Skip to main content
NCBI home page
Microbial Biotechnology logoLink to Microbial Biotechnology
. 2026 Apr 28;19(5):e70362. doi: 10.1111/1751-7915.70362

Genome‐Scale Engineering Importing Property of Escherichia coli for Improving Production of 3‐Hydroxypropionic Acid

Seungjin Kim 1,2,3, Junyeong Sung 3, Ga Yeon Lim 1, Gyoo Yeol Jung 3,4,✉, Hyun Gyu Lim 1,2,✉
PMCID: PMC13124679  PMID: 42050378

ABSTRACT

Microbial biochemical production can suffer reduced growth and productivity from intracellular product accumulation, which can be mitigated by minimizing product import. Limited understanding of import‐related genes, especially for non‐native products, has hindered this approach in strain development. We developed a workflow to identify genes involved in 3‐hydroxypropionic acid (3‐HP) import. We constructed a genome‐wide overexpression library coupled with a 3‐HP‐responsive fluorescent biosensor and used flow cytometry to isolate narQ‐overexpressing strains with a 3.0‐fold higher fluorescence signal. Transcriptome profiling under NarQ overexpression revealed a distinct set of membrane‐associated genes (acrD, mliC, and pgaABCD) that were transcriptionally upregulated, and functional tests confirmed that their overexpression enhanced 3‐HP import while their deletion in producing strains increased 3‐HP titers by up to 21% compared with the control strain. This study provides a systematic workflow for identifying import‐related genes directly from genomic DNA, advancing the development of more efficient microbial production platforms.

Keywords: 3‐Hydroxypropionic acid, import, membrane proteins, NarQ

We developed a systematic workflow to identify genes responsible for 3‐HP import by combining a genomic library with a fluorescent biosensor. Deleting the identified import‐related genes reduced product re‐uptake, successfully increasing 3‐HP titers by 21% and providing a new strategy for optimising microbial production platforms.

graphic file with name MBT2-19-e70362-g004.jpg

Abbreviations

3‐HP

3‐Hydroxypropionic acid

DEGs

Differentially expressed genes

FACS

Fluorescence‐activated cell sorter

FDR

False discovery rate

GO

Gene ontology

HPLC

High‐performance liquid chromatography

MFI

Mean fluorescence intensity

NPN

N‐phenyl‐1‐naphthylamine

PGA

Poly‐β‐1,6‐N‐acetyl‐D‐glucosamine

1. Introduction

3‐Hydroxypropionic acid (3‐HP) is a key platform chemical for producing biodegradable polymers and acrylic derivatives, yet its microbial biosynthesis remains limited by product toxicity and import (Sankaranarayanan et al. 2014; Matsakas et al. 2018; Bhagwat et al. 2021; Liang et al. 2022; Wang, Cui, et al. 2023). Because 3‐HP is a small, weak organic acid, it can diffuse across the cell membrane in its protonated form and re‐enter the cytoplasm after secretion (Qin et al. 2024). This reuptake can perturb intracellular pH and redox balance, triggering stress responses that divert metabolic resources away from production (Korosh et al. 2017; Wu et al. 2024; Àvila‐Cabré et al. 2025). Therefore, efficient production requires not only active export of 3‐HP but also minimisation of its import into the cell.

Modifying membrane transport is a logical approach to address this challenge. Exporters can be overexpressed and importers can be deleted to shift the balance toward extracellular accumulation, and such strategies have improved yields for various organic acids and alcohols (Kim et al. 2018; Onyeabor et al. 2020; Wang, Li, et al. 2023). However, membrane engineering has been difficult to generalize because transport systems for most industrial metabolites, including 3‐HP, are poorly characterized (Jenkins Sánchez et al. 2022). Traditional discovery strategies—such as growth‐based selection of deletion or overexpression libraries—have primarily identified transporters related to nutrients, toxins, or antibiotics (Huang et al. 2018; Sandberg et al. 2019; Lim et al. 2020). These methods rely on growth phenotypes and therefore potentially overlook transporters or regulators associated with non‐growth substrates. Even when homologous sequence searches or radiolabeled uptake assays are applied, the process remains low‐throughput and limited to known transporter families (Kamimoto et al. 2012; Sugiyama et al. 2016; Cheng et al. 2019; Yamada et al. 2022).

Another limitation of current approaches is their narrow focus on canonical transporters. Many other membrane‐associated proteins indirectly influence solute movement by altering membrane composition, supplying energy for active transport, or modulating the folding and activity of membrane complexes (Zhang et al. 2003; Ni and Chen 2004; Ahn et al. 2018; Braun 2024). Such non‐transporter factors have rarely been explored in the context of product uptake.

To overcome these constraints, we implemented a biosensor‐guided, phenotype‐driven screening strategy that directly links intracellular 3‐HP levels to genetic perturbations. This approach combines a genome‐wide overexpression library with a genetically encoded biosensor, enabling high‐throughput identification of genes whose overexpression alters intracellular 3‐HP accumulation, independent of growth. Using this platform, we discovered that overexpression of NarQ, a membrane‐bound sensor histidine kinase, unexpectedly increased intracellular 3‐HP levels. Transcriptomic and functional analyses further revealed that NarQ regulates a set of membrane‐associated genes influencing 3‐HP import. These findings expand the scope of membrane engineering targets beyond classical transporters and demonstrate how biosensor‐based screening can uncover regulatory components that modulate metabolite transport and production efficiency.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, and Reagents

All bacterial strains and plasmids utilized in this study are detailed in Table 1. Routine PCR was carried out using Taq polymerase and DNA endonuclease obtained from Takara (Kusatsu, Japan), while Q5 polymerase was sourced from New England Biolabs (Ipswich, MA, USA). Oligonucleotides for plasmid construction were synthesized by Cosmogenetech (Seoul, Korea), and their sequences are provided in Table 2. Plasmid preparation was performed using a GeneAll Exprep Plasmid SV mini kit (GeneAll Biotechnology, Seoul, Korea). DNA purification was achieved with a GeneAll Expin Gel SV kit or Expin CleanUp SV kit. Reagents for bacterial culture were purchased from BD Biosciences (Sparks, MD, USA). Chromosomal modifications to delete genes were carried out using the λ‐Red recombination method with pKD46 and pCP20 (Datsenko and Wanner 2000). Unless otherwise specified, all chemical reagents (coenzyme B12, etc.) were purchased from Sigma‐Aldrich (St. Louis, MO, USA).

TABLE 1.

The strains and plasmids used for this study.

Name Description Source
Strains
E. coli W An acid tolerant and fast‐growing E. coli strain, ATCC9637 ATCC
E. coli Mach1‐T1R WSEN3 A cloning host Invitrogen
WS‐frag1 E. coli W/pMD20‐Fragment1/pCDF‐C4lysR This study
WS‐frag2 E. coli W/pMD20‐Fragment2/pCDF‐C4lysR This study
WS‐narQ E. coli W/pMD20‐narQ/pCDF‐C4lysR This study
WS‐aegA E. coli W/pMD20‐aegA/pCDF‐C4lysR This study
WS‐Empty E. coli W/pMD20/pCDF‐C4lysR This study
WS‐narQ H370Q E. coli W/pMD20‐narQ H370Q/pCDF‐C4lysR This study
WS ∆narQXLP‐Empty E. coli W ∆narQXLP/pMD20/pCDF‐C4lysR This study
WS ∆narQXLP‐narQ E. coli W ∆narQXLP/pMD20‐narQ/pCDF‐C4lysR This study
WS ∆narQXLP‐narQ H370Q E. coli W ∆narQXLP/pMD20‐narQ (H370Q)/pCDF‐C4lysR This study
WSC‐Empty E. coli W/pMD20/pCDF‐C4lysR/pACYC This study
WSC‐narQ E. coli W/pMD20‐narQ//pCDF‐C4lysR/pACYC This study
WSC‐acrD E. coli W/pMD20/pCDF‐C4lysR/pACYC‐acrD This study
WSC‐mliC E. coli W/pMD20/pCDF‐C4lysR/pACYC‐mliC This study
WSC‐yqiJK E. coli W/pMD20/pCDF‐C4lysR/pACYC‐yqiJK This study
WSC‐pgaABCD E. coli W/pMD20/pCDF‐C4lysR/pACYC‐pgaABCD This study
WSC‐dgcT E. coli W/pMD20/pCDF‐C4lysR/pACYC‐dgcT This study
PW E. coli W/pQE80L‐mKGSADH/pACYC‐B4 This study
PW∆narQ E. coli W ∆narQ/pQE80L‐mKGSADH/pACYC‐B4 This study
PW∆acrD E. coli W ∆acrD/pQE80L‐mKGSADH/pACYC‐B4 This study
PW∆mliC E. coli W ∆mliC/pQE80L‐mKGSADH/pACYC‐B4 This study
PW∆yqiJK E. coli W ∆yqiJK/pQE80L‐mKGSADH/pACYC‐B4 This study
PW∆pgaABCD E. coli W ∆pgaABCD/pQE80L‐mKGSADH/pACYC‐B4 This study
PW∆dgcT E. coli W ∆dgcT/pQE80L‐mKGSADH/pACYC‐B4 This study
Plasmids
pCDF CloDF13 ori Novagen
pMD20 pMB1‐derived ori Takara
pACYC p15A ori Novagen
pCDF‐C4lysR pCDF‐PBBa_J23106‐synUTRC4lysR ‐C4lysR‐T‐PC4M‐synUTR sgfp ‐sgfp Seok et al. (2018)
pMD20‐Fragment1 pMB1‐derived ori, containing aegA‐narQ‐acrD region of E. coli W This study
pMD20‐Fragment2 pMB1‐derived ori, containing nudF‐aegA‐narQ region of E. coli W This study
pMD20‐aegA pMB1‐derived ori, containing aegA region of E. coli W This study
pMD20‐narQ pMB1‐derived ori, containing narQ region of E. coli W This study
pMD20‐narQ H370Q narQ histidine kinase inactivation mutation H370Q This study
pQE80L‐mKGSADH pQE80‐PT5‐mKGSADH Lim et al. (2016)
pACYC‐B4 pACYC‐Ptac‐dhaB1‐Ptac‐dhaB2‐dhaB3‐gdrA‐gdrB Lim et al. (2016)
pACYC‐acrD pACYC‐Pbad‐acrD This study
pACYC‐mliC pACYC‐Pbad‐mliC This study
pACYC‐yqiJK pACYC‐Pbad‐yqiJK This study
pACYC‐pgaABCD pACYC‐Pbad‐pgaABCD This study
pACYC‐dgcT pACYC‐Pbad‐dgcT This study
Open in a new tab

TABLE 2.

The primers used for this study.

Primer Description
pMD20_F CGTCGTGACTGGGAAAACCC
pMD20_R GGTTTGCGTATTGGGCGCTCTTCC
narQ_F GAAGCGGAAGAGCGCCCAATACGCAAACCACCCAGACATTGCTGACTGTTGG
narQ_R AGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGACGGTGTTTTCCAGCGTCTGG
aegA_F AGGAAGCGGAAGAGCGCCCAATACGCAAACCCGCGATCGTAAACTTCACGTTTATGG
aegA_R AGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGGTGGAAAGAATCGACAGCAGCAC
narQ H370Q_F GTGCAACCATCGCCCGCGAATTGCAGGACTCGCTGGCTCAGGTACTTTCTT
narQ H370Q_R AAGAAAGTACCTGAGCCAGCGAGTCCTGCAATTCGCGGGCGATGGTTGCAC
pACYC_Pbad_F ATCTTACTTGTCTAGCATAACCCCTT
pACYC_Pbad_R ATGGAGAAACAGTAGAGAGTTGCG
acrD_F AACTCTCTACTGTTTCTCCATTTAACTTTAAGAAGGAGGACCACATATGGCGAATTTCTTTATTGATCGCC
acrD_R CCAAGGGGTTATGCTAGACAAGTAAGATGTTGTTATTCCGGGCGCGGCTT
mliC_F CGCAACTCTCTACTGTTTCTCCATTTAACTTTAAGAAGGAGATATACATATGAAAAAACTGTTACTGATCTGTTTGCC
mliC_R GCCCCAAGGGGTTATGCTAGACAAGTAAGATGTTGTCAACGCTGTGGATTTTGTAACTGA
yqiJK_F TCTCTACTGTTTCTCCATTTAACTTTAAGAAGGAGATATACATATGATTTTATTCGCCGACTATAATACCCCT
yqiJK_R AGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGACAAGTAAGATGTTGTTATTCTACGTTTTCGGCGACGG
pgaABCD_F TTTTTATCGCAACTCTCTACTGTTTCTCCATTTAACTTTAAGAAGGAGATATACATATGTATTCAAGTAGCAGAAAAAGGTGC
pgaABCD_R ACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGACAAGTAAGATGTTGTTATGCCCGGACTAGCGC
dgcT_F GCAACTCTCTACTGTTTCTCCATTTAACTTTAAGAAGGAGATATACATATGGAAAAAGACTATTTGAGAATTAGTAGTACTGT
dgcT_R AAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGACAAGTAAGATGTTGTTATGGTGACTCACAAAAATTCACCAC
narQ deletion_F TGTGTTTCAGCTAACTGGAACATTAATGATTTTTTGTGGAGAAGAGGCGTGCATGACCGGCGCGATGC
narQ deletion_R CCTTTTATACTGAACCTTAAGTGCAAGTATTCTTTGGTCAGTAGGAGGCAGCTCAGCGGATCTCATGCGC
pgaABCD deletion_F GTGTTTATGCCCGGACTAGCGCTTTTTCTGAAACAACCATTTTTATTTGCGCATGACCGGCGCGATGC
pgaABCD deletion_R ATGGGCTTTGAAACTTCTTACTGCCGCATTTTTAGCAGCGAGTCCCGCGGGCTCAGCGGATCTCATGCGC
acrD deletion _F GCAATCCTGTTGTGTCTGACAGGTACCCTGGCGATTTTCTCATTGCCCGTGCATGACCGGCGCGATGC
acrD deletion _R CACAAAGAACAGCGGCACGAAGTAAATAGCCAGAATAGTAGCTGAAATCAGCTCAGCGGATCTCATGCGC
mliC deletion_F CTTGGAACGTTAGGGAGGGCGTATTGCCCTCCAGACCAGGAAAGTCTTCGGCATGACCGGCGCGATGC
mliC deletion_R TTTGTAACTGACAGTTATTCAATACGATGCGGTCGCGTTTATAGACAGTCGCTCAGCGGATCTCATGCGC
yqiJK deletion_F AACTATCCCAAAGTAAATATTGCGTCACTAAATGGACATTGGAGTGACATGCATGACCGGCGCGATGC
yqiJK deletion_R ATATAAAAAATCCCCGGCTTTTTGTGCCAGGGACGTTCATAGCTGAAAATGCTCAGCGGATCTCATGCGC
dgcT deletion_F ATCTATTAATAATAGAAAGGGATCTACAACCTACAGATTGGTGTAGCTTTGCATGACCGGCGCGATGC
dgcT deletion_R CCTCGCTTAGGCCTGTGTCCATATTACGTGGGTAGGATCAAAAAGCCGCTGCTCAGCGGATCTCATGCGC
Open in a new tab

2.2. Cell Culture Methods

For cell cultivation, a modified M9 minimal medium with 100 mM glycerol, 0.5 g/L MgSO4·7H2O, 2.0 g/L NH4Cl, 2.0 g/L NaCl, 1.0 g/L yeast extract (Seok et al. 2018), and 100 mM potassium phosphate buffer (pH 7.0) was used. Plasmid cloning was conducted in LB (BD Biosciences, Sparks, MD, USA) medium consisting of 5 g/L yeast extract, 10 g/L NaCl, and 10 g/L tryptone. Appropriate antibiotics were added for plasmid maintenance: 50 mg/L ampicillin, 34 mg/L chloramphenicol, and 50 mg/L streptomycin. All cultures were incubated at 37°C with 220 rpm agitation. All experiments were performed in triplicate. For the 3‐HP import assay, individual genes were induced by supplementing the medium with 10 g/L arabinose.

For 3‐HP production cultures, seed cultures were prepared by inoculating a single colony into 3 mL of modified M9 minimal medium in 15 mL test tubes, followed by overnight incubation. These seed cultures were subsequently diluted 1/100 in fresh medium. Once the OD600 reached between 0.8 and 1, the cultures were diluted to an OD600 of 0.05 in 50 mL of fresh medium in 300 mL Erlenmeyer flasks to begin the main cultures. IPTG (0.1 mM) and coenzyme B12 (2 μM) were added at OD600 0.9–1.0 for 3‐HP production.

For 3‐HP import assay, seed cultures were prepared by inoculating a single colony into 3 mL of modified M9 minimal medium in 15 mL test tubes, followed by overnight incubation. These seed cultures were subsequently diluted 1/100 in fresh medium. Once the OD600 reached between 0.8 and 1, the cultures were diluted to an OD600 of 0.05 in 3 mL of fresh modified M9 minimal medium with 100 mM glycerol in 15 mL test tubes. 3‐HP, neutralized to pH 7 with 10 M NaOH, was added 2 h post‐cultivation. After 2 h of 3‐HP treatment, 1/10 diluted samples were analysed for MFI using a CytoFLEX SRT Fluorescence activated cell sorter (Beckman Coulter, Brea, CA, USA, NFEC‐2024‐12‐301263). A total of 500,000 events were observed per variant.

2.3. Genome‐Wide Library Construction and Sorting

E. coli W genomic DNA was fragmented using sonication (300 watts, 2 s × 2 rounds) with a Sonics Vibra Cell VCX‐750 (Newtown, CT, USA). Fragmented DNA of 3–5 kb was purified via gel extraction using a GeneAll Expin Gel SV kit (GeneAll Biotechnology, Seoul, Korea). DNA fragment ends were repaired and phosphorylated with the NEBNextR End Repair Module kit (NEB, Ipswich, MA, USA), followed by ligation to a vector fragment amplified from pMD20 using pMD20_F and pMD20_R primers. The ligated products were introduced into ElectroMAX DH10B cells (NEB, Ipswich, MA, USA) to enhance transformation efficiency. Subsequently, plasmids were extracted and reintroduced into the E. coli W strain harbouring the pCDF‐C4lysR plasmid.

The strain harbouring the genome‐wide library plasmid and pCDF‐C4lysR was incubated in a modified M9 minimal medium until the OD600 reached 0.6–0.8, after which 10 g/L of 3‐HP was added to the medium. After 1 h of incubation, the top 2% of the population in terms of fluorescence was sorted using a CytoFLEX (Beckman Coulter, Brea, CA, USA). This process was repeated for a total of four rounds.

2.4. Outer Membrane Permeability Assay

Outer membrane permeability was assessed using an N‐phenyl‐1‐naphthylamine (NPN) uptake assay, in which increased fluorescence upon partitioning of NPN into membrane phospholipids was used as a readout of outer membrane permeabilization. WS‐Empty and WS‐narQ strains were cultivated overnight in the appropriate medium containing antibiotics. The cultures were then diluted into fresh medium and grown to mid‐exponential phase (OD600 = 0.5). Cells were harvested, washed with 5 mM HEPES (4‐(2‐hydroxyethyl)‐1‐piperazineethanesulfonic acid) buffer (pH 7.2), and resuspended in the same buffer to a final OD600 of 1.0. For the assay, 100 μL of cell suspension was mixed with 100 μL of NPN‐containing buffer, which had been prepared by diluting a 2 mM NPN stock solution in ethanol 1:99 into 5 mM HEPES buffer, resulting in a final NPN concentration of 10 μM in the assay mixture. Fluorescence was measured at 20°C using a Synergy H1 plate reader (BioTek, Winooski, VT, USA) with an excitation wavelength of 350 nm and an emission wavelength of 420 nm.

2.5. RNA Sequencing and DEG Analysis

RNA purity was determined by assaying 1 μL of total RNA extract on a NanoDrop8000 spectrophotometer (Thermofisher, Waltham, MA, USA). Total RNA integrity was checked using an Agilent Technologies 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) with an RNA integrity number value. RNA sequencing libraries were prepared according to the manufacturer's instructions (Illumina Truseq stranded mRNA) and run on Novaseq 6000 sequencing system (Illumina, San Diego, CA, USA), performed sequencing with 2 × 100 bp read length. Sequencing reads were mapped to the reference genome (GenBank accession code: CP002185.1) by Tophat (v2.0.13), turning off splicing option. The aligned results were added to Cuffdiff (v2.2.0) to report differentially expressed genes. Genes exhibiting 2‐fold changes in their expression with False Discovery Rate (FDR) below 0.1 were considered as differentially expressed genes (DEGs).

2.6. Ortholog Mapping and GO Enrichment Analysis

DEGs from E. coli W were mapped to E. coli K‐12 MG1655 orthologs using a reciprocal best hit approach based on bidirectional BLAST‐P (E‐value < 1 × 10−6), retaining top hits with ≥ 70% coverage. The mapped MG1655 gene set was used for gene ontology (GO) enrichment analysis using DAVID. Genes without valid orthologs were excluded. Enrichment was assessed against all detected genes as background.

2.7. Quantification of Cell Numbers, Metabolites, and Fluorescence

OD600 was measured with a Shimadzu UV‐1700 spectrophotometer (Kyoto, Japan). Glycerol and 3‐HP concentrations were determined using high‐performance liquid chromatography (HPLC) with a Nexera HPLC Lite 40 system (Shimadzu, Kyoto, Japan) and a Bio‐Rad Aminex HPX‐87H column (Hercules, CA, USA) at 65°C, with 5 mM H2SO4 as the mobile phase at 0.6 mL/min. Detection was performed with a Shimadzu RID‐20A refractive index detector and SPD 40 UV–VIS detectors. MFI was measured using a CytoFLEX SRT Cell Sorter (Beckman Coulter, Brea, CA, USA) with 488 nm laser excitation, and 525/40 optical filters.

3. Results

3.1. Design of a Functional Screening Workflow to Identify 3‐HP Import‐Related Genes

To identify genes involved in 3‐HP import, we designed a biosensor‐guided functional screening workflow (Figure 1; Ravi and Sankaranarayanan 2023; Zhang et al. 2023). Specifically, a genome‐wide overexpression library was generated by randomly fragmenting the genomic DNA of E. coli W into 3–5 kb pieces and cloning them into a plasmid with a high‐copy origin (pMB1 derivative; Kim et al. 2021). Intracellular 3‐HP levels in library cells were monitored using a previously developed biosensor consisting of a 3‐HP‐responsive transcription factor coupled to a green fluorescence protein gene as a readout (Zhou et al. 2015; Seok et al. 2018). Highly fluorescent cells with overexpression of a potential 3‐HP import‐related gene were then enriched using a fluorescence‐activated cell sorter (FACS). These steps were repeated multiple times, and plasmids in enriched library cells were sequenced. Finally, the effects of the screened genes on intracellular 3‐HP accumulation and 3‐HP production were examined.

FIGURE 1.

FIGURE 1

Open in a new tab

Workflow for identifying import‐related genes and enhancing production through the gene deletions. This schematic illustrates a four‐step platform designed to screen for import‐related genes and modify strain to improve production efficiency. (1) Construction of genome‐wide library—Genomic DNA is fragmented and cloned into high‐copy plasmids to create a genome‐wide library. (2) Screening by import phenotype—Cells exhibiting increased import phenotypes are sorted from the genome‐wide library using a biosensor and fluorescence‐activated cell sorter. (3) Gene identification & validation—Sequencing of the screened variants is conducted, followed by individual validation of each gene's effect on import phenotypes. (4) Producing strain engineering—Identified import‐related genes are deleted in the producing strain to block 3‐HP import and enhance overall production efficiency.

3.2. Discovery o f NarQ as the Overexpression Target Elevating Intracellular 3‐HP

We enriched cells with elevated 3‐HP import from the overexpression library using fluorescence‐based cell sorting. An overexpression library of more than 107 cells was constructed in E. coli W harbouring the sensor plasmid (the WS strain, Table 1). These library cells were cultivated in minimal medium until the optical density at 600 nm reached 0.6–0.8, at which point 10 g/L 3‐HP was added to the medium, and 1 h later, the top 2% most fluorescent cells were isolated by FACS. This enrichment procedure was repeated four times, with 2.0 × 105 cells collected in the first round and 2 × 104 cells in each of the following three rounds. As a result, the final library population exhibited a 4.6‐fold higher MFI compared to the initial library, indicating successful enrichment (Figure 2A).

FIGURE 2.

FIGURE 2

Open in a new tab

Screening and identification of 3‐HP import‐enhancing genes. (A) Fluorescence distribution of the WS strain containing genome‐wide library over four rounds of FACS sorting. The top 2% of cells based on fluorescence intensity were sorted in each round. (B) Comparison of MFI for the 3‐HP import assay. MFI of the variants was measured after 1 h of cultivation with the addition of 10 g/L 3‐HP. Each point represents the average value of the biological triplicates. Error bars indicate the standard deviations. Statistical significance was determined relative to WS‐Empty, with significance indicated as follows: *** for p < 0.001, ** for p < 0.01, and * for p < 0.05; In cases where statistical significance was calculated individually, apart from the WS‐Empty variant, the variants were connected with solid lines to present the results. (C) The overexpressing genomic regions within each variant. Arrows indicate the genomic fragments in the sorted variants (WS‐frag1, WS‐frag2) and the constructed variants (WS‐aegA, WS‐narQ).

Plasmids in enriched clones were obtained and sequenced to identify regions responsible for the enhanced 3‐HP import phenotype. From 13 randomly selected colonies of the final pool, three distinct genomic fragments (Fragments 1–3) were identified, with Fragments 1 and 2 accounting for the majority. Both fragments contained part of aegA and the entire narQ gene (Figure 2C). When reintroduced into the WS strain, WS‐frag1 and WS‐frag2 displayed 3.0‐fold and 3.2‐fold increases in fluorescence, respectively, whereas Fragment 3 showed no effect. Further validation showed that narQ overexpression increased fluorescence to a level comparable to those of WS‐frag1 and WS‐frag2, with no statistically significant difference among them, whereas aegA overexpression resulted in a smaller increase (Figure 2B). Accordingly, the enhanced 3‐HP import phenotype observed in the enriched library was interpreted as being primarily associated with narQ overexpression.

3.3. NarQ Enhances 3‐HP Import, With a Major Contribution From Its Kinase Activity

We examined whether the enhanced 3‐HP level was dependent on the histidine kinase activity of NarQ. NarQ is known to function in nitrate sensing together with NarX and to transmit signals via the response regulators NarL and NarP in the Nar two‐component regulatory system of E. coli W (Figure 3A; Chiang et al. 1992; Rabin and Stewart 1993). To test the contribution of NarQ kinase activity, an autophosphorylation‐defective variant carrying the H370Q mutation was constructed (WS‐narQ H370Q; Table 1; Cavicchioli et al. 1995). The WS‐narQ H370Q strain showed markedly reduced fluorescence compared to WS‐narQ (Figure 3B), indicating that NarQ kinase activity accounts for a major fraction of the increased 3‐HP import signal. However, the WS‐narQ H370Q strain still displayed a residual reporter signal relative to the WS‐Empty (Figure 3B), suggesting that the NarQ‐associated phenotype may also involve an additional kinase‐independent contribution.

FIGURE 3.

FIGURE 3

Open in a new tab

Impact of NarQ histidine kinase activity and the Nar system on 3‐HP import in E. coli . (A) Schematic representation of the Nar two‐component system in E. coli . The system includes two membrane‐bound histidine kinases, NarQ and NarX, which detect extracellular signals and subsequently undergo autophosphorylation at conserved histidine residues (370His for NarQ, as highlighted). The phosphorylated histidine kinases then transfer phosphate groups to the response regulators NarL and NarP, activating them. Once activated, NarL and NarP regulate other gene transcriptions. (B) Result of the 3‐HP import assay in the WS strain and the WS ∆narQXLP strain, with an empty vector control (Empty) or with overexpression of NarQ or NarQH370Q. Each bar represents the average value of the biological triplicates. Error bars indicate the standard deviations. Statistical significance was evaluated for all three pairwise comparisons in each panel; *** indicates p < 0.001, ** indicates p < 0.01, and n.s. indicates not significant. (C) Volcano plots showing transcriptomic responses to narQ overexpression in E. coli W and E. coli W ΔnarQXLP. Genes with more than a 2‐fold increase in expression and an FDR below 0.1 are shown as red dots, and genes meeting these criteria in both backgrounds are highlighted as yellow dots.

We next tested whether the Nar system itself was required for this phenotype. A ΔnarQXLP strain was generated by deleting narQ, narX, narL, and narP from E. coli W, followed by the introduction of the 3‐HP sensor plasmid. Into this background, we introduced pMD20, pMD20‐narQ, or pMD20‐narQ H370Q, generating WSΔnarQXLP‐Empty, WSΔnarQXLP‐narQ, and WS ΔnarQXLP‐narQ H370Q, respectively (Table 1). Notably, NarQ overexpression still led to a strong fluorescence increase in the ΔnarQXLP background (Figure 3B), indicating that the canonical Nar two‐component signalling pathway is not strictly required for this effect. This result also suggests that NarQ may influence 3‐HP import through targets beyond its established nitrate‐responsive regulon. However, the increase observed in the ΔnarQXLP background was lower than that observed upon NarQ overexpression in the WT background (Figure 3B), indicating that the Nar system potentially still contributes to the overall phenotype.

To determine whether the enhanced 3‐HP import could be explained by a nonspecific increase in membrane permeability, an NPN uptake assay was performed. Because the intact outer membrane of Gram‐negative bacteria restricts the entry of the hydrophobic NPN probe, this assay specifically monitors outer membrane integrity (Helander and Mattila‐Sandholm 2000). However, narQ overexpression caused only an insignificant change in NPN‐derived fluorescence relative to the control (Figure S1). This implies that the enhanced import was not caused by general outer membrane permeabilization, thereby motivating further investigation into specific transport mechanisms via transcriptomic analysis.

3.4. Identification of NarQ‐Associated Genes That Enhance 3‐HP Import

To uncover genes regulated by NarQ that contribute to 3‐HP import, we performed comparative transcriptome analyses under conditions of NarQ overexpression. Four experimental groups were analysed: the WT and ΔnarQXLP strains, each with and without NarQ overexpression. Differentially expressed genes (DEGs) were identified as those exhibiting at least a two‐fold change in expression with a FDR below 0.1.

In total, 161 DEGs were detected in the WT strain and 69 in the ΔnarQXLP strain. Volcano plots provided an overview of the global transcriptional changes induced by narQ overexpression in the two genetic backgrounds (Figure 3C). GO enrichment analysis of the upregulated genes further indicated that the WT background exhibited a broader response, including regulation of gene expression, response to cold, translation‐related processes, cell adhesion and biofilm formation, sulfate assimilation, hydrogen sulfide biosynthetic process, and anaerobic respiration‐related processes (Figure S2). The enrichment of anaerobic respiration and anaerobic electron transport chain in the WT background is consistent with the known role of NarQ in nitrate‐responsive signalling. In contrast, GO enrichment in the ΔnarQXLP background was more restricted: adhesion‐ and biofilm‐related processes remained common features, whereas the other enriched terms included L‐arginine biosynthetic process, cellular response to acidic pH, nitrate assimilation, and iron ion transmembrane transport. Notably, nitrate assimilation remained enriched despite deletion of the canonical Nar system, suggesting that narQ overexpression can still influence nitrate‐associated physiology beyond the canonical Nar pathway. In addition, a modest enrichment of the cellular component term membrane was also observed in the ΔnarQXLP background. Among these transcriptional changes, 11 DEGs were shared between the two backgrounds. Notably, most of these shared DEGs encoded membrane‐associated proteins, highlighting a regulatory link between NarQ activity and membrane function.

We next evaluated whether these NarQ‐upregulated genes directly influenced 3‐HP import. Each membrane‐associated candidate gene or operon (acrD, mliC, yqiJK, pgaABCD, and dgcT) was expressed under an arabinose‐inducible promoter (Pbad) on a mid‐copy plasmid (pACYC) and introduced into the sensor strain. The strain overexpressing narQ (WSC‐narQ) was also included as a positive control. Fluorescence assays revealed that overexpression of pgaABCD, acrD, and mliC increased intracellular 3‐HP levels by 3.4‐fold, 2.8‐fold, and 1.8‐fold, respectively, compared with WSC‐Empty, whereas yqiJK and dgcT showed no significant effect. narQ overexpression increased intracellular 3‐HP levels by 4.5‐fold relative to WSC‐Empty, which may be due to the combined effects of multiple targets (Figure 4A). The absence of these genes in the initial FACS enrichment likely reflects that their high‐copy overexpression imposes a strong growth burden (Wagner et al. 2007; Gubellini et al. 2011; Mathieu et al. 2019). In the NarQ‐overexpression background, pgaABCD, acrD, and mliC were upregulated by 2.2‐ to 11.0‐fold, compared with a 67.3‐fold induction of narQ itself from the high‐copy plasmid. These results indicate that NarQ exerts regulatory control over multiple membrane‐associated genes whose activities collectively modulate 3‐HP import, providing a mechanistic link between NarQ signalling and transport phenotypes.

FIGURE 4.

FIGURE 4

Open in a new tab

Effects of gene overexpression on 3‐HP import and gene deletion on 3‐HP production in E. coli. (A) MFI of the WSC‐Empty, WSC‐acrD, WSC‐mliC, WSC‐yqiJK, WSC‐pgaABCD, and WSC‐dgcT strains after incubation with 3‐HP for 2 h. (B) 3‐HP titer of the producing strains PW, PWΔacrD, PWΔmliC, PWΔyqiJK, PWΔpgaABCD, and PWΔdgcT. Each point represents the average value of the biological triplicates. Error bars indicate the standard deviations. Statistical significance was determined relative to WSC‐Empty in A and PW in B, with significance indicated as follows: *** for p < 0.001, ** for p < 0.01, and * for p < 0.05. (C) Fed‐batch cultivation profiles of PW, PWΔacrD, and PWΔmliC. Solid lines with triangle markers represent PW, while dotted lines with square markers and dashed lines with circle markers represent PWΔacrD and PWΔmliC, respectively. OD600, 3‐HP concentration, and consumed glycerol are shown in black, red, and blue, respectively. Data points represent mean values from biological triplicates, and error bars denote standard deviations.

3.5. Improving 3‐HP Production Efficiency by Deleting Import‐Related Genes

We next evaluated the effects of import‐related gene deletions on 3‐HP production. Target genes or operons were deleted, and production strains were constructed by introducing a plasmid‐based pathway for 3‐HP biosynthesis from glycerol through a two‐step reaction (PW, PWΔnarQ, PWΔacrD, PWΔmliC, PWΔyqiJK, PWΔpgaABCD, and PWΔdgcT; Kumar et al. 2013; Lim et al. 2016). Deletion of acrD, mliC, and pgaABCD resulted in notable increases in 3‐HP titers compared with the control strain, PW (Figure 4B). In particular, the PWΔacrD achieved 7.1 g/L, representing a 21% increase relative to the control, with a yield of 0.79 mol/mol. In contrast, the PWΔnarQ strain was also evaluated and produced slightly less 3‐HP than the PW strain (0.97‐fold relative to PW), indicating that deletion of the regulator did not reproduce the beneficial effects observed for deletion of the downstream membrane‐associated genes.

To further assess production efficiency, flask‐scale fed‐batch fermentation was performed with glycerol maintained at 20–150 mM (Coenzyme B12 was added together with glycerol so that its final concentration reached 2 μM per 100 mM of glycerol). Unlike batch cultures, the fed‐batch process revealed dynamic production profiles as extracellular 3‐HP progressively accumulated. During the first 32 h, when 3‐HP concentrations remained relatively low, PWΔacrD exhibited the highest titer (14.4 g/L), corresponding to a 14% improvement over the wild‐type (12.5 g/L). As cultivation progressed beyond 44 h and extracellular 3‐HP concentrations rose, PWΔmliC outperformed PWΔacrD. By 68 h, PWΔmliC reached 18 g/L, an 18.4% improvement compared with the wild‐type (15.2 g/L) (Figure 4C).

4. Discussion

In this study, we established a high‐throughput screening strategy to identify genes involved in 3‐HP import. Using a fluorescence‐based biosensor and flow cytometry, we enriched and isolated variants with enhanced 3‐HP import, ultimately identifying NarQ as a key regulator. Functional analysis revealed that the histidine kinase activity of NarQ was essential for this phenotype and that NarQ enhanced 3‐HP import even in the absence of the canonical Nar two‐component system. Transcriptome profiling further demonstrated that NarQ overexpression transcriptionally upregulated multiple membrane‐associated genes, including acrD, mliC, and pgaABCD. Functional assays validated that these genes were part of the NarQ regulatory response: their overexpression increased intracellular 3‐HP levels, and their deletion improved 3‐HP titers in producing strains. While the exact mechanisms by which these genes influence 3‐HP import remain unclear, the data establish a clear regulatory link between NarQ signalling and membrane‐associated pathways controlling product import.

While both import and export across the cell envelope are critical for microbial survival and bioproduction, previous studies have primarily focused on efflux systems (Dunlop et al. 2011; Jones et al. 2015; Mukhopadhyay 2015). In contrast, import systems‐particularly those affecting non‐native metabolites‐remain poorly understood. Our findings demonstrate that NarQ regulates a set of membrane‐associated genes that collectively influence 3‐HP import, underscoring that import processes can be actively regulated rather than merely passive. This study highlights the value of phenotype‐based screening in uncovering such import‐related genes, which are unlikely to be identified by computational or homology‐based approaches alone.

NarQ is classically characterized as a nitrate‐sensing histidine kinase that transduces signals via NarL and NarP (Chiang et al. 1992; Stewart 2003). In this study, although the Nar system and kinase activity also appear to contribute to the NarQ‐associated increase in the 3‐HP import signal, the observed phenotype is not fully explained by the canonical Nar signalling cascade alone. NarQ overexpression still increased the 3‐HP import signal in the ΔnarQXLP background, suggesting that NarQ may influence this phenotype through targets beyond its established nitrate‐responsive regulon. This expands the functional scope of NarQ beyond its established role as a nitrate sensor and suggests that it potentially influences 3‐HP import through regulatory outputs not fully captured by the canonical Nar pathway.

The genes identified in this study are not readily explained by a single obvious mechanism for 3‐HP transport. Rather, their known functions suggest several plausible mechanisms by which they may contribute to the observed import phenotype. In E. coli , AcrD is an inner membrane transporter of the resistance‐nodulation‐division superfamily that is known to export aminoglycosides. AcrD functions with TolC, a major outer membrane exit channel that is shared by multiple trans‐envelope efflux and secretion systems rather than dedicated to a single transporter (Rosenberg et al. 2000; Elkins and Nikaido 2002; Aires and Nikaido 2005). In this context, altered acrD expression could increase demand for TolC‐dependent export and thereby influence the accessibility of this shared channel for other transport processes across the cell envelope (Yamamoto et al. 2016). The pgaABCD operon is responsible for the synthesis and export of poly‐β‐1,6‐N‐acetyl‐D‐glucosamine (PGA), which is an important determinant of biofilm‐associated surface structure (Itoh et al. 2008). PgaC and PgaD synthesize PGA and transport it from the cytosol to the periplasm, where PgaB partially deacetylates PGA, a modification required for its export through the outer membrane porin PgaA. Because partially deacetylated PGA is cationic and surface‐associated, altered PGA production could modify the local electrostatic and diffusion environment at the cell surface, potentially affecting the access of 3‐HP to the cell envelope (Itoh et al. 2008; Ostapska et al. 2018; Breslawec et al. 2022). MliC is an outer membrane protein whose function remains poorly characterized. However, overexpression of mliC has been reported to suppress the essentiality of lapB, which is required to maintain balanced lipopolysaccharide biogenesis and outer membrane integrity, suggesting a connection to envelope‐associated functions (Callewaert et al. 2008; Vanderkelen et al. 2012; Maniyeri et al. 2023). Taken together, these observations suggest that the genes linked to narQ may influence the observed 3‐HP import phenotype through indirect effects on shared transport routes, the local cell‐surface environment, or outer membrane integrity.

5. Conclusion

Collectively, this study establishes a systematic framework for identifying product import‐related genes directly from genomic DNA using a biosensor‐guided screening strategy. Although demonstrated here with 3‐HP in E. coli , the workflow can be broadly applicable to other non‐native metabolites and diverse microbial hosts. Furthermore, by integrating transcriptomic profiling, NarQ was unexpectedly shown to transcriptionally regulate genes that modulate 3‐HP import. These findings underscore the importance of genome‐wide functional screening of genes, offering new opportunities to enhance the efficiency of microbial production platforms.

Author Contributions

Ga Yeon Lim: data curation, formal analysis, writing – review and editing. Hyun Gyu Lim: conceptualization, validation, writing – original draft, project administration, supervision, funding acquisition, resources, writing – review and editing. Gyoo Yeol Jung: conceptualization, project administration, supervision, funding acquisition, resources, writing – review and editing. Seungjin Kim: conceptualization, investigation, formal analysis, data curation, visualization, writing – original draft, writing – review and editing. Junyeong Sung: formal analysis, data curation, visualization, investigation, writing – original draft, writing – review and editing.

Funding

This work was supported by Korea Institute of Marine Science and Technology promotion, RS‐2022‐KS221581; National Research Foundation of Korea, RS‐2024‐00334792, RS‐2024‐00399277; Korea Basic Science Institute, RS‐2024‐00403077.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Outer membrane permeability assessed by NPN uptake assay.

Figure S2: Gene Ontology (GO) enrichment analysis of differentially expressed genes in WT and ∆narQXLP strain.

MBT2-19-e70362-s001.docx (248.4KB, docx)

Acknowledgements

This research was supported by the Korea Institute of Marine Science and Technology Promotion (KIMST) and funded by the Ministry of Oceans and Fisheries [grant number RS‐2022‐KS221581]. This work was also supported by National Research Foundation of Korea (NRF) grants funded by the Korean government (MSIT) [grant numbers RS‐2024‐00334792 and RS‐2024‐00399277] and Korea Basic Science Institute (National Research Facilities and Equipment Center) grant funded by Ministry of Science and ICT [grant number RS‐2024‐00403077].

Contributor Information

Gyoo Yeol Jung, Email: gyjung@postech.ac.kr.

Hyun Gyu Lim, Email: hyungyu.lim@inha.ac.kr.

Data Availability Statement

The generated RNA sequencing data have been deposited to the NCBI GEO repository with the dataset identifier (GSE313402). Other data will be made available on request.

References

  1. Ahn, J. H. , Lee J. A., Bang J., and Lee S. Y.. 2018. “Membrane Engineering via Trans‐Unsaturated Fatty Acids Production Improves Succinic Acid Production in Mannheimia succiniciproducens .” Journal of Industrial Microbiology & Biotechnology 45: 555–566. 10.1007/s10295-018-2016-6. [DOI] [PubMed] [Google Scholar]
  2. Aires, J. R. , and Nikaido H.. 2005. “Aminoglycosides Are Captured From Both Periplasm and Cytoplasm by the AcrD Multidrug Efflux Transporter of Escherichia coli .” Journal of Bacteriology 187: 1923–1929. 10.1128/JB.187.6.1923-1929.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Àvila‐Cabré, S. , Albiol J., and Ferrer P.. 2025. “Metabolic Engineering of Komagataella phaffii for Enhanced 3‐Hydroxypropionic Acid (3‐HP) Production From Methanol.” Journal of Biological Engineering 19: 19. 10.1186/s13036-025-00488-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bhagwat, S. S. , Li Y., Cortés‐Peña Y. R., et al. 2021. “Sustainable Production of Acrylic Acid via 3‐Hydroxypropionic Acid From Lignocellulosic Biomass.” ACS Sustainable Chemistry & Engineering 9: 16659–16669. 10.1021/acssuschemeng.1c05441. [DOI] [Google Scholar]
  5. Braun, V. 2024. “Substrate Uptake by TonB‐Dependent Outer Membrane Transporters.” Molecular Microbiology 122: 929–947. 10.1111/mmi.15332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Breslawec, A. P. , Wang S., Monahan K. N., Barry L. L., and Poulin M. B.. 2022. “The Endoglycosidase Activity of Dispersin B Is Mediated Through Electrostatic Interactions Witcationic Poly‐β‐(1→6)‐N‐Acetylglucosamine.” FEBS Journal 290: 1049–1059. 10.1111/febs.16624. [DOI] [PubMed] [Google Scholar]
  7. Callewaert, L. , Aertsen A., Deckers D., et al. 2008. “A New Family of Lysozyme Inhibitors Contributing to Lysozyme Tolerance in Gram‐Negative Bacteria.” PLoS Pathogens 4: e1000019. 10.1371/journal.ppat.1000019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cavicchioli, R. , Schröder I., Constanti M., and Gunsalus R. P.. 1995. “The NarX and NarQ Sensor‐Transmitter Proteins of Escherichia coli Each Require Two Conserved Histidines for Nitrate‐Dependent Signal Transduction to NarL.” Journal of Bacteriology 177: 2416–2424. 10.1128/jb.177.9.2416-2424.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cheng, K. J. , Selvam B., Chen L.‐Q., and Shukla D.. 2019. “Distinct Substrate Transport Mechanism Identified in Homologous Sugar Transporters.” Journal of Physical Chemistry. B 123: 8411–8418. 10.1021/acs.jpcb.9b08257. [DOI] [PubMed] [Google Scholar]
  10. Chiang, R. C. , Cavicchioli R., and Gunsalus R. P.. 1992. “Identification and Characterization of narQ, a Second Nitrate Sensor for Nitrate‐Dependent Gene Regulation in Escherichia coli .” Molecular Microbiology 6: 1913–1923. 10.1111/j.1365-2958.1992.tb01364.x. [DOI] [PubMed] [Google Scholar]
  11. Datsenko, K. A. , and Wanner B. L.. 2000. “One‐Step Inactivation of Chromosomal Genes in Escherichia coli K‐12 Using PCR Products.” Proc. Natl. Acad. Sci. USA 97: 6640–6645. 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dunlop, M. J. , Dossani Z. Y., Szmidt H. L., et al. 2011. “Engineering Microbial Biofuel Tolerance and Export Using Efflux Pumps.” Molecular Systems Biology 7: 487. 10.1038/msb.2011.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Elkins, C. A. , and Nikaido H.. 2002. “Substrate Specificity of the RND‐Type Multidrug Efflux Pumps AcrB and AcrD of Escherichia coli Is Determined Predominantly by Two Large Periplasmic Loops.” Journal of Bacteriology 184: 6490–6498. 10.1128/JB.184.23.6490-6499.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gubellini, F. , Verdon G., Karpowich N. K., et al. 2011. “Physiological Response to Membrane Protein Overexpression in E. coli .” Molecular & Cellular Proteomics 10: M111.007930. 10.1074/mcp.M111.007930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Helander, I. M. , and Mattila‐Sandholm T.. 2000. “Fluorometric Assessment of Gram‐Negative Bacterial Permeabilization.” Journal of Applied Microbiology 88: 213–219. 10.1046/j.1365-2672.2000.00971.x. [DOI] [PubMed] [Google Scholar]
  16. Huang, X. , Anderle P., Hostettler L., et al. 2018. “Identification of Placental Nutrient Transporters Associated With Intrauterine Growth Restriction and Pre‐Eclampsia.” BMC Genomics 19: 173. 10.1186/s12864-018-4518-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Itoh, Y. , Rice J. D., Goller C., et al. 2008. “Roles of pgaABCD Genes in Synthesis, Modification, and Export of the Escherichia coli Biofilm Adhesin Poly‐Beta‐1,6‐N‐Acetyl‐D‐Glucosamine.” Journal of Bacteriology 190: 3670–3680. 10.1128/JB.01920-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jenkins Sánchez, L. R. , Claus S., Muth L. T., Salvador López J. M., and Van Bogaert I.. 2022. “Force in Numbers: High‐Throughput Screening Approaches to Unlock Microbial Transport.” Current Opinion in Biotechnology 74: 204–210. 10.1016/j.copbio.2021.11.012. [DOI] [PubMed] [Google Scholar]
  19. Jones, C. M. , Hernández Lozada N. J., and Pfleger B. F.. 2015. “Efflux Systems in Bacteria and Their Metabolic Engineering Applications.” Applied Microbiology and Biotechnology 99: 9381–9393. 10.1007/s00253-015-6963-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kamimoto, Y. , Terasaka K., Hamamoto M., et al. 2012. “Arabidopsis ABCB21 Is a Facultative Auxin Importer/Exporter Regulated by Cytoplasmic Auxin Concentration.” Plant & Cell Physiology 53: 2090–2100. 10.1093/pcp/pcs149. [DOI] [PubMed] [Google Scholar]
  21. Kim, B. , Binkley R., Kim H. U., and Lee S. Y.. 2018. “Metabolic Engineering of Escherichia coli for the Enhanced Production of l‐Tyrosine.” Biotechnology and Bioengineering 115: 2554–2564. 10.1002/bit.26797. [DOI] [PubMed] [Google Scholar]
  22. Kim, S. , Jin S. H., Lim H. G., et al. 2021. “Synthetic Cellular Communication‐Based Screening for Strains With Improved 3‐Hydroxypropionic Acid Secretion.” Lab on a Chip 21: 4455–4463. 10.1039/d1lc00676b. [DOI] [PubMed] [Google Scholar]
  23. Korosh, T. C. , Markley A. L., Clark R. L., McGinley L. L., McMahon K. D., and Pfleger B. F.. 2017. “Engineering Photosynthetic Production of L‐Lysine.” Metabolic Engineering 44: 273–283. 10.1016/j.ymben.2017.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kumar, V. , Ashok S., and Park S.. 2013. “Recent Advances in Biological Production of 3‐Hydroxypropionic Acid.” Biotechnology Advances 31: 945–961. 10.1016/j.biotechadv.2013.02.008. [DOI] [PubMed] [Google Scholar]
  25. Liang, B. , Sun G., Zhang X., Nie Q., Zhao Y., and Yang J.. 2022. “Recent Advances, Challenges and Metabolic Engineering Strategies in the Biosynthesis of 3‐Hydroxypropionic Acid.” Biotechnology and Bioengineering 119: 2639–2668. 10.1002/bit.28170. [DOI] [PubMed] [Google Scholar]
  26. Lim, H. G. , Fong B., Alarcon G., et al. 2020. “Generation of Ionic Liquid Tolerant Pseudomonas putida KT2440 Strains via Adaptive Laboratory Evolution.” Green Chemistry 22: 5677–5690. 10.1039/D0GC01663B. [DOI] [Google Scholar]
  27. Lim, H. G. , Noh M. H., Jeong J. H., Park S., and Jung G. Y.. 2016. “Optimum Rebalancing of the 3‐Hydroxypropionic Acid Production Pathway From Glycerol in Escherichia coli .” ACS Synthetic Biology 5: 1247–1255. 10.1021/acssynbio.5b00303. [DOI] [PubMed] [Google Scholar]
  28. Maniyeri, A. , Wieczorek A., Ayyolath A., Sugalska W., Klein G., and Raina S.. 2023. “Suppressors of lapC Mutation Identify New Regulators of LpxC, Which Mediates the First Committed Step in Lipopolysaccharide Biosynthesis.” International Journal of Molecular Sciences 24: 15174. 10.3390/ijms242015174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mathieu, K. , Javed W., Vallet S., et al. 2019. “Functionality of Membrane Proteins Overexpressed and Purified From E. coli Is Highly Dependent Upon the Strain.” Scientific Reports 9: 2654. 10.1038/s41598-019-39382-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Matsakas, L. , Hrůzová K., Rova U., and Christakopoulos P.. 2018. “Biological Production of 3‐Hydroxypropionic Acid: An Update on the Current Status.” Fermentation 4: 13. 10.3390/fermentation4010013. [DOI] [Google Scholar]
  31. Mukhopadhyay, A. 2015. “Tolerance Engineering in Bacteria for the Production of Advanced Biofuels and Chemicals.” Trends in Microbiology 23: 498–508. 10.1016/j.tim.2015.04.008. [DOI] [PubMed] [Google Scholar]
  32. Ni, Y. , and Chen R. R.. 2004. “Accelerating Whole‐Cell Biocatalysis by Reducing Outer Membrane Permeability Barrier.” Biotechnology and Bioengineering 87: 804–811. 10.1002/bit.20202. [DOI] [PubMed] [Google Scholar]
  33. Onyeabor, M. , Martinez R., Kurgan G., and Wang X.. 2020. “Engineering Transport Systems for Microbial Production.” Advances in Applied Microbiology 111: 33–87. 10.1016/bs.aambs.2020.01.002. [DOI] [PubMed] [Google Scholar]
  34. Ostapska, H. , Howell P. L., and Sheppard D. C.. 2018. “Deacetylated Microbial Biofilm Exopolysaccharides: It Pays to Be Positive.” PLoS Pathogens 14: e1007411. 10.1371/journal.ppat.1007411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Qin, N. , Li L., Wan X., et al. 2024. “Increased CO2 Fixation Enables High Carbon‐Yield Production of 3‐Hydroxypropionic Acid in Yeast.” Nature Communications 15: 1591. 10.1038/s41467-024-45557-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rabin, R. S. , and Stewart V.. 1993. “Dual Response Regulators (NarL and NarP) Interact With Dual Sensors (NarX and NarQ) to Control Nitrate‐ and Nitrite‐Regulated Gene Expression in Escherichia coli K‐12.” Journal of Bacteriology 175: 3259–3268. 10.1128/jb.175.11.3259-3268.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ravi, S. N. , and Sankaranarayanan M.. 2023. “Enhanced Synthesis of 3‐Hydroxypropionic Acid by Eliminating By‐Products Using Recombinant Escherichia coli as a Whole Cell Biocatalyst.” Topics in Catalysis 67: 169–180. 10.1007/s11244-023-01796-6. [DOI] [Google Scholar]
  38. Rosenberg, E. Y. , Ma D., and Nikaido H.. 2000. “AcrD of Escherichia coli Is an Aminoglycoside Efflux Pump.” Journal of Bacteriology 182: 1754–1756. 10.1128/JB.182.6.1754-1756.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sandberg, T. E. , Salazar M. J., Weng L. L., Palsson B. O., and Feist A. M.. 2019. “The Emergence of Adaptive Laboratory Evolution as an Efficient Tool for Biological Discovery and Industrial Biotechnology.” Metabolic Engineering 56: 1–16. 10.1016/j.ymben.2019.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sankaranarayanan, M. , Ashok S., and Park S.. 2014. “Production of 3‐Hydroxypropionic Acid From Glycerol by Acid Tolerant Escherichia coli .” Journal of Industrial Microbiology & Biotechnology 41: 1039–1050. 10.1007/s10295-014-1451-2. [DOI] [PubMed] [Google Scholar]
  41. Seok, J. Y. , Yang J., Choi S. J., et al. 2018. “Directed Evolution of the 3‐Hydroxypropionic Acid Production Pathway by Engineering Aldehyde Dehydrogenase Using a Synthetic Selection Device.” Metabolic Engineering 47: 113–120. 10.1016/j.ymben.2018.03.009. [DOI] [PubMed] [Google Scholar]
  42. Stewart, V. 2003. “Nitrate‐ and Nitrite‐Responsive Sensors NarX and NarQ of Proteobacteria.” Biochemical Society Transactions 31: 1–10. 10.1042/bst0310001. [DOI] [PubMed] [Google Scholar]
  43. Sugiyama, Y. , Nakamura A., Matsumoto M., et al. 2016. “A Novel Putrescine Exporter SapBCDF of Escherichia coli .” Journal of Biological Chemistry 291: 26343–26351. 10.1074/jbc.M116.762450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Vanderkelen, L. , Ons E., Van Herreweghe J. M., Callewaert L., Goddeeris B. M., and Michiels C. W.. 2012. “Role of Lysozyme Inhibitors in the Virulence of Avian Pathogenic Escherichia coli .” PLoS One 7: e45954. 10.1371/journal.pone.0045954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wagner, S. , Baars L., Ytterberg A. J., et al. 2007. “Consequences of Membrane Protein Overexpression in Escherichia coli .” Molecular & Cellular Proteomics 6: 1527–1550. 10.1074/mcp.M600431-MCP200. [DOI] [PubMed] [Google Scholar]
  46. Wang, L. , Li N., Yu S., and Zhou J.. 2023. “Enhancing Caffeic Acid Production in Escherichia coli by Engineering the Biosynthesis Pathway and Transporter.” Bioresource Technology 368: 128320. 10.1016/j.biortech.2022.128320. [DOI] [PubMed] [Google Scholar]
  47. Wang, X. , Cui Z., Sun X., Wang Z., and Chen T.. 2023. “Production of 3‐Hydroxypropionic Acid From Renewable Substrates by Metabolically Engineered Microorganisms: A Review.” Molecules 28: 1888. 10.3390/molecules28041888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wu, T. , Jiang J., Zhang H., Liu J., and Ruan H.. 2024. “Transcending Membrane Barriers: Advances in Membrane Engineering to Enhance the Production Capacity of Microbial Cell Factories.” Microbial Cell Factories 23: 154. 10.1186/s12934-024-02436-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yamada, Y. , Nakagawa A., Sato F., Minami H., and Shitan N.. 2022. “Transport Engineering Using Tobacco Transporter NtJAT1 Enhances Alkaloid Production in Escherichia coli .” Bioscience, Biotechnology, and Biochemistry 86: 865–869. 10.1093/bbb/zbac056. [DOI] [PubMed] [Google Scholar]
  50. Yamamoto, K. , Tamai R., Yamazaki M., Inaba T., Sowa Y., and Kawagishi I.. 2016. “Substrate‐Dependent Dynamics of the Multidrug Efflux Transporter AcrB of Escherichia coli .” Scientific Reports 6: 21909. 10.1038/srep21909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang, Y. , Yun J., Zhang G., et al. 2023. “Efficient Biosynthesis of 3‐Hydroxypropionic Acid From Glucose Through Multidimensional Engineering of Escherichia coli .” Bioresource Technology 389: 129822. 10.1016/j.biortech.2023.129822. [DOI] [PubMed] [Google Scholar]
  52. Zhang, Z. , Feige J. N., Chang A. B., et al. 2003. “A Transporter of Escherichia coli Specific for L‐ and D‐Methionine Is the Prototype for a New Family Within the ABC Superfamily.” Archives of Microbiology 180: 88–100. 10.1007/s00203-003-0561-4. [DOI] [PubMed] [Google Scholar]
  53. Zhou, S. , Ainala S. K., Seol E., Nguyen T. T., and Park S.. 2015. “Inducible Gene Expression System by 3‐Hydroxypropionic Acid.” Biotechnology for Biofuels 8: 169. 10.1186/s13068-015-0353-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: Outer membrane permeability assessed by NPN uptake assay.

Figure S2: Gene Ontology (GO) enrichment analysis of differentially expressed genes in WT and ∆narQXLP strain.

MBT2-19-e70362-s001.docx (248.4KB, docx)

Data Availability Statement

The generated RNA sequencing data have been deposited to the NCBI GEO repository with the dataset identifier (GSE313402). Other data will be made available on request.

Articles from Microbial Biotechnology are provided here courtesy of Wiley

RESOURCES