methods

Cell culture, virus and treatment

The HCECs (ATCC, USA) were cultured in DMEM/F12 (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA) at 37 °C in a 5% CO₂ humidified incubator. The HSV-1 F strain was kindly provided by the Center for Public Health Research, Nanjing University Medical School. The virus was propagated in Vero cells, and viral titers were determined by plaque assay.

When the HCECs reached 60–80% confluence, they were divided into the following groups and cultured for 24 h: normal control (CON), virus group infected with HSV-1 at a multiplicity of infection (MOI) of 0.5 based on our previous study [24], and intervention groups treated with GSK 650,394 (Selleck, China) and RAPA (Selleck, China). For GSK 650,394 and RAPA treatment, GSK 650,394 was applied at concentrations of 5, 10, 15, and 20 µM and RAPA at 20 nM, both dissolved in dimethyl sulfoxide (DMSO; Sigma, China) with a final concentration of 0.1% (v/v).

Cell transfection

Cells were seeded in 6-well plates and transfected at 60–80% confluence with Lipofectamine 3000 (Thermo Fisher Scientific, China) following the manufacturer’s instructions. Three distinct shRNA sequences targeting human SGK2 and a scrambled negative-control construct (shNC) were designed and synthesized by GenePharma (Shanghai, China). The specific shRNA sequences are listed in Table 1.

Table 1.

Oligonucleotide sequences

Name	sequences (5′→3′)
shSGK2-1	AGCAGACTTTCTTGAGATTAA
shSGK2-2	TGCACTCCCTCAACATCATTT
shSGK2-3	CTTCTACAGCCAAGATGTATC
shNC	GTTCTCCGAACGTGTCACGT

Animals

Six-week-old male C57BL/6 mice were purchased from Nanjing Hui Mao Xin Biotechnology Co., Ltd (Nanjing, China). All mice were housed under specific pathogen-free (SPF) conditions with a 12-hour light/dark cycle and free access to food and water. Animal experiments were approved by the Institutional Animal Care and Use Committee of Jinling Hospital and conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

HSK mice model and treatment

The HSK mice model was established as described in our previous articles [13]. To evaluate the therapeutic efficacy in vivo, mice were randomly divided into groups: NC group, HSK group, GSK 650,394 (10 µM), RAPA group (200 nM) and DMSO group (0.1%). All treatments were initiated immediately after infection and continued for 7 days. On 7 day post-infection (dpi), corneal lesions were examined and scored under a dissection microscope (Carl Zeiss, Germany). HSK score for corneal opacity and the fluorescein staining score for cornea were consistent with our previous articles. Mice were then euthanized, and corneal tissues were collected for subsequent analysis.

High-throughput RNA sequencing (RNA-Seq)

Total RNA was extracted from HCECs with or without HSV-1 infection for 24 h post-infection (hpi) using TRIzol reagent (Sangon Biotech, China). The RNA concentration and purity were measured using a Nanodrop 1000 spectrophotometer (Thermo Scientific, USA), with OD260/280 ratios ranging between 1.8 and 2.1. Library construction and sequencing were performed by LC Bio Technology (LC Bio Technology, China). The obtained sequencing data (Clean Data) were subjected to sequence alignment, gene expression quantification, GSEA, gene differential analysis and enrichment analysis.

Quantitative real-time polymerase chain reaction (RT-qPCR)

Total RNA was extracted from HCECs using the TRIzol method as previously described. A total of 1 µg of RNA was reverse transcribed into cDNA using the Evo M-MLV RT Mix Kit (Accurate Biology, China). Subsequently, qPCR was performed using AceQ qPCR SYBR Green Master Mix (Vazyme Biotech, China) on the ABI 7500 Real-Time PCR System (Thermo Fisher, USA). GAPDH was used as the reference gene, and the relative mRNA expression levels were calculated using the 2^(-ΔΔCt) method. The sequences of the primers used are listed in Table 2.

Table 3.

Information of antibodies

Name	Catalog Number	Source	Manufacturer	Country	Applications
SGK2	11185-1-AP	Rabbit	Proteintech	CN	WB, IF
TSC2	24601-1-AP	Rabbit	Proteintech	CN	WB, IF
p-TSC2	29000-1-AP	Rabbit	Proteintech	CN	WB
mTOR	66888-1-Ig	Mouse	Proteintech	CN	WB
p-mTOR	67778-1-Ig	Mouse	Proteintech	CN	WB
p62	23,214 S	Rabbit	CST	USA	WB, IF
ICP0	sc-53,070	Mouse	Santa Cruz	USA	WB
ICP4	sc-69,809	Mouse	Santa Cruz	USA	WB
HSV-1-gD	sc-21,719	Mouse	Santa Cruz	USA	WB, IF
BAX	60267-1-Ig	Mouse	Proteintech	CN	WB
Bcl-2	26593-1-AP	Rabbit	Proteintech	CN	WB
LC3A/B	12741D	Rabbit	CST	USA	WB
GAPDH	10494-1-AP	Rabbit	Proteintech	CN	WB
HRP-conjugated anti-rabbit	SA00001-2	Goat Anti-Rabbit	Proteintech	CN	WB
HRP-conjugated anti-mouse	SA00001-1	Goat Anti-Mouse	Proteintech	CN	WB
CoraLite594-conjugated	SA00013-4	Goat Anti-Rabbit	Proteintech	CN	IF
CoraLite488-conjugated	SA00013-2	Goat Anti-Mouse	Proteintech	CN	IF

Table 2.

List of primer sequences for RT-qPCR

Genes	Primer sequences (5′→3′)
SGK2(human)	F: TTCGGTTCCAACTGCTGGTT
	R: AGAACGCCCCATCAGACTTG
GAPDH(human)	F: GGAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATGG
Sgk2(mouse)	F: CCATCAGCCAACCCAAATGC R: GCCATGATGTGGTTCTCTTTGTT
Gapdh (mouse)	F: TGATGACATCAAGAAGGTGGTGAAG R: TCCTTGGAGGCCATGTGGGCCAT

Western blot (WB)

The total protein concentration was quantified using the BCA method. Equal amounts of protein were separated by 8–12% polyacrylamide gel (Beyotime, China) and transferred onto polyvinylidene difluoride (PVDF) membranes (Merck, Germany). After blocking with 5% non-fat milk for 1 h, membranes were incubated overnight at 4 °C with the primary antibodies. Following washing with Tris-Buffered Saline with Tween 20 (TBST), membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. The protein bands were visualized using an UltraSignal ECL Western blot Detection Reagent and images were captured with a Gel imaging system. Protein expression was quantified using ImageJ software (National Institutes of Health, USA), and the relative protein expression levels were normalized to GAPDH. The antibodies used in this study are summarized in Table 3.

Flow cytometry analysis

Apoptosis was assessed using an Annexin V-FITC/PI apoptosis detection kit (Vazyme Biotech, China). The cells were detached with trypsin, washed with cold PBS, and resuspended in binding buffer. Annexin V-FITC and propidium iodide (PI) were added, and the mixture was incubated in the dark for 15 min at room temperature. The samples were analyzed using a flow cytometer (BriCyte E6, Mindray, China), equipped with a 488 nm laser and two fluorescence detectors. Fluorescence signals were detected using the FL1 channel (FITC, 530/30 nm) for Annexin V and the FL2 channel (585/42 nm) for PI. Compensation was performed automatically using single-stained controls prior to data acquisition, and the percentage of apoptotic cells was quantified using FlowJo software version 10.0 (FlowJo, USA).

TUNEL staining

Cell apoptosis was further examined using a TUNEL apoptosis detection kit (Vazyme Biotech, China) according to the manufacturer’s instructions. The staining results were observed and imaged using a laser confocal microscope (LSM 980, Carl Zeiss, Germany).

Immunofluorescence staining

HCECs were fixed with 4% paraformaldehyde, while the paraffin sections were deparaffinized and subjected to antigen retrieval. Subsequently, cells and tissue sections were permeabilized with 0.5% Triton X-100 (Solarbio, China) and blocked with 5% bovine serum albumin (BSA). Samples were incubated overnight at 4 °C with primary antibodies, followed by incubation with corresponding fluorescently labeled secondary antibodies for 1 h at room temperature in the dark. Nuclei were counterstained with DAPI (Beyotime, China). Fluorescent images were captured using a laser confocal microscope (LSM 980, Carl Zeiss, Germany).

Hematoxylin and eosin (H&E) staining

The mice eyeballs were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 4 μm intervals. Sections were stained using an H&E staining kit (Servicebio, China), and histological changes were observed and photographed under a light microscope (BX53, Olympus, Japan).

In cell western assay

HCECs were seeded in 96-well plates and fixed with 4% paraformaldehyde, permeabilized with Triton X-100, and blocked with 5% BSA. Cells were incubated overnight at 4 °C with an anti-HSV-1-gD primary antibody (1:200), followed by incubation with a DYLight 800-conjugated secondary antibody (1:1000) and DRAQ5 nuclear dye (1:10000) at room temperature for 1 h in the dark. Fluorescence signals were detected and quantified using an Odyssey infrared imaging system (LI-COR, USA).

Transmission electron microscopy (TEM)

TEM was performed to evaluate the morphological structure of HCECs with different treatments. Briefly, treated HCECs were digested and fixed in an electron microscopy-grade fixative (Electron Microscopy Sciences, USA). The samples were then washed three times with PBS (pH 7.4) via centrifugation, dehydrated through a graded ethanol series, embedded, and double-stained with uranyl acetate and lead citrate. Finally, ultrastructural images of the HCECs were captured using a transmission electron microscope (HT7800, Hitachi, Japan).

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8.0 software (GraphPad, USA). Comparisons between two groups were analyzed using Student’s t-test, while comparisons among multiple groups were conducted using one-way analysis of variance (ANOVA). All experimental data are presented as the mean ± standard deviation (SD) from at least three independent experiments. P < 0.05 was considered statistically significant.

Results

HSV-1 infection promotes apoptosis in CECs both in vivo and in vitro

HCECs were infected with HSV-1 at MOI = 0.5 for 24 hpi, as this condition achieved effective viral infection while minimizing excessive apoptosis based on our previous study [24]. Microscopic images revealed that, compared to the control group, HSV-1 infection exhibited numerous syncytia along with a significant reduction in cell density (Fig. 1A). Western blot was used to evaluate the expression of HSV-1 replication related proteins. The protein levels of ICP0, ICP4 and HSV-1-gD were exclusively expressed in the HSV-1 infected group. Furthermore, HSV-1 infection elevated the expression of pro-apoptotic protein BAX while decreasing anti-apoptotic protein Bcl-2 (Fig. 1B and C), suggesting a shift toward a pro-apoptotic state in infected cells. Consistently, flow cytometry and TUNEL staining revealed that HSV-1 infection markedly increased the proportion of apoptotic cells in HCECs (Fig. 1D, E, and F), further confirming that HSV-1 infection promotes apoptosis in HCECs.

Fig. 1.

HSV-1 infection promotes apoptosis in CECs both in vivo and in vitro. (A-F) HCECs were infected by HSV-1 (MOI = 0.5) for 24 hpi. (A) Representative microscopic images showing morphological changes of HCECs in the control (CON) and HSV-1 infected groups. Bars = 20 μm. (B) Representative western blot showing the expression of viral proteins (ICP4, ICP0, HSV-1-gD) and apoptosis-related proteins (Bcl-2 and Bax). (C) Statistical chart of B (n = 3). (D) Flow cytometry analysis of apoptosis detected by Annexin V-FITC/PI staining. (E) Statistical chart of D (n = 3). (F) TUNEL staining (red) and DAPI (blue) of HCECs. Bars = 50 μm. (G) Representative images of mice anterior segment and fluorescein staining taken on 7 dpi. (H) Statistical chart of HSK scores (n = 3). (I) TUNEL staining (red) and DAPI (blue) of mice corneal sections. Bars = 50 μm. *P < 0.05, **P < 0.01 and ****P < 0.0001 versus the CON group

To further determine the effect of HSV-1 infection on the corneal epithelium in vivo, we established an HSK mouse model. Fluorescein sodium staining showed obvious corneal fluorescence and structural disorganization in HSK mice at 7 dpi (Fig. 1G and H). Additionally, TUNEL staining of corneal tissues showed a notable increase in apoptotic CECs in HSK mice (Fig. 1I).

In conclusion, HSV-1 infection can promote apoptosis in CECs both in vivo and in vitro.

SGK2 expression is upregulated in HSV-1 infected CECs and corneal tissues

In order to systematically screen the key molecules regulating the apoptosis of CECs induced by HSV-1 infection, we first conducted transcriptome sequencing on normal uninfected HCECs and HSV-1 infected HCECs for 24 hpi. Among the differentially expressed genes, 2947 were upregulated and 2130 were downregulated. The volcano plots and heatmap illustrated distinct differential gene expression profiles associated with HSV-1 infection, with SGK2 showing a marked upregulation in the infected group (Fig. 2A and B). Gene Ontology (GO) enrichment analysis demonstrated that the differentially expressed genes were primarily involved in cell cycle regulation, apoptotic process and autophagy (Fig. 2C). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis further revealed associations with autophagy and mTOR signaling pathway (Fig. 2D). Since SGK2 was significantly upregulated in HSV-1 infected HCECs, we selected SGK2 for subsequent experiments.

Fig. 2.

SGK2 expression is upregulated in HSV-1–infected CECs and corneal tissues. (A) Volcano plot of transcriptome sequencing data. Red, increased expression; blue, decreased expression; grey. non-significant changes. (B) Heatmap of DEGs between control and HSV-1 infected HCECs. Red indicates upregulation and blue indicates downregulation. (C) Bar chart of GO enrichment analysis. (D) Bar chart of KEGG pathway enrichment analysis. (E) Relative mRNA expression level of SGK2 in HCECs (n = 3). (F) Relative SGK2 mRNA expression in mice cornea (n = 3). (G) Representative western blot showing SGK2 protein expression in HCECs. (H) Statistical chart of G (n = 3). (I) Representative immunofluorescence images showing SGK2 (red), HSV-1-gD (green), and DAPI (blue) staining in HCECs after HSV-1 infection. Bars = 100 μm. (J) Immunofluorescence staining of SGK2 (red), HSV-1-gD (green), and DAPI (blue) in corneal tissues from control and HSK mice. Bars = 100 μm. **P < 0.01 and ***P < 0.001 versus the CON group

To validate the accuracy of the transcriptomic sequencing data, we examined SGK2 expression in HSV-1 infected HCECs and corneal tissues from HSK mice. RT-qPCR results showed a significant upregulation of SGK2 mRNA levels in both models (Fig. 2E and F). Consistently, western blot and immunofluorescence analysis revealed increased SGK2 protein expression in HSV-1 infected cells and corneal tissues (Fig. 2G-J).

These results indicate that SGK2 expression is positively correlated with corneal HSV-1 infection, suggesting that SGK2 may be involved in the progression of HSV-1 infected CECs.

Inhibition of SGK2 suppresses HSV-1 replication and apoptosis induced by HSV-1 infection in CECs

To investigate the effect of SGK2 upregulation on HSV-1 infection, we employed the SGK2 inhibitor GSK 650,394. The cells were pretreated with 5, 10, 15, and 20 µM GSK 650,394 for 3 h, followed by HSV-1 infection (MOI = 0.5) for 24 h. Western blot results demonstrated that GSK 650,394 significantly suppressed SGK2 expression in HSV-1 infected HCECs at concentrations of 10, 15, and 20 µM (Fig. 3A and B). Therefore, we selected the lowest effective concentration of GSK 650,394 (10 µM) for subsequent cellular experiments. Furthermore, compared to the HSV-1 infected and DMSO groups, the protein levels of viral-associated proteins ICP4, ICP0, and HSV-1-gD were significantly reduced in the GSK 650,394 treated group (Fig. 3C and D). In cell western assay and immunofluorescence staining showed that GSK 650,394 treatment markedly inhibited the expression of HSV-1-gD in HSV-1 infected HCECs (Fig. 3E and F). Furthermore, immunofluorescence staining of SGK2 and HSV-1-gD in mice corneal tissue demonstrated the consistent results (Fig. 3G). Given that GSK 650,394 acts as a pan-SGK inhibitor with non-specific effects on other SGK family members, particularly SGK1 and SGK3, we knocked down SGK2 using shSGK2 transfection. The efficacy of three distinct shSGK2 sequences in knocking down SGK2 was determined using qRT-PCR (Fig. 3H). The most efficient shSGK2 (shSGK2-1) was selected for subsequent experiments. As shown in Fig. 3I and J, transfection with shSGK2 effectively reduced SGK2 expression in HCECs. Consistent with the effectiveness of GSK650394, silencing SGK2 significantly decreased the protein levels of ICP0, ICP4 and HSV-1-gD compared to the shNC group.

Fig. 3.

Inhibition of SGK2 suppresses HSV-1 replication in CECs. (A) Representative western blot analysis of SGK2. (B) Statistical chart of A (n = 3). (C) Representative western blot showing the expression of SGK2 and viral proteins ICP4, ICP0, HSV-1-gD. (D) Statistical chart of C (n = 3). (E) In cell western assay analysis showing HSV-1-gD (green) normalized by DRAQ5 (red). (F-G) Representative immunofluorescence staining of SGK2 (red), HSV-1-gD (green), and DAPI (blue). Bars = 100 μm. (H) Relative mRNA levels of SGK2 (n = 3). (I) Western blot analyses evaluating the expression of SGK2 and viral proteins ICP4, ICP0, HSV-1-gD. (J) Statistical chart of I (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 and ns P > 0.05

To further evaluate the effect of SGK2 upregulation on apoptosis in HSV-1 infected CECs, we conducted western blot and flow cytometry. GSK 650,394 treatment effectively reversed the increase in BAX and decrease in Bcl-2 induced by HSV-1 infection (Fig. 4A and B). Flow cytometry revealed a significant decrease in the proportion of apoptotic cells in the GSK 650,394 group (Fig. 4C and D). In addition, compared with the HSV-1 infected and DMSO groups, treatment with GSK 650,394 markedly reduced corneal fluorescence intensity and alleviated epithelial damage in HSK mice (Fig. 4E and F). Consistently, TUNEL staining showed a decrease in apoptotic cells in the corneal tissues of the GSK 650,394 group (Fig. 4G).

Fig. 4.

SGK2 inhibition suppresses apoptosis induced by HSV-1 infection in CECs. (A) Representative western blot analysis of BAX and Bcl-2. (B) Statistical chart of A (n = 3). (C) Flow cytometry detected the apoptosis of HCECs. (D) Statistical chart of C (n = 3). (E) Representative images of mice corneal fluorescein sodium staining. (F) Statistical chart of HSK scores (n = 3). (G) TUNEL staining (red) and DAPI (blue) of mice corneal sections. Bars = 50 μm. *P < 0.05, **P < 0.01, ***P < 0.001 and ns P > 0.05

Collectively, inhibition of SGK2 can suppress HSV-1 replication and apoptosis in HSV-1 infected CECs both in vivo and in vitro.

SGK2 inhibits autophagy through the mTOR pathway

To investigate whether SGK2 regulates autophagy in HSV-1 infection, we examined the influence of GSK 650,394 on autophagy-related markers in HCECs. Compared with the HSV-1 infected and the DMSO groups, GSK 650,394 treatment showed a decrease in p62 protein expression together with an increase in the ratio of LC3-II to LC3-I (Fig. 5A, B, and C).

Fig. 5.

SGK2 inhibits autophagy through the mTOR pathway. (A) Representative western blot analysis of autophagy-related proteins p62 and LC3I/II. (B-C) Statistical chart of A (n = 3). (D) Representative western blot analysis of SGK2, TSC2, p-TSC2, mTOR, and p-mTOR. (E) Statistical chart of D (n = 3). (F-G) Representative immunofluorescence images of TSC2 (red), HSV-1-gD (green), and DAPI (blue). Bars = 100 μm. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 and ns P > 0.05

To identify how SGK2 blocks autophagy in CECs, we examined expression of mTOR at 24 hpi, as mTOR is known to serve as a negative regulator of autophagy [20]. Western blot analysis revealed that both total mTOR expression and mTOR phosphorylation at Ser2448 were significantly upregulated in HSV-1-infected CECs, accompanied by an elevated p-mTOR/mTOR ratio, which coincided with suppressed autophagy. Conversely, GSK650394 treatment inhibited both total mTOR expression and mTOR phosphorylation at Ser2448, and significantly reduced the p-mTOR/mTOR ratio (Fig. 5D and E).

TSC2 is a key inhibitor of mTORC1 that directly regulates the mTOR pathway [25]. To further explore the relationship between SGK2 and mTOR, western blot and immunofluorescence staining were used to detect TSC2 expression. There was a decrease in TSC2 along with an increase in p-TSC2 in CECs infected with HSV-1 both in vivo and in vitro, whereas GSK 650,394 treatment upregulated TSC2 expression and reduced p-TSC2 levels (Fig. 5D and E). Immunofluorescence staining result of TSC2 protein level was consistent with that of western blot (Fig. 5F and G).

These results indicate that SGK2 promotes TSC2 phosphorylation and degradation, thereby activating the mTOR pathway and suppressing autophagy during HSV-1 infection.

Activation of autophagy inhibits apoptosis during HSV-1 infection in CECs

To elucidate the role of autophagy in HSV-1 infection, we used the mTOR pathway inhibitor RAPA to block mTOR activity. RAPA treatment significantly reduced p62 protein level and increased the ratio of LC3-II to LC3-I (Fig. 6A and B). Additionally, TEM revealed a significant increase in the number of autophagosomes in the RAPA group compared with those in the HSV-1 infection and DMSO group (Fig. 6C). Immunofluorescence staining results were consistent with the western blot, showing significantly decrease in p62 protein level in the RAPA group (Fig. 6D and E). Concurrently, in cell western assay revealed that RAPA treatment markedly suppressed HSV-1-gD expression in HSV-1 infected HCECs (Fig. 6F). Furthermore, it also increased the expression of anti-apoptotic protein Bcl-2 and reduced the pro-apoptotic protein BAX in HSV-1 infected CECs (Fig. 6G and H).

Fig. 6.

Activation of autophagy inhibits apoptosis during HSV-1 infection in CECs. (A) Representative western blot analysis of autophagy-related proteins p62 and LC3-I /II. (B) Statistical chart of A (n = 3). (C) Representative TEM images of HCECs showing autophagosomes (red arrows). Bars = 2 μm and 1 μm. (D-E) Representative immunofluorescence images of p62 (red), HSV-1-gD (green), and DAPI (blue). Bars = 100 μm. (F) In cell western assay analysis showing HSV-1-gD (green) normalized by DRAQ5 (red). (G) Representative western blot analysis of apoptosis-related proteins Bcl-2 and BAX. (H) Statistical chart of G (n = 3). *P < 0.05, **P < 0.01, ****P < 0.0001 and ns P > 0.05

Consequently, RAPA activates autophagy through the mTOR pathway and inhibits apoptosis caused by HSV-1 infection in CECs.

Discussion

This study focused on the role of SGK2 during HSV-1 infection, and found that HSV-1 markedly induced SGK2 expression in CECs, accompanied by increased apoptosis. Pharmacological inhibition of SGK2 using GSK 650,394 and genetic knockdown using shRNA both effectively suppressed both virus-induced apoptosis and HSV-1 replication in vitro and in vivo. Furthermore, SGK2 phosphorylated TSC2 and promoted its degradation, thereby relieving its inhibitory effect on mTOR, which in turn suppressed protective autophagy in host cells. This suppression of autophagy led to enhanced apoptosis and viral replication. Collectively, these findings suggest that SGK2 exacerbates HSV-1 induced cellular damage by modulating the TSC2/mTOR axis, highlighting SGK2 as a potential therapeutic target for HSK.

As key mediators of cell survival and proliferation, members of the SGK family have been increasingly recognized for their important roles in regulating viral infections [26]. Previous studies have reported that treatment with the SGK inhibitor GSK 650,394 interfered with the replication of several herpesviruses in Vero cells [11]. Moreover, our previous research confirmed that the expression of SGK1 was upregulated in HSV-1 infected CECs and GSK 650,394 effectively suppressed viral replication [13]. However, GSK 650,394 is a broad-spectrum inhibitor that targets all three SGK isoforms. In the present study, we confirmed that the SGK2 isoform was markedly upregulated at both mRNA and protein levels in HSV-1 infected CECs in vitro and in vivo, which further highlighted the significant effect of SGK family during virus infection.

Previous studies showed that the overexpression of SGK exerted a protective effect on cell survival, likely through the activation of associated signaling pathways such as the SEK/JNK pathway or FOXO3a phosphorylation [27, 28]. The protective effect of SGK2 has been demonstrated to be involved in the progression of multiple myeloma, prostate cancer, bladder cancer [29–31]. Interestingly, other researches reported that SGK1 overexpression in the nervous system markedly induced neuronal apoptosis, whereas SGK1 siRNA reversed this situation [32]. This discrepancy may arise from differences in cell type or cellular context. In this study, we found that upregulation of SGK2 promoted HSV-1 induced apoptosis, whereas GSK 650,394 effectively reversed this effect. However, the precise molecular mechanism underlying this process remains to be elucidated.

Autophagy is an evolutionarily conserved catabolic process in which cytoplasmic proteins and organelles are sequestered within double-membrane vesicles known as autophagosomes and subsequently delivered to lysosomes for degradation [33]. The resulting macromolecular precursors can then be recycled or utilized as energy substrates for cellular metabolism [34]. It was reported that autophagy limited the pathogenicity of HSV-1 through multiple mechanisms, including direct degradation of viral components (xenophagy) and activation of antiviral immune responses [35, 36]. However, HSV-1 has evolved several strategies to counteract host autophagic defenses. The viral genes ICP34.5 and ICP0 are both implicated in autophagy inhibition [21]. ICP34.5 suppresses autophagy by directly binding to Beclin-1 or by modulating pathways such as PKR/eIF2 [37], while ICP0 promotes the degradation of key autophagy adaptor proteins, including p62/SQSTM1 and OPTN, thereby disrupting autophagic flux [38]. In addition, a recent study revealed that the HSV-1 serine/threonine kinase Us3 may inhibit autophagy via phosphorylation and activation of mTORC1 [39]. In this research, HSV-1 infection of CECs suppressed autophagy, and the KEGG analysis indicated that SGK2 was associated with both autophagy and the mTOR pathway in infected cells. mTOR kinase, a negative regulator of autophagy, functions within two distinct complexes, mTORC1 and mTORC2. Among them, mTORC1 plays an important role in regulating protein synthesis, nutrient sensing, and autophagy. The TSC1/TSC2 heterodimer, upstream of mTORC1, acts as an inhibitory complex. Normally, TSC2 suppresses mTORC1 activation through its GAP activity by inactivating the small GTPase Rheb, thereby maintaining basal autophagy levels [40]. Previous evidence suggested that activation of SGK kinases can promote mTORC1 signaling by phosphorylating and inhibiting TSC2 [28]. For instance, SGK1 modulated cardiomyocyte growth through the TSC2/mTOR axis [22], whereas SGK3 overexpression in epithelial cells enhanced TSC2 phosphorylation, mTORC1 activation, and cellular proliferation [23]. However, the role of SGK2 in upstream feedback regulation of the TSC2/mTOR pathway remained unclear. In this study, we found that SGK2 activation during HSV-1 infection promoted TSC2 phosphorylation and reduced its expression, promoted mTOR activation, and reduced autophagy levels in CECs, suggesting that SGK2 may act as a negative regulator of autophagy through modulation of the mTOR signaling pathway.

An increasing number of studies have demonstrated that the complex interaction between autophagy and apoptosis varies depending on the cell type and the stimulating factor [41]. A recent study found that the inhibition of SGK2, as a novel autophagy regulator, blocked platinum (PT)-induced autophagy in epithelial ovarian cancer cells, thereby increasing cell death [42]. In our previous work, we discovered that the interaction between autophagy and apoptosis was related to HSV-1 infection, and HSV-1 inhibited autophagy through reactive oxygen species (ROS) accumulation to promote apoptosis [24]. We confirmed that the upregulation of SGK2 activated the mTOR pathway, reduced autophagy, and markedly increased both HSV-1 induced apoptosis and viral replication. Conversely, activation of autophagy by RAPA reversed these effects. These findings suggest that SGK2 serves as a crucial regulatory point for autophagy and apoptosis during HSV-1 infection. There are several limitations in our study. We primarily focused on the role of SGK2 in suppressing protective autophagy through phosphorylation and degradation of TSC2, and whether SGK2 regulates autophagy through other pathways remains to be explored. Previous studies have reported that TRIM29 promotes HSV-1 infection by negatively regulating STING-mediated type I interferon responses and enhances PERK-mediated apoptosis, and whether SGK2 partly contributes to HSK pathogenesis through upregulation of TRIM29 expression warrants experimental validation in future studies [43, 44]. Furthermore, we only studied the functional role of SGK2 in HSV-1-infected CECs, and the upstream regulatory mechanism governing HSV-1-induced SGK2 upregulation remains to be elucidated. Given that different herpesvirus strains and the pathological mechanisms of HSK may vary, future investigations are warranted to elucidate the broader role of SGK2 in other herpesvirus infections. Therapeutically, topical application of SGK2 inhibitors may represent a promising strategy to promote autophagy and reduce viral replication in corneal epithelial cells. However, the effects on other ocular surface cell types, such as corneal stromal cells, endothelial cells, and conjunctival cells, warrant further investigation before clinical translation.

Conclusions

Taken together, our study revealed a critical regulatory role of SGK2 kinase in modulating the balance between CECs autophagy and apoptosis during HSV-1 infection. SGK2 expression was markedly upregulated following HSV-1 infection, leading to suppression of protective autophagy through activation of the mTOR pathway, which in turn exacerbated HSV-1 induced cellular damage. These findings provide new insights into the molecular mechanisms underlying HSK and identify SGK2 as a promising therapeutic target for the treatment of HSK.

Author contributions

SL, YW and XK conceived the study. SL, YW, YY and QW performed experiments. FJ and WY contributed to methodology and data analysis. SL, XK and WY edited the manuscript. All authors read and approved the final manuscript for submission.

Funding

This work was supported by the Special Fund for Clinical Research of Nanjing Drum Tower Hospital (2024-LCYJ-MS-26).

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The animal study protocol was approved by the Institutional Review Board of Nanjing Jinling Hospital (2023JLHGZRDWLS-000160, 9th, March, 2023).

Consent for publication

All authors approved the final manuscript and consented to its submission.

Competing interests

The authors declare no competing interests.