TCF4 contributes to OA progression by regulating the transcription of LOXL1

Highlights

LOXL1 is highly expressed in tissues and cells of OA.

Silencing LOXL1 mitigates IL-1β-induced chondrocyte damage and MIA-induced joint pathology in mice.

TCF4 stimulates the transcription of LOXL1.

LOXL1 abrogates the impacts of TCF4 deletion in chondrocytes induced by IL-1β.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12950-026-00494-w.

Background

Osteoarthritis (OA) is a chronic degenerative joint disease that seriously affects patients’ quality of life. Lysyl oxidase like 1 (LOXL1), a member of the lysyl oxidase protein family, whose role in OA is unknown.

Methods

The gene expression pattern was investigated by the Gene Expression Omnibus database. Quantitative real-time PCR (qRT-PCR) and western blot were used to detect the gene expression in tissues and cells. Interleukin-1β (IL-1β) was applied to induce an inflammatory chondrocyte injury model in vitro, mimicking certain aspects of OA pathology, and the cell viability was measured by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT) assay. 5-Ethynyl-2’-deoxyuridine (EdU) staining, flow cytometry, and enzyme linked immunosorbent assay (ELISA) assays were utilized for function examination. In addition, the monoiodoacetate (MIA)-induced arthritis mouse models were constructed to evaluate the effects of LOXL1 in vivo, and the hematoxylin-eosin (H&E) staining, safranin-O/fast green (SOFG) staining, and immunohistochemistry (IHC) were used to estimate the histological and morphological changes of the knee joints obtained from the mice. The transcriptional binding between genes was verified by chromatin immunoprecipitation (ChIP) and dual luciferase reporter assay.

Results

LOXL1 was up-regulated in tissues of OA. The down-regulation of LOXL1 promoted cell proliferation and inhibited apoptosis, inflammation, oxidative stress, and extracellular matrix (ECM) degradation in vitro. Meanwhile, LOXL1 knockdown exhibited the same results in vivo. Mechanically, transcription factor 4 (TCF4) activated the transcription of LOXL1, and TCF4 deficiency-mediated effects on chondrocyte injury were weakened by LOXL1.

Conclusion

In summary, TCF4 may contribute to OA pathology by activating LOXL1 transcription, and the TCF4/LOXL1 axis is involved in IL-1β-induced chondrocyte dysfunction and MIA-induced joint degeneration.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12950-026-00494-w.

Introduction

As an inflammatory disease characterized by joint pain, stiffness, and deformity, the burden of osteoarthritis (OA) continues to escalate globally [1], affecting up to 50% of people over 65 years old, which is the vital cause of disability affecting people over the age of 70 [2]. The pathogenesis of OA is diverse [3]. Still, it is most important to understand the key pathological mechanisms and explore new therapeutic targets to develop new options for improving OA symptoms and treatment.

The lysyl oxidase like (LOXL) family belongs to the copper-dependent amine oxidase family, first discovered in mammals and yeast [4]. The LOXL family consists of 5 paralogues, LOX and LOXL1-4, which can stimulate the cross-linking of collagen and elastin in the extracellular matrix (ECM) [5, 6]. Earlier studies of LOXL1 focused on exfoliation syndrome and glaucoma [7–9], but in recent years, it has been studied more extensively. The pan-cancer analysis found that LOXL1 was highly expressed in tumors [10]. Meanwhile, LOXL1 could inhibit the malignant progression of colorectal cancer [11]. Based on the CRISPR-Cas9 technology, it was proved that LOXL1 knockout resulted in enhanced metastatic ability of prostate cancer [12]. In addition, LOXL1 was a crucial player in the occurrence of breast cancer [13].

The pathogenesis of OA is multifactorial, involving a complex interplay between genetic predisposition, mechanical stress, and biochemical signaling that ultimately leads to cartilage degradation, synovitis, and subchondral bone remodeling [14, 15]. A hallmark of OA is the progressive breakdown of the articular cartilage ECM, primarily composed of collagen type Ⅱ and aggrecan [16]. The structural integrity and biomechanical properties of the ECM are critically maintained by enzymatic cross-linking, a process largely mediated by the LOX family of enzymes [17]. Beyond the prototype LOX, the LOXL family members, including LOXL1, catalyze the cross-linking of collagen and elastin fibers, thereby influencing tissue stiffness and tensile strength [18]. In articular cartilage, balanced ECM cross-linking is essential for load-bearing function; however, dysregulated expression of LOX/LOXL proteins has been implicated in altering ECM composition and increasing matrix stiffness, which in turn can disrupt chondrocyte homeostasis and promote a catabolic state. Concurrently, aberrant activation of developmental signaling pathways, notably the Wnt/β-catenin pathway, is a well-established driver of OA progression [19]. In this pathway, stabilized β-catenin translocates to the nucleus and associates with transcription factors of the T-cell factor/lymphoid enhancer factor family, predominantly transcription factor 4 (TCF4) in chondrocytes, to transcribe target genes involved in matrix degradation, inflammation, and inhibition of anabolism [20, 21]. The Wnt/β-catenin/TCF4 axis thus serves as a key regulator of chondrocyte catabolism and ECM breakdown. TCF4 is a classic effector protein of the Wnt/β-catenin pathway [22] and belongs to the nuclear factor component of the T cytokine/lymph enhancer family. It had been confirmed that the Wnt/β-catenin pathway was associated with intestinal inflammation [23], pancreatic inflammation [24], rheumatoid arthritis [25], and other inflammatory diseases. TCF4, as a transcription factor, was related to the progression of many cancers, including melanoma [26], pancreatic cancer [27], and neuroblastoma [28]. Despite the recognized roles of LOX/LOXL in ECM remodeling and Wnt/β-catenin/TCF4 in OA catabolism, a direct regulatory link between TCF4 and specific LOXL family members, particularly LOXL1, in the context of OA pathogenesis remains unexplored.

In this research, IL-1β and monoiodoacetate (MIA)-induced models were used to investigate the potential role and regulatory mechanism of LOXL1 in both in vivo and in vitro, hoping to provide a reference for the diagnosis and prevention of OA.

Materials and methods

Data source and analysis

The GSE169077 dataset contained 5 normal samples (Normal) and 6 OA samples (OA) and the GSE114007 dataset contained 18 normal (Normal) and 20 OA knee cartilage tissues (OA) were from the Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/gds?term). The GEO2R website was utilized to explore the expression pattern in healthy articular (Normal) and OA articular (OA) cartilage tissues received from OA patients subjected to knee replacement surgery in the datasets of GSE169077 and GSE114007.

The JASPAR website (http://jaspar.genereg.net/), an open-access resource of experimentally defined transcription factor binding sites for eukaryotes, was used to predict the binding sites of TCF1 on LOXL1.

Human samples

This study rigorously collected and analyzed clinical sample data: 43 cartilage samples collected from the OA patients with total knee arthroplasty (OA, n = 43) and 43 control samples collected from the amputees with non-OA patients (Normal, n = 43). (1) Age: The mean age in the OA group was 62 ± 7 years; the mean age in the control group was 59 ± 8 years. Statistical analysis revealed no significant difference in age between the two groups (P > 0.05), ruling out potential interference from age on the study results. (2) Gender: In the OA group, there were 18 males and 25 females; while the control group included 19 males and 24 females. No significant difference was found in gender distribution between groups (P > 0.05), ensuring comparability of gender factors. (3) Disease stage and joint location: OA patients were assessed using the Kellgren-Lawrence grading system, with disease stages ranging from Ⅱ to Ⅳ. All joint cartilage samples were collected from the patients’ knees.

Inclusion and exclusion criteria: (1) Inclusion criteria: Patients with OA who voluntarily participated in this study and signed an informed consent form. Control subjects must have no history of OA or other joint diseases, no severe systemic diseases, and be age-matched with the patient group. (2) Exclusion criteria: Individuals with other joint-affecting diseases, such as rheumatoid arthritis, gouty arthritis; those who have undergone intra-articular injections or surgical interventions; patients with severe cardiovascular, hepatic, renal, or other major organ diseases; pregnant or lactating women; and individuals with allergies to medications or reagents potentially used during the study. This study has been reviewed and approved by the Ethics Committee of Suizhou Hospital, Hubei University of Medicine. All sample collection procedures strictly adhered to the principles outlined in the Declaration of Helsinki. Before collection, subjects or their legal representatives were provided with detailed information regarding the study’s purpose, procedures, and potential risks, and written informed consent was obtained.

RNA extraction and detection

After tissue or cell collection, TRIeasy™ Total RNA Extraction Reagent (Yeasen, Shanghai, China) was used for sample cleavage and RNA extraction. The extracted RNA, whose concentration was detected by the NanoDrop One/One^C (Thermo Fisher Scientific, Waltham, MA, USA), was reverted to cDNA following the instructions of the LunaScript^® RT SuperMix Kit (New England Biolabs, Ipswich, MA, USA). Based on the manual of the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China), the gene amplification was performed following the procedure: 95℃, 10 min; 95℃, 15 s, 60℃, 1 min, 40 cycles. The β-actin was used as an internal reference for normalization, and the expression of genes was evaluated by the 2^−ΔΔCt method. The primer sequences used in this study were as follows: TCF4, Forward (5’-3’) GGACGGACAAAGAGCTGAGT, Reverse (5’-3’) GGGCTTGGATGTCCTCCATT; LOXL1, Forward (5’-3’) TGTACCGGCCCAACCAGAAC, Reverse (5’-3’) CCGCACATCGTAGTCGGT; β-actin, Forward (5’-3’) AGGATTCCTATGTGGGCGAC, Reverse (5’-3’) ATAGCACAGCCTGGATAGCAA.

Western blot

The proteins extracted from tissues or cells in line with the instructions of the Minute™ Total Protein Extraction Kit for Animal Cultured Cells/Tissues (Invent Biotechnologies, Beijing, China) were added to the FuturePAGE™ Protein preform glue (ACE Biotechnology, Changzhou, China), and the protein bands with different sizes were separated at 200 V for 1 h using the MOPS-sodium dodecyl sulfate (SDS) Running Buffer (ACE Biotechnology). The proteins were transferred to the polyvinylidene fluoride (PVDF) membrane at 80 V for 2 h and sealed with QuickBlock™ Blocking Buffer (Beyotime, Shanghai, China). After that, the proteins were reacted with primary antibodies at 4℃ for 12 h and reacted with Goat Anti-Rabbit IgG H&L (HRP) (1:20000, ab6721, Abcam, Cambridge, UK) or Rabbit Anti-Mouse IgG H&L (HRP) (1:10000, ab6728, Abcam) at room temperature for 2 h. The images of proteins were obtained using the ChemiDoc system (Bio-rad, Hercules, CA, USA). Band intensities were quantified using ImageJ software and normalized to β-actin. The information of the primary antibodies were as follows: anti-LOXL1 (1:1000, ab313585, Abcam), anti-ADAM metallopeptidase with thrombospondin type 1 motif 5 (anti-ADAMTS-5, 1:250, ab41037, Abcam), anti-collagen type II alpha 1 chain (anti-COL2A1, 1:10000, ab34712, Abcam), anti-matrix metallopeptidase 13 (anti-MMP13, 1:1000, ab51072, Abcam), anti-Aggrecan (1:1000, ab3778, Abcam), anti-TCF4 (1:10000, ab217668, Abcam), and anti-β-actin (1:5000, ab8226, Abcam).

Cell isolation and culture

The normal or OA knee tissues were cleaned with phosphate buffer saline (PBS) and cut into pieces, and the chondrocytes were obtained after digestion by type II collagenase. The isolated chondrocytes were grown in the Dulbecco’s modified eagle medium supplemented with 10% fetal bovine serum (Oumarsi, Shanghai, China) and 1 U/mL penicillin-streptomycin solution (Pricella, Wuhan, China) at a 37℃ incubator with 5% CO₂. The chondrocytes were treated with IL-1β (Yeasen) at 0, 5, 10, and 20 ng/mL for 48 h or treated with IL-1β at 10 ng/mL for 0, 24, 48, and 72 h to screen the optimal treatment condition for stimulating chondrocytes to establish an in vitro model of inflammatory chondrocyte injury, which mimicked key aspects of OA-related inflammation.

Cell viability assay

Based on the manual of the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT) Cell Proliferation and Cytotoxicity Assay Kit (Beyotime), the cells with 2 × 10³ cells/well were spread into the 96-well-plate, and the MTT was dissolved into 5 mg/mL. The cells were treated with different conditions as required by experiments, and the dissolved MTT solution was added to the plate and reacted with the treated cells for 4 h. The Formazan solution was added to the plate. Then the absorbance was detected at 570 nm.

Vector plasmid construction and transfection

The short hairpin RNA targeting LOXL1 (sh-LOXL1) and TCF4 (sh-TCF4), the overexpression vector of LOXL1 (LOXL1), and the corresponding negative control (NC: sh-NC and vector) were generated by Guangzhou Ribobio Biological Technology Co., Ltd. The above plasmids were transfected into chondrocytes employing Lipofectamine 2000 (Thermo Fisher Scientific).

Cell proliferation assay

Based on the manufacturer’s specification of the Cell-Light™ 5-ethynyl-2’-deoxyuridine (EdU) Apollo In Vitro Kit (Ribobio), the chondrocytes with 1 × 10⁵ cells/well inoculated into the 96-well plate were grew to the normal growth stage and treated for different experiments. The reagent A in the kit was diluted to 50 µM EdU medium at a ratio of 1000:1 using the complete medium and then were added to the plate for 2 h. After the cells were fixed, 2 mg/mL of glycine was added and reacted in a decolorizing shaker for 5 min. The cells were infiltrated with 0.5% Triton X-100 and then added with the configured 1×Apollo staining reaction solution and reacted at 37℃ for 30 min avoiding light. The cell penetration was again performed using 0.5% Triton X-100, and the 4’,6-diamidino-2-phenylindole (DAPI) was added to the plate for nuclear staining at 37℃ for 30 min. After that, image acquisition and analysis were conducted employing a fluorescence microscope (Sinico, Shenzhen, China).

Cell apoptosis assay

The treated cells were digested and collected in a centrifuge tube. The Annexin V-FITC binding solution, Annexin V-FITC, and propidium iodide stain solution were used to treat the cells successively. Then the reaction was happened at 25℃ for 20 min and immediately detected by a flow cytometer (Beckman Coulter, Brea, CA, USA). The above steps were in the light of the manual of the Annexin V-FITC Apoptosis Detection Kit (Beyotime).

Inflammatory factor detection

Based on the specification of the enzyme linked immunosorbent assay (ELISA) kits (COIBO BIO, Shanghai, China), the contents of tumor necrosis factor-α (TNF-α) and IL-6 were assessed. In brief, the standard and sample holes were set up in the slats. The standard holes were added with 50 µL standard substances with different concentrations, and the sample holes were added with 50 µL samples. In addition to the blank holes, standard and sample holes were treated with 100 µL of antibody labeled by horse radish peroxidase (HRP), which was allowed to react at 37℃ for 1 h. After washing, the substrate A and B with 50 µL were added to each well and reacted at 37℃ for 15 min without light. The absorbance at 450 nm was tested within 15 min after 50 µL termination solution was added.

Malondialdehyde (MDA) measurement

Based on the manual of the MDA Content Detection Kit (Solarbio, Beijing, China), the MDA levels in cells and tissues were measured. After the cell or tissue samples were collected, the supernatant was centrifuged and collected for sample testing. The test tube was added with 300 µL of MDA test working solution, 100 µL of sample to be tested, and 100 µL of reagent 3. The blank tube was added with 300 µL of MDA test working solution, 100 µL of distilled water, and 100 µL of reagent 3. The above mixture was insulated at 100℃ for 1 h, then cooled in an ice bath and centrifuged at 1000×g for 10 min. The supernatant was added to the 96-well plate, and the OD value of the sample was examined at different wavelengths (450 nm, 532 nm, and 600 nm). MDA level was assessed in line with the following formula: MDA content = 5 × (12.9×(ΔA532-ΔA600)-2.58 × ΔA450) ÷ Cpr. Cpr: sample protein concentration, mg/mL.

Reactive oxygen species (ROS) assay

In line with the user guide of the ROS Assay Kit (Baiaolaibo, Beijing, China), the ROS level of cells was detected. The diluted DCFH-DA (10 µM) was added to the treated cells to make the cell density of 2 × 10⁷ cells/mL and reacted in the incubator at 37℃ for 20 min. After washing with the serum-free medium, the ROS level of the cells was assessed by the flow cytometer (Agilent, Santa Clara, CA, USA).

According to the manual of the Tissue ROS Test Kit (DHE) (Baiaolaibo), the detection of ROS levels in tissues was performed. 50 mg fresh tissue samples were accurately weighed and homogenized with 1 mL homogenate buffer and centrifuged at 4℃ 1000×g for 3 min. 200 µL supernatant were obtained by centrifugation and 2 µL DHE probe were added to the 96-well plate. The mixture was reacted at 37℃ for 30 min without light, and ROS level was determined by a flow cytometer (Agilent).

Mouse model experiments

All procedures of this experiment were abided by the requirements of Suizhou Hospital, Hubei University of Medicine Animal Ethics Committee. The 7-week-old C57BL/6 mice offered by the Peking University Health Science Center Department of Laboratory Animal Science (Beijing, China) were assigned to 3 groups (Ctrl group, Model + AAV-sh-NC group, and Model + AAV-sh-LOXL1 group) with 6 mice per group. The mice in Model + AAV-sh-NC and Model + AAV-sh-LOXL1 groups were treated with intra-articular injection of monoiodoacetate (MIA, 2 mg/25 µL, Sigma-Aldrich, Darmstadt, Germany) in the right knee joints to induce OA models in vivo. After one week, the mice were injected with adeno-associated virus vector (AAV)-sh-NC or AAV-sh-LOXL1 received from Guangzhou PackGene Biotechnology Co., Ltd. for 4 weeks. The mice in the Ctrl group did not receive any intervention. After 35 days, the mice were killed and the tissues were collected for the follow-up experiments.

Histological staining

Hematoxylin-eosin (H&E) staining: The mouse tissues were collected and washed with pre-cooled PBS, and then immobilized with 4% paraformaldehyde for 24 h or more. The joint tissues were embedded in paraffin after gradient dehydration with ethanol and cut into sections with the thickness of 5 μm. The sections were dewaxed with xylene and stained with hematoxylin (4 min) and eosin (1 min), respectively. The sections were dehydrated with gradient ethanol solution and then permeated with xylene. After the sections were sealed with neutral resin, they could be observed and photographed by the microscope (Leica, Wetzlar, Germany).

Safranin-O/fast green (SOFG) staining: The specimen was treated using the same method as H&E staining, and the sections were dyed with Safranin O Stain for 5 min. The sections were washed with Safranin differentiation solution for 2 min and dehydrated with ethanol at different concentrations. The xylene was used for the transparency of the sections. After the sections were blocked with neutral resin, the images were received under the microscope (Leica).

Immunohistochemistry (IHC)

The mouse joint tissues were fixed, embedded, and sliced, and then antigen retrieval was conducted with the repair solution. The tissue sections were blocked using bovine serum albumin (BSA) for 20 min and reacted with anti-Ki-67 (1:100, ab15580, Abcam) at 4℃ for 12 h, followed by Goat Anti-Rabbit IgG H&L (HRP) (1:1000, ab6721, Abcam) at 37℃ for 2 h. After washing, the diaminobenzidine (DAB) was used for color development. The sections were blocked and observed under the microscope (Leica).

Chromatin immunoprecipitation (ChIP)

The cells cross-linked with formaldehyde at 37℃ were collected and treated with ultrasound to cut the DNA for 400–800 bps. After ultrasonic treatment, the samples collected by centrifugation were diluted with the ChIP Dilution Buffer containing phenylmethanesulfonyl fluoride (PMSF). A part of the sample was used as Input, and the rest was reacted with Protein A + G Agarose/Salmon Sperm DNA at 4℃ for 30 min. The samples were centrifuged, and the primary antibodies (anti-TCF4, 1:100, ab217668, Abcam; IgG, 1:100, ab171870, Abcam) were added, followed by the treatment of Protein A + G Agarose/Salmon Sperm DNA to precipitate the proteins recognized by the primary antibodies. Then the sample was washed, the Elution buffer was added, and 5 M NaCl was added to remove the cross-linking between the protein and genomic DNAs. After purification, the samples could be used for PCR detection. The above procedure was executed based on the manual of the ChIP Assay Kit (Beyotime).

Dual luciferase reporter assay

To investigate the m6A modification on LOXL1 and the interaction between LOXL1 and TCF4, the wild-type vector (LOXL1^wt) or mutant-type vector (LOXL1^mut) targeting LOXL1 was transfected into chondrocytes together with sh-NC or sh-TCF4 by Lipofectamine™ 3000 (Thermo Fisher Scientific). The Firefly/Renilla luciferase activity was measured based on the instruction of the Dual Luciferase Reporter Gene Assay Kit (Yeasen) after the transfection of 36 h.

Statistical analysis

All data were represented as mean ± standard error of the mean (SEM). The GraphPad Prism 8.4.3 (GraphPad Software, San Diego, CA, USA) was employed to analyze the data, and the differences between the data were determined by the Student’s t-test and one-way or two-way ANOVA. The statistical difference was reasonable at P < 0.05.

Results

LOXL1 is overexpressed in OA

First of all, LOXL1 expression was analyzed in the GSE169077 and GSE114007 datasets, and compared with the Normal group, LOXL1 was elevated in the OA group (Fig. 1A-B). In clinical samples, LOXL1 expression was higher in the OA group than that in the Normal group (Fig. 1C). Similarly, the high expression of LOXL1 in OA tissues was also verified by western blot results (Fig. 1D). These results suggest that LOXL1 may be a regulatory factor of OA.

Fig. 1.

LOXL1 is highly expressed in OA tissues. (A) The LOXL1 mRNA levels in Normal and OA groups in GSE169077 from the GEO database. (B) The LOXL1 mRNA levels in Normal and OA groups in GSE114007 from the GEO database. (C) The LOXL1 mRNA levels of normal joint tissues (n = 43) and arthritic tissues (n = 43) were detected by qRT-PCR. (D) The LOXL1 protein levels of normal joint tissues (n = 3) and arthritic tissues (n = 3) were examined by western blot. *P < 0.05, ***P < 0.001

IL-1β is used to induce inflammatory injury in chondrocytes

In order to induce inflammatory chondrocyte injury model, the treatment conditions of IL-1β were screened. As shown in Fig. 2A, the chondrocytes were treated with IL-1β at 0, 5, 10, and 20 ng/mL, and the cell viability of chondrocytes decreased in a dose-dependent manner. Moreover, the cell viability of chondrocytes decreased as the extension with the treatment time of IL-1β (Fig. 2B). Therefore, IL-1β with 10 ng/mL for 48 h is used to stimulate chondrocytes to mimic OA-related inflammation in vitro.

Fig. 2.

IL-1β hampers cell viability of chondrocytes. (A) The cell viability of chondrocytes treated with IL-1β at 0, 5, 10, or 20 ng/mL for 24 h was evaluated by MTT assay. (B) The cell viability of chondrocytes treated with IL-1β at 10 ng/mL for 0, 24, 48, or 72 h was evaluated by MTT assay. **P < 0.01, ***P < 0.001

Knocking down LOXL1 alleviates IL-1β-induced suppression of cell proliferation and induction of apoptosis, inflammation, oxidative stress, and ECM degradation

To further illustrate the function of LOXL1 in OA, the following experiments were performed. The treatment of IL-1β promoted the expression of LOXL1 in chondrocytes (Fig. 3A). The expression of LOXL1 was inhibited by sh-LOXL1 in chondrocytes or IL-1β treated chondrocytes (Fig. 3B-C). In function, the number of EdU⁺ cells was decreased with the treatment of IL-1β, which was reversed by the transfection of sh-LOXL1 (Fig. 3D). The apoptosis of chondrocytes measured by flow cytometry showed the opposite result of the EdU assay (Fig. 3E). Meanwhile, the promotion of IL-1β on the release of inflammatory factor TNF-α and IL-6 was undermined by LOXL1 knockdown (Fig. 3F). As described in Fig. 3G-H, silencing LOXL1 retarded the IL-1β-induced oxidative stress. At the same time, ECM-related proteins were detected by western blot. IL-1β significantly down-regulated the levels of COL2A1 and Aggrecan and up-regulated the expression of ADAMTS-5 and MMP13 in chondrocytes; however, these IL-1β-induced changes were reversed by LOXL1 deletion (Fig. 3I). Consequently, these data indicate that LOXL1 knockdown can alleviate IL-1β-induced chondrocyte injury.

Fig. 3.

LOXL1 curbs chondrocyte proliferation and impels apoptosis, inflammation, oxidative stress, and ECM degradation in vitro. (A) The LOXL1 protein levels of chondrocytes in Ctrl and IL-1β groups were examined by western blot. (B) The LOXL1 protein levels of chondrocytes treated with sh-NC and sh-LOXL1 were examined by western blot. The chondrocytes were treated with different conditions and divided into 3 groups (Ctrl, IL-1β + sh-NC, and IL-1β + sh-LOXL1). (C) The LOXL1 protein levels of the treated chondrocytes were examined by western blot. (D) The number of EdU ⁺ cells in the treated chondrocytes was assessed by EdU assay. (E) The apoptosis of the treated chondrocytes was estimated by flow cytometry. (F) The levels of TNF-α and IL-6 in the treated chondrocyte supernatant were monitored by ELISA. (G) The MDA levels of the treated chondrocytes were determined by the MDA Content Detection Kit. (H) The ROS levels of the treated chondrocytes were analyzed by flow cytometry. (I) The protein levels of ADAMTS-5, COL2A1, MMP13, and Aggrecan in the treated chondrocytes were examined by western blot. **P < 0.01, ***P < 0.001

Silencing LOXL1 ameliorates cartilage damage and reduces inflammation and ECM degradation in MIA-induced mouse OA model

To investigate the impact of LOXL1 in the progression of OA in vivo, the MIA-induced mouse models of OA were treated with intra-articular injection of AAV-sh-LOXL1 or AVV-sh-NC. The H&E and SOFG staining showed that the joint tissues in the Model + AAV-sh-NC group were characterized by OA features, such as unevenness, thinning, and cracking of the cartilage surface, and reduction of chondrocytes compared with the Ctrl group. However, the protective effect of sh-LOXL1 was observed in the Model + AAV-sh-LOXL1 group, as cartilage damage was alleviated after the AAV-sh-LOXL1 treatment (Fig. 4A-B). Besides, LOXL1 deficiency markedly expedited chondrocyte proliferation, as indicated by Ki-67 staining (Fig. 4C). The low expression of LOXL1 was observed in the mice treated with AAV-sh-LOXL1 (Fig. 4D). The levels of TNF-α and IL-6 were increased in the mice in the Model + AAV-sh-NC group in comparison to the mice in the Ctrl group, which was abated by sh-LOXL1 in the Model + AAV-sh-LOXL1 group (Fig. 4E). In the same way, the MDA and ROS levels were consistent with in vitro results that the reduced LOXL1 weakened the oxidative stress in OA mice (Fig. 4F-G). The detection of key proteins of anabolism and catabolism in mice was also performed in vivo experiments, and the results exhibited a decreased expression of anabolic-related proteins (COL2A1, Aggrecan) and an increased expression of catabolic-related proteins (ADAMTS-5, MMP13) in the Model + AAV-sh-NC group compared to the Ctrl group, while the changes were recuperated in the Model + AAV-sh-LOXL1 group, which was consistent with results illustrated in vitro experiment (Fig. 4H). Collectively, the above data prove that LOXL1’s absence possesses the property of protecting articular cartilage in MIA-induced OA in vivo.

Fig. 4.

LOXL1 inhibits chondrocyte proliferation and promotes cellular inflammation, oxidative stress, and ECM degradation in vivo. The MIA was used to induce mouse models of OA, and the mice were treated with intra-articular injection of AAV-sh-LOXL1 or AVV-sh-NC and were divided into 3 groups (Ctrl, Model + AAV-sh-NC, and Model + AAV-sh-LOXL1). (A) The sections of the knee joints from the mice were stained with H&E. (B) The sections of the knee joints from the mice were stained with SOFG. (C) The Ki-67 was detected in the sections of the knee joints from the mice by IHC. (D) The LOXL1 protein levels of the mice were examined by western blot. (E) The levels of TNF-α and IL-6 in the serum of mice were monitored by ELISA. (F) The MDA levels of the mice were determined by the MDA Content Detection Kit. (G) The ROS levels of the mice were analyzed by flow cytometry. (H) The protein levels of ADAMTS-5, COL2A1, MMP13, and Aggrecan in the mice were examined by western blot. *P < 0.05, ***P < 0.001

TCF4 regulates the transcription of LOXL1

To explore the mechanism of LOXL1 in the progression of OA, this study employed the JASPAR website to predict potential binding sites on LOXL1 sequence and found that there were 2 binding sites of TCF4 on the promoter region of LOXL1 (Fig. 5A). However, ChIP assay demonstrated that the binding of LOXL1 and TCF4 occurred only at site 2 (Fig. 5B), which was further confirmed by dual luciferase reporter assay (Fig. 5C). Beyond that, TCF4 knockdown confined the expression levels of LOXL1 and TCF4, and TCF4 overexpression exhibited the contrary results (Fig. 5D). In human samples, TCF4 was up-regulated in the arthritic tissues in contrast to the normal articular tissues (Fig. 5E-F), and the positive correlation of TCF4 and LOXL1 expression was displayed in Fig. 5G. Taken together, there is a transcriptional regulation between TCF4 and LOXL1.

Fig. 5.

TCF4 activates the transcription of LOXL1. (A) The binding sites of TCF4 and LOXL1 were predicted by the JASPAR website. (B) The ChIP assay was used to detect the binding between TCF4 and LOXL1. (C) The luciferase activity of chondrocytes was tested by the dual luciferase reporter assay after the cells were co-transfected with LOXL1^wt or LOXL1^mut and sh-NC or sh-TCF4. (D) The LOXL1 and TCF4 protein levels of the chondrocytes transfected with sh-NC, sh-TCF4, vector, and TCF4 overexpression vectors were examined by western blot. (E) The TCF4 mRNA levels of normal joint tissues (n = 43) and arthritic tissues (n = 43) were detected by qRT-PCR. (F) The TCF4 protein levels of normal joint tissues (n = 3) and arthritic tissues (n = 3) were examined by western blot. (G) The correlation between TCF4 and LOXL1 mRNA levels was analyzed by the Spearman correlation analysis. **P < 0.01, ***P < 0.001, ns, no significance

LOXL1 up-regulation diminished the impact of TCF4 deficiency in chondrocytes

For the purpose of verifying the role of LOXL1 and TCF4 in OA, the co-transfection of sh-TCF4 and LOXL1 was conducted in chondrocytes. IL-1β induced the high expression of TCF4 in chondrocytes (Fig. 6A), and the transfection of LOXL1 overexpression vector was effective (Fig. 6B). The western blot assay presented that the depleted TCF4 impeded the IL-1β-induced boost of LOXL1 expression in chondrocytes, and this phenomenon was reversed with the transfection of LOXL1 overexpression vectors (Fig. 6C). In addition, the acceleration of sh-TCF4 on the number of EdU⁺ cells was relieved by the co-transfection of LOXL1 in chondrocytes (Fig. 6D). LOXL1 overexpression ameliorated the effects of deficient TCF4 on apoptosis in chondrocytes (Fig. 6E). Furthermore, sh-TCF4-blocked the release levels of TNF-α and IL-6 were alleviated after the transfection of LOXL1 overexpression vectors (Fig. 6F). LOXL1 up-regulation intensified the levels of MDA and ROS in IL-1β-induced chondrocytes repressed by TCF4 deficiency (Fig. 6G-H). What’s more, after down-regulation of TCF4, the expressions of COL2A1 and Aggrecan were increased, while the expressions of ADAMTS-5 and MMP13 were decreased, and TCF4 overexpression could reduce the influence of down-regulated TCF4 on the expression of the above proteins (Fig. 6I). Accordingly, overexpression of LOXL1 overturned the effects of TCF4 knockdown on IL-1β-induced chondrocytes.

Fig. 6.

TCF4 regulates the effects of LOXL1 on IL-1β-induced chondrocytes. (A) The TCF4 protein levels of the chondrocytes in Ctrl and IL-1β groups were examined by western blot. (B) The LOXL1 protein levels of the chondrocytes transfected with vector and LOXL1 were examined by western blot. The chondrocytes were treated with different conditions and divided into 4 groups (Ctrl, IL-1β, IL-1β + sh-TCF4 + vector, and IL-1β + sh-TCF4 + LOXL1). (C) The LOXL1 protein levels of the treated chondrocytes were examined by western blot. (D) The number of EdU⁺ cells in the treated chondrocytes was assessed by EdU assay. (E) The apoptosis of the treated chondrocytes was estimated by flow cytometry. (F) The levels of TNF-α and IL-6 in the treated chondrocyte supernatant were monitored by ELISA. (G) The MDA levels of the treated chondrocytes were determined by the MDA Content Detection Kit. (H) The ROS levels of the treated chondrocytes were analyzed by flow cytometry. (I) The protein levels of ADAMTS-5, COL2A1, MMP13, and Aggrecan in the treated chondrocytes were examined by western blot. *P < 0.05, **P < 0.01, ***P < 0.001

Discussion

OA is a musculoskeletal disease, one of the important factors leading to disability [29], and is common in the elderly population. As the population ages, the global prevalence rate of OA has increased, and the impact on women is greater than that men. OA affects the whole joint, including the tissues around the joint [30]. As a chronic disease, OA will gradually change over time and also lead to cardiovascular disease, obesity, and diabetes, thus further increasing the incidence of OA [31]. Therefore, it is urgent to prevent OA and control the disease progression.

This study identified LOXL1 as a novel promoter of chondrocyte dysfunction. While LOXL1 has been implicated in fibrosis and cancer through its ECM remodeling functions [32–34], its role in OA was not entirely clear. Notably, LOXL1 was identified as an arthritis-related gene [35]. Herein, this research demonstrated that LOXL1 was significantly up-regulated in OA cartilage tissues and IL-1β-stimulated chondrocytes. This finding aligns with a recent report showing elevated LOXL1 in rheumatoid arthritis synovium [36], suggesting a broader role in joint pathology. The canonical function of LOXL1 is to catalyze covalent cross-linking within the ECM, which typically contributes to tissue stabilization. In this study, the data showed that silencing LOXL1 protected against IL-1β-induced ECM degradation. This suggests that in the inflammatory milieu of OA, up-regulated LOXL1 may facilitate a pathological form of ECM remodeling. Excessive or aberrant cross-linking could alter cartilage biomechanics, expose cryptic epitopes that perpetuate inflammation, or disrupt normal integrin-mediated survival signals to chondrocytes, thereby accelerating catabolism [37]. These results in this study, showing that LOXL1 knockdown mitigates inflammation, oxidative stress, and apoptosis while promoting chondrocyte proliferation, support the notion that LOXL1 drives a vicious cycle linking ECM disruption to cellular dysfunction in OA. Therefore, LOXL1 is not merely a bystander but a biologically plausible and active contributor to cartilage degeneration. However, the findings are primarily based on IL-1β-stimulated chondrocytes and the MIA model. The precise mechanistic link between elevated LOXL1 levels and ECM degeneration, such as its direct effects on collagen cross-linking, tissue stiffness, or downstream catabolic signaling pathways in chondrocytes, warrants further investigation.

The bioinformatic prediction and experimental validation indicated that LOXL1 contained a functional binding site for the transcription factor TCF4. It was found that TCF4 was also up-regulated in OA tissues and positively correlated with LOXL1 expression, which was in line with the predecessor’s research [20]. The Wnt/β-catenin signaling played a role in promoting catabolism in the pathogenesis of OA [38]. As an effector of Wnt/β-catenin, TCF4 was also a factor in expediting catabolism and apoptosis of chondrocytes [20]. Zhou et al. reported that TCF4 was a diagnostic marker of OA in peripheral blood and had a certain clinical diagnostic value [39]. Furthermore, TCF4 was involved in the remission of OA by saikosaponin D [40]. Interestingly, the suppressive effect of TCF4 absence on apoptosis, inflammation, oxidative stress, and ECM degradation of chondrocytes caused by IL-1β was eroded by LOXL1. These data are consistent with previous reports implicating TCF4 in chondrocyte catabolism [41, 42] and suggest that TCF4 may exert its pro-catabolic effects, at least in part, through the transcriptional up-regulation of LOXL1. Collectively, these results support a model where the TCF4/LOXL1 axis is involved in promoting chondrocyte dysfunction and cartilage degradation in experimental models. Given that TCF4 is a well-established effector of Wnt/β-catenin signaling, a pathway critically involved in OA pathogenesis [43], this study seeks to determine whether TCF4’s pro-catabolic effects are partly mediated through LOXL1. While Wnt/β-catenin activation influences multiple downstream targets, such as cyclin D1 and c-Myc [44, 45], the specific induction of LOXL1 may represent a distinct mechanism linking Wnt signaling to ECM restructuring in OA. This TCF4/LOXL1 axis highlights a transcriptional route through which Wnt activation directly promotes ECM‑destabilizing enzyme expression, thereby accelerating cartilage degeneration.

In the present study, results identify the TCF4/LOXL1 axis as a novel regulatory pathway involved in chondrocyte injury in vitro and in vivo. The findings suggest that targeting this axis might hold therapeutic potential on OA. However, it should be noted that the in vitro experiments relied on IL-1β stimulation, which models acute inflammatory stress rather than the chronic, multi-factorial nature of OA. While IL-1β is widely used to study OA-related inflammation and ECM degradation, future studies should consider incorporating additional OA-relevant stressors such as TNF-α, cyclic mechanical stress, or oxidative stress to better simulate the complex OA microenvironment. Nevertheless, the in vivo MIA model, which induces progressive joint degeneration, supports the pathogenic role of LOXL1 in OA.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Conceptualization and Methodology: Xiaojun Liu and Xinyi Fan; Formal analysis and Data curation: Yiming Zhang and Haiyang Ouyang; Validation and Investigation: Jiquan Wang and Xiaojun Liu; Writing - original draft preparation and Writing - review and editing: Jiquan Wang, Xiaojun Liu and Xinyi Fan; Approval of final manuscript: all authors.

Funding

No funding was received.

Data availability

The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The present study was approved by the ethical review committee of the Suizhou Hospital, Hubei University of Medicine. Written informed consent was obtained from all enrolled patients.

Patient consent for publication

The results presented in this paper have not been published preciously in whole or in part.

Competing interests

The authors declare no competing interests.