Abstract
Introduction
The objective of this study was to investigate the effects of parathyroid hormone on tooth movement and uncover its mechanism from a metabolic perspective.
Methods
The influences of parathyroid hormone on PDLCs osteogenic differentiation and monocyte osteoclastic differentiation were investigated. According to the RNA-seq analysis, glucose metabolism has been discussed subsequently. Mouse maxillary first molar mesial movement model was constructed to estimate the effects of parathyroid administration on alveolar bone remodelling and tooth movement.
Results
Parathyroid administration accelerated mouse maxillary first molar mesial movement by promoting alveolar bone remodelling. The expression of osteogenic markers and the number and surface of osteoclast cells were promoted. Parathyroid hormone administration facilitates PDLCs osteogenic differentiation and monocytes osteoclastic differentiation synchronously. RNA-seq indicated that parathyroid administration mainly affects the metabolism and cellular signalling of PDLCs. Parathyroid administration enhanced glucose uptake, glucose consumption and aerobic glycolysis of PDLCs while exhibiting no obvious effects on the Krebs cycle and oxidative phosphorylation. Moreover, mitochondrial fission of PDLCs was promoted after parathyroid administration. Furthermore, results indicated that parathyroid administration promoted the expression of GLUT1, HK1 and LDHA. Inhibition of mitochondrial midzone fission partially alleviated the osteo-inductive effects of parathyroid hormone.
Conclusions
Collectively, parathyroid hormone regulates PDLCs aerobic glycolysis and mitochondrial fission to promote alveolar bone remodelling, and metabolic reprogramming is of vital importance in the processes of orthodontic tooth movement.
Clinical Relevance
This study elucidates the role of metabolites associated with parathyroid hormones in tooth movement, and lays a foundation for regulating the speed of tooth movement by monitoring their activity.
KEY WORDS: Alveolar bone remodelling, PDLCs, Metabolic reprogramming, PTH, Aerobic glycolysis
Introduction
The prevalence of malocclusion worldwide is 56%, and the percentages are even higher in Africa and Europe, with 81% and 72%, respectively.1 Given that malocclusion shows harmful effects on oral function, appearance and even mental health, the requests for orthodontic treatment have increased gradually. Orthodontic tooth movement (OTM) is based on the metabolic homeostasis of alveolar bone under mechanically stimulated. It involves the osteogenesis process of periodontal ligament cells (PDLCs) on the tension side and the alveolar bone resorption effect of osteoclast cells on the compression side.2 PDLCs regulate alveolar bone remodelling by secreting cytokines to facilitate mineral matrix deposition and induction of monocytes osteoclast differentiation under orthodontic force, which exhibits non-negligible effects during OTM.3 Hence, optimising PDLCs functions could facilitate tooth movement and avoid unfavourable side effects under mechanical stimuli. Moreover, clarifying the underlying mechanism by which OTM regulates alveolar bone remodelling can deepen the understanding of OTM, beneficial for the invention of orthodontic techniques, and provide more treatment targets for accelerating OTM.
Parathyroid hormone (PTH), a biological peptide hormone, is essential for both calcium and phosphorus metabolism and regulates bone remodelling by inducing osteoblast and osteoclast cells differentiation.4 Previous studies indicate that intermittent PTH administration facilitates bone formation by inducing osteogenic differentiation of osteoblast cells while continuous PTH administration promotes bone resorption by regulating the RANKL/OPG ratio.5,6 Even though the effects of PTH on bones of the trunk have been studied for years and daily administration of PTH has been proposed for the treatment of osteoporosis, the effects of PTH on alveolar bone are not clearly understood. Intermittent PTH application has been proved to be favourable to postorthodontic retention via IGF-1 pathway.7 Zhang et al.8 found that intermittent application of PTH could reduce rat alveolar bone loss during OTM with periodontitis. Their results indicated the anabolic effects of intermittent PTH application on alveolar bone. However, other studies found that PTH injection accelerates OTM by inducing bone resorption, and the results exhibited the catabolic effects of intermittent PTH administration on alveolar bone.9,10 Considering the dual effects of PTH on alveolar bone metabolism, we propose that intermittent PTH administration enhances bone remodelling by promoting osteogenesis and osteoclasis synchronously, and PTH might be a favourable candidate for accelerating OTM.
Glucose metabolism can be achieved by using glucose to generate pyruvate, and the latter metabolite could generate ATP either by LDHA or through the Krebs cycle and oxidative phosphorylation (OXPHOS), which provides energy for a variety of biological and pathological processes in cells.11 Extant studies indicate that the anabolic and catabolic effects of PTH on osteoblasts are associated with glucose metabolism and mitochondrial function regulation.12 Although OXPHOS can generate more ATP for biosynthesis, recent studies indicate that aerobic glycolysis plays a predominant role in the anabolic effects of osteoblasts.13 However, to date, research has not focused on the effects of PTH on the glucose metabolism of PDLCs. Moreover, the effect of glucose metabolism on OTM is elusive. A recent study has indicated that glucose transporter 1 affects receptor activation of RANKL/OPG signals and thus influences the osteoclast effects in the compression site of OTM, which revealed the importance of glucose metabolism on OTM.14
This study aims to elucidate the effects of PTH on the glucose metabolism of PDLCs during OTM. In the current study we found that PTH administration could facilitate osteogenic and osteoclastic effects on alveolar bone synchronously. PTH facilitates PDLCs aerobic glycolysis to generate ATP for bone remodelling while showing no obvious influence on the Krebs cycle and OXPHOS. Furthermore, PTH administration could accelerate OTM, which provides a new clinical strategy for modulating orthodontic treatment.
Methods
Cell culture and treatment
Primary periodontal ligament cells were obtained from patients who received premolar extraction before orthodontic treatment at Shanghai Ninth Peoples’ Hospital. The protocol was approved by the Institutional Research Ethics Committee of Shanghai Ninth Peoples’ Hospital (SH9H-2022-TK356-1). The extracted premolars were obtained from patients aged 18 to 30 years, without systematic diseases and periodontitis. Cells were applied for experiments at passages 3 to 6.
THP-1 cell was cultured in RPMI 1640 containing 10% FBS and 100 U/ml penicillin and 100 μg/mL streptomycin. PMA (100 ng/mL) was applied to THP-1 cells and co-cultured with PTH pretreated PDLCs using Transwell system. To induce THP-1 osteoclastic differentiation, THP-1 was stimulated with 50 ng/mL RANKL and M-CSF. After 7 days of stimulation, the cells were applied for further experiments.
For intermittent PTH administration, 1 μg/mL human PTH (1-84) was added to the culture medium for 6 hours, followed by replacement with PTH-free medium for 18 hours. The aforementioned cultivation mode continued for 1 cycle, and the total intermittent PTH administration involved at least 3 cycles before experiments.7,8
ALP staining and quantitative assay
After 3 cycles of intermittent PTH administration, the ALP activity of PDLCs was evaluated using the BCIP/NBT Alkaline Phosphatase Color Development Kit. The ALP was also quantitively measured using an Alkaline Phosphatase Assay Kit. Both assays were performed according to the manufacturer’s instructions.
Alizarin red S staining
For the preparation of the alizarin red S solution, 1g Tris was added into ddH2O, and the pH was adjusted to 4.2. Then, 2 g Alizarin Red S was dissolved in the solution, which was then filtered for further experiments. After 21 days of cultivation of intermittent PTH-treated PDLCs, cells were fixed with 4% paraformaldehyde and stained with alizarin red S solution for 30 minutes. The cells were washed with ddH2O and observed using stereomicroscopy.
Quantitative real-time polymerase chain reaction (qRT-PCR)
After intermittent PTH treatment, the total RNA was isolated using FastPure Cell/Tissue Total RNA Isolation Kit V2 according to the manufacturer’s instructions. cDNA was generated using PrimeScript RT Master Mix. qRT-PCR was performed using SYBR Green Master Mix in the QuantStudio 6 Flex System. RPS18 was selected as the internal control; the primer sequences applied in this study are listed in Table 1.
Table 1.
Primer pairs used in qRT-PCR analysis.
| Gene | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|
| ALP | ACTGGTACTCAGACAACGAGAT | ACGTCAATGTCCCTGATGTTATG |
| COL Iα1 | GTGCGATGACGTGATCTGTGA | CGGTGGTTTCTTGGTCGGT |
| Runx2 | CCGCCTCAGTGATTTAGGGC | GGGTCTGTAATCTGACTCTGTCC |
| BSP | CCCCACCTTTTGGGAAAACCA | TCCCCGTTCTCACTTTCATAGAT |
| OCN | GGCGCTACCTGTATCAATGG | GTGGTCAGCCAACTCGTCA |
| RANK | CACCAAATGAACCCCATGTTTAC | GGACTCCTTATCTCCACTTAGGC |
| CTSK | GGGGGACATGACCAGTGAAG | CAGAGTCTGGGGCTCTACCT |
| Cathepsin | TATGTGCAGAAGAACCGGGG | GAAGGAGGTCAGGCTTGCAT |
| TRAP | TGAGGACGTATTCTCTGACCG | CACATTGGTCTGTGGGATCTTG |
| MMP9 | TCTATGGTCCTCGCCCTGAA | CATCGTCCACCGGACTCAAA |
| MCSFR | GGTGAAAGGAAATGCCCGTC | GGCCACTCTGCTCTCCTGACTC |
| HK1 | CACATGGAGTCCGAGGTTTATG | CGTGAATCCCACAGGTAACTTC |
| HK2 | TTGACCAGGAGATTGACATGGG | CAACCGCATCAGGACCTCA |
| PFKP | GACCTTCGTTCTGGAGGTGAT | CACGGTTCTCCGAGAGTTTG |
| PFKL | GTACCTGGCGCTGGTATCTG | CCTCTCACACATGAAGTTCTCC |
| PFKM | GGTGCCCGTGTCTTCTTTGT | AAGCATCATCGAAACGCTCTC |
| PKM | ATGTCGAAGCCCCATAGTGAA | TGGGTGGTGAATCAATGTCCA |
| LDHA | ATGGCAACTCTAAAGGATCAGC | CCAACCCCAACAACTGTAATCT |
| PDHA | TGGTAGCATCCCGTAATTTTGC | ATTCGGCGTACAGTCTGCATC |
| PDHB | AAGAGGCGCTTTCACTGGAC | ACTAACCTTGTATGCCCCATCA |
| IDH3A | TGCTGCCAAAGCACCTATTCA | GTGACCGGCTGCTATTGGG |
| IDH2 | CCCGTATTATCTGGCAGTTCATC | ATCAGTCTGGTCACGGTTTGG |
| SDH | AAGAGGCGCTTTCACTGGAC | ACTAACCTTGTATGCCCCATCA |
| DRP1 | CTGCCTCAAATCGTCGTAGTG | GAGGTCTCCGGGTGACAATTC |
| MFN2 | CTCTCGATGCAACTCTATCGTC | TCCTGTACGTGTCTTCAAGGAA |
| OPA1 | TGTGAGGTCTGCCAGTCTTTA | TGTCCTTAATTGGGGTCGTTG |
| RPS18 | GCGGCGGAAAATAGCCTTTG | GATCACACGTTCCACCTCATC |
Glucose consumption and glucose uptake assay
After 3 cycles of PTH stimulation, cells were cultured in a medium containing 25 mM glucose, and the culture medium was collected at 0, 6, 12 and 24 hours. The glucose concentration in the supernatant at different time points was measured to calculate the glucose consumption rate. To detect the glucose uptake, after 3 rounds of PTH stimulation, 100 μM 2-NBDG was added to the culture medium and incubated for 1 hour. Subsequently, glucose uptake was visualised using a confocal microscope.
NAD+/NADH assay, ATP assay, Mito-Tracker assay and Seahorse assay
NAD+/NADH assay and ATP assay were performed according to the manufacture’s instruction. To observe the morphological changes of mitochondria, 200 nM Mito-Tracker Red CMXRos was added to the culture medium of PDLCs and incubated for 30 minutes at 37 °C. Cells were then fixed and visualised under a confocal microscope. The glycolytic rate was analysed with a Seahorse X96 extracellular flux analyser.
Establishment of orthodontic tooth movement model and administration of PTH
Animal experiments were approved by the Biomedical Ethics Committee of Shanghai Ninth People’s Hospital (SH9H-2023-A108-SB). Male C57BL/6 mice aged 8 weeks were randomly divided into 2 groups with 5 mice in each group. After general anaesthesia, a 0.02-inch ligature wire was threaded through the distal adjacent space of the maxillary first molar, and a nickel titanium spring was fixed to the mesial region of the tooth. The nickel-titanium spring was stretched to confirm a loading force of 30 g, and the other end of the spring was fixed to the incisors. Subsequently, the upper central incisors were etched with phosphoric acid and covered with light-cured resin following prebonding treatment. After surgery, 80 μg/kg PTH was injected daily into the buccal and palatal mucosa of the maxillary first molar. The dosage used for in vivo experiments was based on previously published studies.15, 16, 17 After 7 days of surgery, animals were euthanised using anaesthesia overdose, and the maxillae were dissected and fixed for further analysis. This study adhered to the ARRIVE 2.0 (Animal Research: Reporting 24 In Vivo Experiments) guidelines.
Histological staining and micro-CT scanning
Maxillae were first observed under a stereomicroscope. Subsequently, maxillae were scanned with a micro-CT scanner, and 3-dimensional reconstruction and X-ray imaging were processed to assess the movement of the first molar.
Tissues were decalcified and embedded, and 5-μm specimens were made for histological and immunological staining. Haematoxylin and eosin (H&E) staining, Masson staining and TRAP staining were processed according to the instructions. Immuno-histological staining of BMP2, OCN and OPG was conducted to evaluate alveolar bone remodelling with and without PTH stimulation. The staining was performed as described in our previous published work.18
Statistical analysis
Results are presented as the means ± standard deviation. Statistical comparisons between groups were performed using a t-test (SPSS 13.0). Differences were defined as statistically significant if *P < .05, ⁎⁎P < .01, ⁎⁎⁎P < .001. Experiments were independently repeated at least 3 times
Results
PTH administration accelerates orthodontic tooth movement in vivo
The current study first estimated the effects of PTH on OTM in vivo. X-ray results showed that an increase in periodontal space was observed on the tension side of the first molar in PTH-stimulated mice while no significant OTM was observed between the first and second molars of the control group (Figure 1A). Similar to the X-ray result, microscopic photos showed obvious OTM distance in the PTH group (Figure 1C). H&E staining showed that the periodontal ligament width on the compression side was thinner than on the tension side. The arrangement of the periodontal ligament on the compression side was disordered. The alveolar bone surface of both control and PTH groups was irregular, and it was more obvious in the PTH group, which shows positive alveolar bone absorption. On the tension side, new bone deposition was found, and the periodontal ligament was clearly stretched in the PTH group (Figure 1B and Figure S1). Masson staining showed disorganised collagen fibre arrangement on the compression side and stretched collagen fibres on the tension side. Furthermore, the percentage of collagen in the PTH group was higher than in the control group (Figure 1D and Figure S2). Quantitative analysis showed that orthodontic tooth movement distance and periodontal ligament width at the tension site were significantly higher in the PTH group (Figure S3).
Fig. 1.
PTH administration accelerates orthodontic tooth movement. A, Representative images of X-ray scanning showing the distance between the first and second molars was higher in the PTH group. Scale bars = 1 mm. B, Representative images of haematoxylin and eosin (H&E) staining of control and PTH groups in orthodontic tooth moving model. Original magnification: x100 (Mesial Root) and x200 (tension and compression sides). Scale bars = 100 μm. C, The distance between the first and second molars was observed with a stereomicroscope. Scale bars = 1 mm. D, Histological measurement of collagen fibre content on Masson-stained sections. Original magnification: x100 (mesial root) and x200 (tension and compression sides). Scale bars = 100 μm. E, Immunohistochemical (IHC) staining showed higher expressions of BMP2 and OCN and lower expression of OPG in the PTH group. F, Representative tartrate-resistant acid phosphatase (TRAP) staining images of control and PTH groups in the orthodontic tooth moving model. Original magnification: x200. Scale bars = 100 μm.
Immunohistochemistry staining results showed that the expression of BMP2 and OCN was significantly higher in the periodontal ligament areas of the PTH group, which indicated the active osteogenic potential of PTH. The expression of OPG was significantly lower in the PTH group. This indicated that the ability to inhibit osteoclastic differentiation was weakened in the PTH group, which was beneficial for alveolar bone adsorption on the compression side, and accelerated OTM in the PTH group (Figure 1E and Figure S4). In addition, TRAP staining showed that TRAP-positive multinucleated cells were obvious in the PTH administration group (Figure 1F). The number and surface area of osteoclast cells were significantly higher in the PTH administration group (Figure S5). Overall, PTH administration was shown to facilitate bone adsorption and bone deposition synchronously, promote alveolar bone remodelling and accelerate OTM.
PTH facilitate osteogenic and osteoclastic differentiation synchronously in vitro
The influence of PTH on osteogenic differentiation of PDLCs cells was investigated. After 3 cycles of PTH stimulation, ALP staining showed that PTH administration observably enhanced the expression of ALP (Figure 2A). At the same time, ALP activity has been quantitatively detected. The results showed that PTH increased ALP activity significantly (Figure 2C). Alizarin red staining showed that the PTH group exhibited a higher amount of calcium nodules, which indicated that PTH administration can facilitate calcium ions deposition (Figure 2B and Figure S6). qRT-PCR showed that PTH application can significantly increase the expression of osteogenic associated genes, including ALP, Runx2, Col Iα1, BSP and OCN, both at day 3 and day 7 (Figure 2D). At 21 days post–PTH administration, the expression of OCN, an osteogenic marker at the late stage, was obviously promoted (Figure S7). The aforementioned results showed that intermittent PTH administration can facilitate PDLCs osteogenic differentiation.
Fig. 2.
PTH facilitates osteogenic and osteoclastic differentiation of PDLCs synchronously. ALP staining (A) (original magnification: x35, scale bar = 200 μm) and ALP activity (B) exhibited higher ALP expression and activity in PTH stimulated PDLCs. C, Alizarin Red staining showed obvious higher calcium nodule deposition in the PTH administrated group. D, qRT-PCR results indicated that ALP, OCL Iα1, Runx2, BSP and OCN expressions were significantly higher after PTH administration both at day 3 and day 7. E, TRAP staining showed more TRAP-positive cell expression in the PTH group (original magnification: x40, scale bar = 200 μm). F, qRT-PCR showed higher expression of osteoclastic associated genes in the PTH group, including RANK, CTSK, Cathepsin, TRAP, MMP9 and MCSFR. P < .05 represents a significant difference. *P < .05, ⁎⁎P < .01, ⁎⁎⁎P < .001.
Furthermore, PTH-treated PDLCs were co-cultured with THP-1 for 1 week to observe their influence on monocyte osteoclastic differentiation. TRAP staining showed that, compared with the control group, the PTH group exhibited more multinucleated TRAP-positive cells, and the cells were larger in size (Figure 2E). Moreover, qRT-PCR also exhibited higher expression levels of RANK, CTSK, Cathepsin, TRAP, MMP9 and MCSFR in PTH-treated PDLCs and THP-1 co-cultured system (Figure 2F). Therefore, PTH-treated PDLCs facilitated THP-1 cells osteoclastic differentiation.
Collectively, PTH administration not only promoted PDLCs osteogenic differentiation but also induced THP-1 cells osteoclastic differentiation synchronously. Therefore, the application of PTH facilitated alveolar bone remodelling rather than playing a singular role in bone metabolism.
PTH mainly influences PDLCs metabolism and signalling transduction
To gain insight into the mechanism by which PTH influences PDLCs function, we explored the potential impacts through RNA sequencing experiments. After 3 cycles of PTH stimulation, compared with the control group, the PTH group showed 154 genes upregulated and 228 genes downregulated (Figure 3A, B). KEGG annotation analysis showed that the differentiated expressed genes mainly focused on metabolism, the endocrine system and signalling transduction (Figure 3C). Similar to that, reactome annotation analysis also demonstrated the importance of signal transduction and metabolism in the impact of PTH on PDLCs function (Figure 3E). Moreover, GO annotation analysis showed that PTH predominantly regulated cellular processes, biological regulation and metabolic process. In terms of the cellular component, PTH mainly influenced the cell part and the organelle (Figure 3D). Given that the signalling transduction of PTH has been investigated for years, here we set our sights on the perspectives of glucose metabolism and mitochondrial function. The differential expressed genes associated with metabolism have also been analysed (see Figure 4A).
Fig. 3.
PTH administration mainly influences PDLCs metabolism and signalling transduction. A, RNA-seq results showed that, after PTH administration, 154 genes were upregulated and 228 genes were downregulated. B, A heat map exhibited differentially expressed genes according to the RNA-seq result. KEGG analysis (C), GO annotations analysis (D) and Reactome annotations analysis (E) results indicated that the endocrine system, metabolism, signal transduction and organelles were key reactive aspects during PTH administration.
Fig. 4.
PTH regulates PDLCs osteogenic via aerobic glycolysis. A, A heat map exhibited differentially expressed genes that were associated with metabolism according to RNA-seq result. B, qRT-PCR showed that the expression of glycolysis-associated genes, including HK1, HK2, PFKP, PFKM, PFKL, PKM and LDHA, was significantly increased in the PTH group, while it exhibited little effect on Kreb cycle–associated genes, including PDHA, PDHB, IDH3A, IDH2 and SDH. Glucose consumption (C) and glucose intake (D) results showed that PTH significantly promoted the intake and consumption of glucose. Original magnification: x200. Scale bar = 100 μm. E, Considering the effect of glucose consumption on the Kreb cycle, NAD+/NADH was examined, and no obvious influence of PTH on NAD+, NADH and NADHtotal was observed. Moreover, the ratios of NAD+/NADHtotal and NADH/NADHtotal showed no significant statistical difference. F, PTH administration significantly increased the content of ATP in PDLCs, which should be generated from aerobic glycolysis. G, PTH administration showed higher amounts of mitochondria, which were dispersed throughout the cytoplasm with rich network connections. Original magnification: x400. Scale bar = 10 μm. H, qRT-PCR showed that PTH significantly increased the expression of DRP1, which is correlated to mitochondrial fission. P < .05 represents a significant difference. *P < .05, ⁎⁎P < .01, ⁎⁎⁎P < .001.
PTH regulates PDLCs osteogenic via aerobic glycolysis
To investigate the influence of PTH administration on the glucose metabolism and mitochondrial function of PDLCs, we first analysed the genes associated with glucose metabolism (Figure 4A). qRT-PCR showed that PTH administration increased the expression of HK1, HK2, PFKP, PFKL, PFKM and PKM, which are the rate-limiting enzymes of glucose metabolism. The results indicated that PDLCs used more glucose after PTH stimulation. Furthermore, PTH significantly increased the expression of LDHA, while it exhibited no influence on genes associated with the Krebs Cycle (Figure 4B). The glucose consumption and glucose uptake assays showed that PTH significantly enhanced glucose usage (Figure 4C, D), which was in accordance with the higher expression of glucose metabolism–associated genes. The NADH/NAD+ experiment exhibited slightly higher concentrations of NADH, NAD+ and NADHtotal compared with those of the control group, but the differences were not significant. Moreover, the NADH/NADHtotal and NAD+/NADHtotal showed no significant difference between control and PTH groups (Figure 4E). These results demonstrated that PTH converted pyruvate into lactic acid via aerobic glycolysis even under oxygen conditions instead of converting pyruvate to acetyl-CoA for the Krebs cycle and OXPHOS. The ATP assay revealed higher ATP concentration in the PTH group compared with the control group, which is essential for tissue regeneration (Figure 4F). Mito-tracker showed that mitochondria aggregated in a patchy pattern in the control group. However, in the PTH group, the number of mitochondria significantly increased and dispersed throughout the cytoplasm, and there were rich network connections between mitochondria (Figure 4G). qRT-PCR showed that the expression of dynamin-related protein 1 (DRP1) was significantly increased in the PTH group, whereas the expression of MFN2 and OPA1 exhibited no statistical differences between the control and PTH groups (Figure 4H). Collectively, the results indicated that PTH increased aerobic glycolysis of glucose and promoted mitochondrial fission.
To evaluate the effects of PTH on glucose metabolism during orthodontic tooth movement in vivo, we subsequently detected the expression of GLUT1, HK1 and LDHA. The results showed that PTH application significantly promoted the expression of GLUT1 and HK1, indicating that PTH can promote glucose transportation and usage (Figure 5A, B, D). The higher expression of LDHA was consistent with the promotion of aerobic glycolysis observed in vitro following PTH treatment (Figure 5C, D). Moreover, mitochondrial fission was inhibited by DRP1 knock-down via shRNA, and its impact on osteogenic differentiation was investigated. ALP staining showed that DRP1 knock-down observably inhibited the activity of ALP (Figure 5E). qRT-PCR results showed that the expression of ALP and COL Iα1 were statistically alleviated following DRP1 knock-down while the expression of Runx2 exhibited no significant difference. The expression of LDHA was significantly promoted after PTH administration, which could be reversed by DRP1 inhibition (Figure S8). The elevated glucose consumption rate in the PTH-administered group was inhibited in the shDRP1 group (Figure S9). Meanwhile, we detected the glycolytic rate of PDLCs via a Seahorse assay. The results demonstrated that PTH treatment promoted the glycolytic proton efflux rate while inhibition of mitochondrial fission by shDRP1 significantly decreased the glycolytic rate (Figure S8). These findings indicated that mitochondrial midzone fission could partially mediate the bone remodelling effects induced by intermittent PTH administration (Figure 5F).
Fig. 5.
PTH administration accelerates orthodontic tooth movement via aerobic glycolysis and mitochondria fission. Immunohistochemical (IHC) staining showed higher expression of GLUT1 (A), HK1 (B) and LDHA (C) in the PTH group. Original magnification: x200. Scale bars = 100 μm. D, Quantitative results showed that the expression of GLUT1, HK1 and LDHA was significantly higher in the PTH group compared with the control group. E, DRP1 was knocked down and the ALP activity was markedly reduced in the DRP1 knock-down group. Scale bar = 200 μm. F, qRT-PCR results indicated that DRP1 knock-down significantly inhibited the expression of ALP and COL Iα1, whereas the expression of Runx2 exhibited no statistical difference. P < .05 represents a significant difference. *P < .05, ⁎⁎P < .01, ⁎⁎⁎P < .001.
Discussion
In the current study, we provided additional evidence for the biphasic roles of PTH on alveolar bone metabolism and revealed the essential role of aerobic glycolysis in PTH-induced bone remodelling. Previous studies have shown that the effect of PTH on bone metabolism is correlated with its frequency of administration. Intermittent PTH stimulation promotes bone anabolic metabolism while continuous PTH stimulation promotes bone catabolic metabolism.4 However, some studies have also demonstrated that intermittent PTH administration has a bidirectional effect on bone metabolism, but the overall phenotype tends to be osteogenic. Our results supported the latter perspective. Specifically, intermittent PTH stimulation facilitated ALP activity, calcium nodule deposition and the expression of osteogenic genes. Conversely, intermittent PTH administration also promoted osteoclast differentiation of monocytes, as evidenced by a significant increase in the number of multinucleated TRAP-positive cells in the PTH group, along with a marked upregulation of osteoclast-related genes. The biphasic effects of PTH help to create an active bone remodelling microenvironment under orthodontic force, thereby accelerating orthodontic tooth movement. Animal experiments further confirmed the in vitro findings, showing a significant increase in tooth movement distance following local PTH administration. The immunohistochemical analysis revealed a significant increase in the expression of BMP2 and OCN in the periodontium, a decrease in OPG expression and a notable increase in TRAP-positive cells in the periodontium region.
Furthermore, we explored the potential molecular mechanisms underlying the effect of PTH on PDLCs. Previous studies have shown that PTH mainly functions through the PKA signalling pathway activated by PTH/PTHrP receptors (PPRs). In addition, its impact on bone homeostasis requires the involvement of T cells, which secrete regulatory factors such as TNF- α, IL-17 and Wnt10b, and affects the phenotype of osteoblasts and bone cells in turn. In addition to cellular signalling, our RNA-seq results indicated that metabolic reprogramming plays a non-negligible role in the dual effects of PTH on PDLCs. Glucose, as the primary energy source, is essential for the function of both osteoblasts and osteoclasts. Glucose taken up through Glut1 in osteoblasts favours osteoblast differentiation and bone formation.19 Wang et al. demonstrated that mechanical force could activate GLUT1 expression in both an in vivo OTM model and in vitro–cultured human PDLCs exposed to compressive force, which contributed to osteoclast differentiation during periodontal tissue remodelling.20 These findings inspired us to explore the role of glucose metabolism in PTH-induced bone metabolism remodelling. Our results showed that aerobic glycolysis was promoted following PTH administration. Under PTH administration, PDLCs took up and consumed more glucose but did not convert it into pyruvate acid for entry into the Krebs cycle and OXPHOS. On the contrary, the glucose was metabolised into lactic acid and generated ATP rapidly to meet the energy demands of bone metabolism (Figure 6).
Fig. 6.
The diagram illustrates that PTH could facilitate PDLCs aerobic glycolysis and mitochondrial fission to regulate alveolar bone remodelling and orthodontic tooth movement.
This study explored the role of PTH in promoting bone remodelling in PDLCs from a metabolic perspective. However, the relationship between signalling pathways and metabolic function requires further investigation. Intermittent PTH administration facilitates the anabolic effects on bone via the Wnt signalling pathway,21 and the PKM2 isoform can translocate into nucleus and bind to c-Src-phosphorylated Y333 of β-catenin.22 This interaction is essential for Wnt pathway activation. Moreover, Chen et al. suggested that promoted glycolysis alters the contents of α-KG and lactate, thereby promoting Wnt/β-catenin activation.23 In addition, PTH enhances bone remodelling via PKA-pCREB-API signalling axis5 while the impact of PKA signalling on metabolism remains controversial. PKA can phosphorylate HDACs to inhibit their deacetylase activity, resulting in a metabolic shift from glycolysis to the Krebs cycle.24 Furthermore, other studies have uncovered the underlying mechanism by which PKA modulates histone modifications. Glycolysis activates PKA via the Ras-cAMP pathway, which phosphorylates Jhd2 to inhibit H3K4 demethylation and maintain H3K14 acetylation.25 This indicates that glycolysis can regulate histone modification through PKA, thereby rewiring cell fate. The osteoclast activation induced by PTH requires the involvement of T cells, and both IL-17 and TNF-α are essential mediators of the catabolic activity triggered by PTH.26,27 PTH stimulation can promote the secretion of IL-17 and TNF-α, which in turn stimulate glycolysis and the production of growth factor.28 Although direct evidence is lacking to confirm that PTH reshapes metabolic function by regulating signalling pathways, accumulating evidence suggests that their interaction shapes the biological phenotype of cells, and this hypothesis requires further investigation.
There are 2 main types of mitochondrial fission: peripheral fission and midzone fission. Peripheral fission occurs at the edges of the mitochondria, isolating damaged components and facilitating autophagic degradation. Midzone fission occurs centrally, which is more conducive to mitochondrial proliferation and biosynthesis.29 Midzone fission supports even distribution and DNA replication of mitochondria, enhancing cell proliferation and function, thus playing an important role in the osteogenic process. Both types of mitochondrial fission are mediated by DRP1,29 which contributes to osteoclast differentiation by promoting the c-fos-NFATc1 axis through downregulation of RANKL.30 Another study demonstrated that enhanced mitochondrial fission achieved by Opa1 knockdown or Fis1 overexpression could accelerate osteogenesis.31 Our results also indicated that inhibition of mitochondrial fission partially mitigated the osteo-induction effects induced by PTH administration. In summary, mitochondrial fission plays a crucial role in both osteoblasts and osteoclasts. Mito-tracker staining and qRT-PCR results in the current study showed increased mitochondrial distribution and DRP1 expression. We thus speculated that PDLCs undergo mitochondrial midzone fission following PTH administration. However, this hypothesis requires further investigation in the future.
Mitochondrial dynamics is central to maintaining energy metabolism. As a key regulator of mitochondrial fission, DRP1 mediates mitochondrial fragmentation upon aberrant activation, which directly modulates cellular glycolysis and is widely involved in pathophysiological processes.32,33 Phosphorylation-dependent activation of DRP1 enables its binding to FIS1 and MiD49, thereby inducing excessive mitochondrial fission.34 Fragmented mitochondria exhibit impaired oxidative phosphorylation and insufficient ATP production. In response, cells upregulate the transcription factors HIF‑1α and c‑Myc, leading to high expression of key glycolytic enzymes including PFKM, HK2 and LDHA, which drastically increases glycolytic flux and lactate accumulation.34,35 Targeting DRP1 to reverse abnormal mitochondrial fission and pathological glycolysis provides important theoretical support for elucidating the association between mitochondrial metabolic dysfunction and diseases.
Conclusion
In summary, our results showed that PTH administration exhibits biphasic effects on bone metabolism under mechanical force, promoting both osteogenic differentiation of PDLCs and osteoclastic differentiation of monocytes. PTH enhanced glucose uptake, glucose consumption and aerobic glycolysis while exhibiting minimal effects on the Krebs cycle and OXPHOS. In addition, mitochondrial fission was observed in PTH-stimulated PDLCs. The current study reveals the dual roles of PTH in bone metabolism and highlights the critical role of aerobic glycolysis in bone remodelling. Moreover, disruption of metabolic homeostasis could influence the efficiency of tooth movement.
Author contributions
Conceptualisation: Chen, Fang, Pan, Peng, Wu, Xia. Design: Chen, Fang, Pan, Peng, Wu, Xia. Data analysis and interpretation: Chen, Fang, Lu, Lv, Pan, Wang, Wu, Xia. Writing—initial draft: Chen, Lu, Lv, Wang, Wu. Writing—revision and editing: Fang, Pan, Peng, Wu, Xia
Funding
The study was supported by the National Natural Science Foundation of China (82101074).
Conflict of interest
None declared.
Footnotes
Supplementary material associated with this article can be found in the online version at doi:10.1016/j.identj.2026.109572.
Contributor Information
Lunguo Xia, Email: xialunguo@hotmail.com.
Bing Fang, Email: fangbing@sjtu.edu.cn.
Xiaogang Pan, Email: xgpan70@126.com.
Appendix. Supplementary materials
References
- 1.Lombardo G., Vena F., Negri P., et al. Worldwide prevalence of malocclusion in the different stages of dentition: a systematic review and meta-analysis. Eur J Paediatr Dentistry. 2020;21(2):115–122. doi: 10.23804/ejpd.2020.21.02.05. [DOI] [PubMed] [Google Scholar]
- 2.Jin A., Hong Y., Yang Y., et al. FOXO3 mediates tooth movement by regulating force-induced osteogenesis. J Dent Res. 2021;101(2):196–205. doi: 10.1177/00220345211021534. [DOI] [PubMed] [Google Scholar]
- 3.Wang K., Xu C., Xie X., et al. Axin2+ PDL cells directly contribute to new alveolar bone formation in response to orthodontic tension force. J Dent Res. 2022;101(6):695–703. doi: 10.1177/00220345211062585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Silva B.C., Bilezikian J.P. Parathyroid hormone: anabolic and catabolic actions on the skeleton. Curr Opin Pharmacol. 2015;22:41–50. doi: 10.1016/j.coph.2015.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Saito H., Gasser A., Bolamperti S., et al. TG-interacting factor 1 (Tgif1)-deficiency attenuates bone remodelling and blunts the anabolic response to parathyroid hormone. Nat Comm. 2019;10(1):1354. doi: 10.1038/s41467-019-08778-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Huang J., Lin D., Wei Z., et al. Parathyroid hormone derivative with reduced osteoclastic activity promoted bone regeneration via synergistic bone remodelling and angiogenesis. Small. 2020;16(6) doi: 10.1002/smll.201905876. [DOI] [PubMed] [Google Scholar]
- 7.Li T., Yan Z., He S., et al. Intermittent parathyroid hormone improves orthodontic retention via insulin-like growth factor-1. Oral Dis. 2020;27(2):290–300. doi: 10.1111/odi.13519. [DOI] [PubMed] [Google Scholar]
- 8.Zhang C., Li T., Zhou C., et al. Parathyroid hormone increases alveolar bone homoeostasis during orthodontic tooth movement in rats with periodontitis via crosstalk between STAT3 and β-catenin. Int J Oral Sci. 2020;12(1):38. doi: 10.1038/s41368-020-00104-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Soma S., Matsumoto S., Higuchi Y., et al. Local and chronic application of PTH accelerates tooth movement in rats. J Dent Res. 2000;79(9):1717–1724. doi: 10.1177/00220345000790091301. [DOI] [PubMed] [Google Scholar]
- 10.Li F., Li G., Hu H., et al. Effect of parathyroid hormone on experimental tooth movement in rats. Am J Orthodont Dentofac Orthoped. 2013;144(4):523–532. doi: 10.1016/j.ajodo.2013.05.010. [DOI] [PubMed] [Google Scholar]
- 11.Esen E., Long F. Aerobic glycolysis in osteoblasts. Curr Osteoporosis Rep. 2014;12(4):433–438. doi: 10.1007/s11914-014-0235-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.DeMambro V.E., Tian L., Karthik V., et al. Effects of PTH on osteoblast bioenergetics in response to glucose. Bone Reports. 2023;19 doi: 10.1016/j.bonr.2023.101705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Riddle R.C. Parathyroid hormone reprograms osteoblast metabolism. J Bone Mineral Res. 2015;30(11):1956–1958. doi: 10.1002/jbmr.2727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wang Y., Li Q., Liu F., et al. Transcriptional activation of glucose transporter 1 in orthodontic tooth movement-associated mechanical response. Int J Oral Sci. 2018;10(3):27. doi: 10.1038/s41368-018-0029-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Dang M., Koh A.J., Danciu T., et al. Preprogrammed long-term systemic pulsatile delivery of parathyroid hormone to strengthen bone. Adv Healthc Mater. 2017;6(3) doi: 10.1002/adhm.201600901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Li J-Y, Yu M., Pal S., et al. Parathyroid hormone–dependent bone formation requires butyrate production by intestinal microbiota. J Clin Invest. 2020;130(4):1767–1781. doi: 10.1172/JCI133473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Bedi B., Li J-Y, Tawfeek H., et al. Silencing of parathyroid hormone (PTH) receptor 1 in T cells blunts the bone anabolic activity of PTH. Proc Nat Acad Sci. 2012;109(12):E725–E733. doi: 10.1073/pnas.1120735109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wu X., Chen H., Wang Y., et al. Akt2 Affects Periodontal Inflammation via Altering the M1/M2 Ratio. J Dent Res. 2020;99(5):577–587. doi: 10.1177/0022034520910127. [DOI] [PubMed] [Google Scholar]
- 19.Wei J., Shimazu J., Makinistoglu M.P., et al. Glucose uptake and Runx2 synergize to orchestrate osteoblast differentiation and bone formation. Cell. 2015;161(7):1576–1591. doi: 10.1016/j.cell.2015.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Wang Y., Li Q., Liu F., et al. Transcriptional activation of glucose transporter 1 in orthodontic tooth movement-associated mechanical response. Int J Oral Sci. 2018;10(3):27. doi: 10.1038/s41368-018-0029-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.D’Amelio P., Sassi F., Buondonno I., et al. Treatment with intermittent PTH increases Wnt10b production by T cells in osteoporotic patients. Osteoporosis Int. 2015;26(12):2785–2791. doi: 10.1007/s00198-015-3189-8. [DOI] [PubMed] [Google Scholar]
- 22.Yang W., Xia Y., Ji H., et al. Nuclear PKM2 regulates β-catenin transactivation upon EGFR activation. Nature. 2011;480(7375):118–122. doi: 10.1038/nature10598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Chen Z., He Q., Lu T., et al. mcPGK1-dependent mitochondrial import of PGK1 promotes metabolic reprogramming and self-renewal of liver TICs. Nat Commun. 2023;14(1):1121. doi: 10.1038/s41467-023-36651-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Dai W., Yu Q., Ma R., et al. PKA plays a conserved role in regulating gene expression and metabolic adaptation by phosphorylating Rpd3/HDAC1. Nat Commun. 2025;16(1):4030. doi: 10.1038/s41467-025-59064-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yu Q., Gong X., Tong Y., et al. Phosphorylation of Jhd2 by the Ras-cAMP-PKA(Tpk2) pathway regulates histone modifications and autophagy. Nat Commun. 2022;13(1):5675. doi: 10.1038/s41467-022-33423-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Pacifici R. The role of IL-17 and TH17 cells in the bone catabolic activity of PTH. Front Immunol. 2016;7:57. doi: 10.3389/fimmu.2016.00057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Li J-Y, Yu M., Tyagi A.M., et al. IL-17 receptor signalling in osteoblasts/osteocytes mediates PTH-induced bone loss and enhances osteocytic RANKL production. J Bone Mineral Res. 2019;34(2):349–360. doi: 10.1002/jbmr.3600. [DOI] [PubMed] [Google Scholar]
- 28.Straus D.S. TNFα and IL-17 cooperatively stimulate glucose metabolism and growth factor production in human colorectal cancer cells. Mol Cancer. 2013;12:78. doi: 10.1186/1476-4598-12-78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kleele T., Rey T., Winter J., et al. Distinct fission signatures predict mitochondrial degradation or biogenesis. Nature. 2021;593(7859):435–439. doi: 10.1038/s41586-021-03510-6. [DOI] [PubMed] [Google Scholar]
- 30.Jeong S., Seong J.H., Kang J.H., et al. Dynamin-related protein 1 positively regulates osteoclast differentiation and bone loss. FEBS Lett. 2021;595(1):58–67. doi: 10.1002/1873-3468.13963. [DOI] [PubMed] [Google Scholar]
- 31.Suh J., Kim N.K., Shim W., et al. Mitochondrial fragmentation and donut formation enhance mitochondrial secretion to promote osteogenesis. Cell Metab. 2023;35(2):345–360. doi: 10.1016/j.cmet.2023.01.003. e7. [DOI] [PubMed] [Google Scholar]
- 32.Schmitt K., Grimm A., Dallmann R., et al. Circadian control of DRP1 activity regulates mitochondrial dynamics and bioenergetics. Cell Metab. 2018;27(3):657–666. doi: 10.1016/j.cmet.2018.01.011. e5. [DOI] [PubMed] [Google Scholar]
- 33.Hu Y., Li J., Chen H., et al. Autophagy related 5 promotes mitochondrial fission and inflammation via HSP90-HIF-1α-mediated glycolysis in kidney fibrosis. Adv Sci (Weinh) 2025;12(17) doi: 10.1002/advs.202414673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Sun Z., Ma Z., Cao W., et al. Calcium-mediated mitochondrial fission and mitophagy drive glycolysis to facilitate arterivirus proliferation. PLoS Pathog. 2025;21(1) doi: 10.1371/journal.ppat.1012872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sun T., Yu H., Zhang D., et al. Activated DRP1 promotes mitochondrial fission and induces glycolysis in ATII cells under hyperoxia. Respir Res. 2024;25(1):443. doi: 10.1186/s12931-024-03083-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






