Effect of Limosilactobacillus reuteri probiotic on dual-species biofilms of Streptococcus sobrinus and Candida albicans: an in vitro study

Abstract

The development of intricate dental biofilms and an imbalance in the oral microbiota are linked to Early Childhood Caries (ECC) as a multifactorial oral disease. Although Streptococcus mutans has been extensively studied, other microorganisms, including Streptococcus sobrinus and Candida albicans, also contribute significantly to the severity of ECC. Probiotics like Limosilactobacillus reuteri, which produce antimicrobial metabolites, such as reuterin, have shown potential as biofilm-modulating agents, but their effects on dual-species biofilms from ECC clinical isolates remain poorly understood. The inhibitory potential of L. reuteri against dual-species biofilms formed by clinical isolates of S. sobrinus with C. albicans obtained from children with ECC was evaluated by this study. Supragingival plaque sampling in ECC patients aged 3–5 years enabled the recovery of clinical isolates representing S. sobrinus as well as C. albicans. Dual-species biofilm cultures were grown in saliva-treated 96-well microplates. After incubation with L. reuteri (2 × 10⁸ CFU/mL), the accumulated biofilm was evaluated through crystal violet staining and absorbance measurement at 600 nm. The microbial count (CFU/mL) was determined by absolute real-time PCR, and the expression of virulence genes (gtfI and HWP1) was evaluated by utilizing relative real-time PCR. The reduction in biofilm biomass produced by treatment with L. reuteri was 35% (p < 0.05). In addition, there was a significant reduction in the microbial load of S. sobrinus and C. albicans. Expression of the virulence genes gtfI and HWP1 was notably downregulated following probiotic treatment (p < 0.05). L. reuteri exhibits potent antibiofilm and antivirulence effects against dual-species biofilms formed by ECC-associated clinical isolates. These findings support its potential as a biofilm-modulating agent for caries prevention strategies.

Introduction

One of the most prevalent oral conditions affecting young children is early childhood caries (ECC), which is still a major worldwide health concern. The condition develops as a indicate of complex interactions involving host susceptibility, frequent consumption of fermentable carbohydrates, and ecological disturbances within dental plaque microbiota (American Academy of Pediatric Dentistry 2025). For many years, the main bacteria linked to dental caries has been identified as Streptococcus mutans. However, a growing body of research indicates that polymicrobial interactions within the intricate dental biofilm are what cause ECC rather than a single bacteria. Other microbial species, including Streptococcus sobrinus and the opportunistic fungus Candida albicans, have been increasingly associated with severe and rapidly progressing forms of the disease. The coexistence of bacterial and fungal species within dental plaque can facilitate cooperative interactions that enhance biofilm stability and virulence. These cross-kingdom interactions promote the accumulation of extracellular matrix components, microbial co-adhesion, and improved tolerance to environmental stress (Paunfase et al. 2023; Sari et al. 2019; Koo et al. 2018).

Although many studies have investigated biofilms formed by S. mutans together with C. albicans, comparatively fewer investigations have examined similar interactions involving S. sobrinus. This gap is noteworthy because S. sobrinus demonstrates strong acidogenic and aciduric properties and has been linked to increased caries severity in clinical studies. The presence of this microorganism has been associated with more extensive lesions and accelerated caries progression in children (Li et al. 2021; Korona-Glowniak et al. 2022; Jeevanandan et al. 2024).

To better represent clinical conditions, the study used isolates of S. sobrinus together with C. albicans recovered from children diagnosed with ECC. Compared with laboratory reference strains, clinical isolates often retain phenotypic diversity and virulence characteristics that more closely represent natural infections (Li et al. 2021).

In recent years, preventive strategies in cariology have increasingly focused on ecological approaches aimed at modulating microbial communities rather than eliminating oral microorganisms. Within this context, probiotics have emerged as promising biological agents capable of influencing the composition and activity of oral biofilms (Wasfi et al. 2018; Twetman 2018). Certain probiotic species can inhibit pathogen colonization, produce antimicrobial metabolites, and alter the structural organization of microbial communities (Fu et al. 2025).

Among these microorganisms, Limosilactobacillus reuteri has received considerable attention because mucosal surfaces can be colonized and antimicrobial compounds such as reuterin and reutericyclin can be produced. These metabolites exhibit activity against a broad spectrum of microorganisms and may interfere with pathogenic biofilm formation (Wasfi et al. 2018; Jørgensen et al. 2017). Previous studies have reported that L. reuteri can suppress the growth of oral pathogens and influence biofilm development (Félix-Sicairos et al. 2024; Fu et al. 2025). Oral diseases associated with biofilms, including dental caries, can be prevented by L. reuteri, which is considered a promising probiotic candidate due to these properties. Nevertheless, the effects of this probiotic on polymicrobial biofilms involving S. sobrinus and C. albicans derived from ECC patients remain insufficiently understood. The effects of L. reuteri on biofilm biomass, microbial load, and expression of virulence-related genes (gtfI and HWP1) in dual-species biofilms produced by clinical isolates representing S. sobrinus along with C. albicans obtained from children with ECC were evaluated by this study.

Materials and methods

Study design and ethical approval

This laboratory-based in vitro experiment employed a dual-species biofilm model using clinical isolates representing S. sobrinus along with C. albicans obtained from children diagnosed with ECC. The intervention involved exposure to a commercial L. reuteri probiotic preparation (DSM 17938 and ATCC PTA 5289; BioGaia ProDentis^®). This study was approved by the Institutional Review Board (Approval No. 28/Ethical Approval/***/VI/2025). Written informed consent was obtained from the parents or legal guardians of all participants.

Sample collection and isolate identification

Four children aged 3–5 years diagnosed with ECC at a pediatric dental clinic provided supragingival plaque samples for this study. Four independent clinical isolates obtained from different children with ECC were used as biological replicates to represent microbial variability among patients. Each isolate was tested in duplicate to ensure experimental reproducibility.

After obtaining informed consent from parents or guardians, sterile cotton swabs were used to gather plaque, which was then transferred in tubes with one milliliter of phosphate-buffered saline (PBS). All samples were processed within four hours and preserved at − 80 °C until further analysis (Agustin et al. 2024).

To ensure homogeneous distribution of microorganisms, the samples were vortexed briefly using a vortex mixer (Vortexer 1, Velp Scientifica, Italy). Fifty microliters (50 µL) of the homogenized suspension were plated using a sterile spreader onto TYS20B (Trypticase Soy Yeast Extract with 20% sucrose and bacitracin) selective agar for the isolation of S. sobrinus. The plates were incubated in an anaerobic jar containing a gas mixture of 80% N₂, 10% CO₂, and 10% H₂ at 37 °C for 48 h under microaerophilic conditions (Chismirina et al. 2023; Krzyściak et al. 2017).

Putative S. sobrinus colonies identified based on morphology were confirmed using PCR. The primers listed in Table 1 were specifically used for the identification of Streptococcus sobrinus. PCR amplification was performed using a MaxyGene II thermal cycler (Axygen, USA). The cycling schedule comprised 35 amplification cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s after the initial denaturation at 95 °C for five minutes. A holding step at 4 °C was performed after a final extension step at 72 °C for five minutes. Electrophoresis on a 1.5% agarose gel containing GelRed^™ was used to segregate the amplified PCR products, which were then visible under UV light. The expected amplicon size for S. sobrinus was 712 bp.

Table 1.

Primer sequences for the identification of Streptococcus sobrinus by PCR

	Primer sequence	bp
Forward	5′-GATAACTACCTGACAGCTGACT-3′	712
Reverse	5′-AAGCTGCCTTAAGGTAATCACT-3′

PCR confirmation was performed specifically for S. sobrinus due to its phenotypic similarity to other oral streptococci, which may hinder accurate identification using conventional methods. In contrast, C. albicans was identified using established morphological and microbiological criteria commonly applied in fungal diagnostics. 50 µL of the homogenized suspension was inoculated onto CHROMagar™ (CHROMagar, France) and incubated aerobically at 37 °C for approximately 48 h. Colonies of C. albicans were identified based on their characteristic blue-green coloration, smooth surface, well-defined margins, and colony size ranging from 2 to 4 mm.

Preparation of microbial suspensions

5 mL of Brain Heart Infusion (BHI) broth supplemented with 5% sucrose was provided to cultivate S. sobrinus clinical isolates, while Candida albicans colonies were cultivated in 5 mL of Sabouraud Dextrose Broth (SDB) supplemented with 5% sucrose. All cultures were prepared in sterile 15 mL tubes. The bacterial cultures were incubated at 37 °C for 24 h under microaerophilic conditions (80% N₂, 10% CO₂, 10% H₂) in an anaerobic jar, while the fungal cultures were incubated aerobically at 37 °C for 24 h (Krzyściak et al. 2017).

After incubation, optical density measurement at 600 nm (OD₆₀₀) with a microplate reader was utilized to suspend standardized microbial suspensions. The inoculum suspensions were standardized to approximately 1 × 10⁶ CFU/mL for S. sobrinus and 1 × 10⁴ CFU/mL for C. albicans, consistent with concentrations commonly used in dual-species oral biofilm models. These standardized suspensions were subsequently used for biofilm formation assays (Krzyściak et al. 2017).

Preparation of probiotic suspension

The probiotic preparation was derived from Limosilactobacillus reuteri drops containing strains ATCC PTA 5289 and DSM 17,938, and sterile phosphate buffered saline (PBS) was provided to dilute the suspension so that a final concentration of 2 × 10⁸ CFU/mL could be achieved.

Biofilm formation and saliva coating

To simulate oral conditions, wells of a 96-well plate were coated with cell-free, filtered saliva from healthy adult donors to mimic the acquired pellicle. 50 µL of standard S. sobrinus suspension was added together with 50 µL of standard C. albicans suspension into each well to produce a dual-species biofilm. Then, the plates were incubated at 37 °C for 48 h under microaerophilic conditions (80% N₂, 10% CO₂, 10% H₂) so that the biofilm could be formed.

Following the incubation period, loosely attached cells were eliminated by rinsing each well with 100 µL of PBS. Fresh culture media were then introduced, consisting of 50 µL Brain Heart Infusion broth with 5% sucrose along with 50 µL Sabouraud Dextrose Broth containing the same sucrose concentration. For the probiotic-treated group, the wells were filled with 50 µL of L. reuteri probiotic solution. To maintain the same final volume under all experimental settings, 50 µL of sterile distilled water was supplied to the untreated control group as a solvent control. The plates were further incubated at 37 °C under the same microaerophilic conditions for 24 h (Krzyściak et al. 2017).

At the end of the incubation, mature biofilms were observed on the bottom and sidewalls of the wells and subsequently processed for further experimental analyses.

Biofilm biomass quantification

Biofilm accumulation was evaluated through a crystal violet assay. After a 24-hour incubation period, non-attached cells were eliminated by rinsing the wells with PBS. The attached biofilm layer was stained using 0.1% crystal violet for about 2–3 minutes, after which the excess dye was removed. The amount of biofilm in each group was then ascertained by dissolving the residual stain with 95% ethanol and measuring the optical density at 600 nm using a microplate reader.

Microbial load quantification

DNA extraction was carried out with GENEzol™ (Geneaid, Taiwan). Real-time PCR reactions were prepared in 96-well plate format using the SensiFAST™ SYBR^® No-ROX Kit (Bioline, UK), with all reactions performed in duplicate. Primer sequences are listed in Table 2. Ct values obtained from biofilm samples were converted to estimated CFU/mL using standard curves generated from 10-fold serial dilutions of laboratory strains of Streptococcus sobrinus and Candida albicans. The standard curves showed strong linear correlations between Ct values and log CFU/mL for both microorganisms (Fig. 1 and Fig. 2).

Table 2.

Primer sequences used for microbial quantification of Streptococcus sobrinus and Candida

		Primer sequence	bp
S. sobrinus	Forward Reverse	5’-TTCAAAGCCAAGACCAAGCTAGT-3’5’-CCAGCCTGAGATTCAGCTTGT-3’	88
C. albicans	Forward Reverse	5’-CACGACGGAGTTTCACAAGA-3’5’-CGATGGAAGTTTGAGGCAAT-3’	134

Fig. 1.

Standard curve generated from 10-fold serial dilutions of Streptococcus sobrinus, showing the relationship between Ct values and log₁₀ CFU/mL (R² = 0.99)

Fig. 2.

Standard curve generated from 10-fold serial dilutions of Candida albicans, showing the relationship between Ct values and log₁₀ CFU/mL (R² = 0.99)

Gene expression analysis

Isopropanol precipitation was used to extract RNA from the aqueous phase, which was then cleaned with 75% ethanol and resuspended in RNase-free water. A NanoDrop spectrophotometer was then used to measure the RNA’s concentration and purity. Reverse transcription was used to create complementary DNA using the ReverTra Ace^® qPCR RT Master Mix (Toyobo, Japan). Real-time PCR was conducted to evaluate the virulence genes gtfI (S. sobrinus) and HWP1 (C. albicans), using 16 S rRNA and ACT1 as reference genes (primer sequences are listed in Table 3). The SensiFAST™ SYBR^® No-ROX Kit (Bioline, UK) in a total reaction volume of 10 µL was used to prepare the reaction. The 2^−ΔΔCt method can be implemented to calculate relative gene expression.

Table 3.

Primer sequences used for real-time PCR analysis of virulence gene expression

Nama primer		Primer sequence	bp
Universal bacterial 16 S rRNA	Forward Reverse	5’ -AAGCAACGCGAAGAACCTTA − 3’ 5’ -GTCTCGCTAGAGTGCCCAAC-3’	180
Housekeeping gene ACT1	Forward Reverse	5’- TGAACAATGGATGGACCAGA − 3’ 5’- TGCTGAACGTATGCAAAAGG − 3’	160
gtfI (S. sobrinus)	Forward Reverse	5’-GAAACCAACCCAACTTTAGCTTGGAT-3’ 5’-ATGGAGTGATTTTCCATCGGTACTTG-3’	150
HWP1 (C. albicans)	Forward Reverse	5’ -GCTCCTGCTCCTTGAAATGAC-3’ 5’-CTGGAGCAATTGGTGAGGTT-3’	150

Statistical analysis

SPSS version 29 was used to statistically evaluate the data. The Shapiro–Wilk normality test was implemented to assess the data distribution. Differences between the treatment and control groups were analyzed using an independent t-test, with statistical significance defined as p < 0.05 (Dahlan 2014).

Results

Effect of L. reuteri on biofilm biomass

Analysis of biofilm formation using the crystal violet assay showed that exposure to L. reuteri significantly suppressed biofilm development compared with the control condition (p < 0.05). The dual-species biofilm in the treated group produced a mean OD₆₀₀ of 0.129 ± 0.003, whereas the control group reached 0.198 ± 0.014, indicating an approximately 35% reduction in total biofilm biomass (Fig. 3).

Fig. 3.

Biofilm mass (OD₆₀₀) of dual-species biofilms in the Limosilactobacillus reuteri–treated group and the untreated control group. Bars represent mean ± standard deviation. Independent t-test; p < 0.05. * indicates a significant difference compared with the control

Effect on microbial load

Absolute quantification by real-time PCR demonstrated a significant reduction in the microbial load of both S. sobrinus and C. albicans in the treated biofilm group (p < 0.05). The mean log₁₀ CFU/mL of S. sobrinus decreased by 13%, from 8.92 ± 0.49 in the control to 7.73 ± 0.51 in the treated group (Fig. 4). C. albicans counts were also significantly reduced, showing a 12% decrease from 3.64 ± 0.14 to 3.21 ± 0.06 (Fig. 5).

Fig. 4.

Microbial counts (log₁₀ CFU/mL) of Streptococcus sobrinus in dual-species biofilms in the Limosilactobacillus reuteri–treated group and the untreated control group. Bars represent mean ± standard deviation. Independent t-test; p < 0.05. * indicates a significant difference compared with the control

Fig. 5.

Microbial counts (log₁₀ CFU/mL) of Candida albicans in dual-species biofilms in the Limosilactobacillus reuteri–treated group and the untreated control group. Bars represent mean ± standard deviation. Independent t-test; p < 0.05. * indicates a significant difference compared with the control

Effect on virulence gene expression

Compared with the control group, the treated samples showed significantly reduced expression of the virulence genes, gtfI in S. sobrinus and HWP1 in C. albicans (p < 0.05). Expression of gtfI decreased by about 73% (Fig. 6), while HWP1 was reduced by approximately 51% (Fig. 7). These indicates suggest that L. reuteri not only reduces biofilm biomass and microbial burden but also attenuates virulence at the gene-expression level in both bacterial and fungal components of the dual-species biofilm.

Fig. 6.

Gene fold change of virulence genes gtfI (Streptococcus sobrinus) in dual-species biofilms in the Limosilactobacillus reuteri–treated group and the untreated control group. Bars represent mean fold change ± standard deviation. Independent t-test; p < 0.05. * indicates a significant difference compared with the control

Fig. 7.

Gene fold change of virulence genes HWP1 (Candida albicans) in dual-species biofilms in the Limosilactobacillus reuteri–treated group and the untreated control group. Bars represent mean fold change ± standard deviation. Independent t-test; p < 0.05. * indicates a significant difference compared with the control

Discussion

Early childhood caries (ECC) is increasingly recognized as a complex biofilm-associated disease that indicates from dynamic interactions between host susceptibility, frequent exposure to fermentable carbohydrates, and ecological shifts within the oral microbial community (Monica et al. 2018). Increasing evidence suggests that cariogenic biofilms are not driven by a single pathogen but instead arise from polymicrobial interactions that enhance microbial virulence and ecological stability. In addition to the well-known role of Streptococcus mutans, other microorganisms such as Streptococcus sobrinus and Candida albicans have been increasingly implicated in ECC progression, particularly in severe or rapidly advancing lesions (Fakhruddin et al. 2021; Agustin et al. 2024).

Although S. mutans has long been regarded as the principal cariogenic species, the contribution of S. sobrinus to ECC remains a subject of ongoing debate. Some studies have demonstrated a strong association between S. sobrinus and increased caries severity or rapid disease progression, whereas others continue to highlight the dominant role of S. mutans in cariogenic biofilms (Li et al. 2021; Korona-Glowniak et al. 2022; Jeevanandan et al. 2024). These inconsistencies may be attributed to variations in study design, microbial detection techniques, and differences in host–microbial interactions across populations. Within this polymicrobial framework, the present study does not aim to replace the established role of S. mutans, but rather to expand current understanding by focusing on alternative cariogenic species and their interactions. In particular, the interaction between S. sobrinus and C. albicans represents a relatively underexplored aspect of ECC pathogenesis.

Interactions between bacterial and fungal species can significantly influence the development of structured polymicrobial biofilms with enhanced extracellular matrix production, increased stress tolerance, and greater resistance to environmental fluctuations (Sari et al. 2019; Lobo et al. 2019).

Cariogenic biofilms in the oral cavity of young children are polymicrobial communities that include acidogenic bacteria together with opportunistic fungi (Liu et al. 2023). Mixed-species biofilms involving streptococci and C. albicans have been reported to exhibit greater structural complexity and increased biomass compared with single-species communities (Lobo et al. 2019; Falsetta et al. 2014). The morphological plasticity of C. albicans, especially its ability to transition between yeast and hyphal forms, contributes to the stability of polymicrobial biofilms and facilitates close interactions with bacterial cells (Du et al. 2022). Several molecular mechanisms are believed to contribute to these cross-kingdom interactions. Glucosyltransferases and other cariogenic streptococci-produced enzymes can interact with fungal cell surfaces to promote the creation of extracellular polysaccharides, which serve as the biofilm matrix’s structural backbone. At the same time, fungal adhesins such as HWP1 play an important role in interspecies attachment and biofilm maturation. These cooperative mechanisms enable microorganisms to persist within the same ecological niche and enhance the overall stability of the biofilm community (Martorano-Fernandes et al. 2023; Kim et al. 2021).

The dual-species biofilm model used in the present study was designed to reproduce the ecological complexity of dental plaque associated with ECC. The use of clinical isolates instead of laboratory reference strains enhances the biological relevance of the model, as clinical strains often retain virulence characteristics and genetic variability present in natural infections (Alnuaimi et al. 2013). Furthermore, the use of saliva-coated surfaces helps simulate the acquired pellicle that naturally forms on tooth surfaces and facilitates microbial adhesion (Martínez-Hernández et al. 2023).

The ecological complexity of cariogenic dental plaque can be further reflected in this study by implementing a dual-species biofilm model. This experimental system provides a useful platform for assessing the potential of probiotic-based interventions in polymicrobial biofilms associated with dental caries. Limosilactobacillus reuteri was selected as the probiotic agent because previous investigations have reported its antimicrobial, antibiofilm, and immunomodulatory activities against various oral pathogens (Widyarman et al. 2018; Sumendap et al. 2025). One of the distinctive characteristics of this species is its capacity to synthesize reuterin (3-hydroxypropionaldehyde), a metabolite with broad antimicrobial activity that can affect bacterial, fungal, and even viral microorganisms (Wasfi et al. 2018; Félix-Sicairos et al. 2024). These properties are in line with the current concept of caries prevention, which emphasizes ecological modulation of the oral microbiome rather than complete eradication of microorganisms.

Treatment with L. reuteri significantly reduced the biomass of dual-species biofilms formed by S. sobrinus and C. albicans. This reduction suggests that the probiotic interfered with biofilm formation and microbial accumulation. Similar inhibitory effects have been reported in previous investigations demonstrating that L. reuteri can suppress polymicrobial biofilm development in oral microbial communities (Kang et al. 2011; Widyarman et al. 2018).

Several mechanisms may explain the antibiofilm activity observed in the present study. Probiotic microorganisms can compete with pathogenic species for adhesion sites and available nutrients within the biofilm environment (Félix-Sicairos et al. 2024; Damayanti et al. 2021). This competitive interaction may limit the ability of cariogenic microorganisms to colonize surfaces and establish stable biofilm communities (Yu et al. 2020; Christian et al. 2020). In addition to competitive interactions, antimicrobial metabolites such as reuterin and reutericyclin produced by L. reuteri may directly affect microbial viability. Reuterin has been reported to interfere with microbial metabolic processes and compromise cell membrane integrity in a wide range of microorganisms. Meanwhile, reutericyclin demonstrates strong inhibitory activity against Gram-positive bacteria by disrupting transmembrane proton gradients (Kang et al. 2011; Britton 2017; Krzyściak et al. 2017). These effects may lead not only to microbial cell death but also to alterations in biofilm structure and function.

It is important to note that biofilm biomass in this study was assessed using crystal violet staining, which measures total biofilm accumulation without distinguishing between viable and non-viable cells (Merino et al. 2019; Feoktistova et al. 2016). Consequently, the observed reduction in biomass may reflect both direct antimicrobial activity leading to cell death and modulation of biofilm formation through interference with virulence-related pathways. In this context, probiotic treatment may also influence the transition of microorganisms toward a less structured or planktonic state by altering gene expression associated with biofilm development. Additional viability-based assays, such as MTT or metabolic activity assays, would be valuable to further differentiate between microbial killing and functional modulation of biofilm formation (Stindlova et al. 2024).

Moreover, as a lactic acid bacterium, L. reuteri lowers the environmental pH (Monica et al. 2018). Although S. sobrinus and C. albicans are aciduric, extreme acidification by L. reuteri may create conditions unfavorable for optimal growth and complex biofilm development (Mu et al. 2018; Köhler et al. 2012).

In addition to reducing biofilm biomass, L. reuteri treatment significantly decreased the microbial load of both S. sobrinus and C. albicans. This finding indicates that the probiotic not only interferes with biofilm formation but also suppresses the proliferation of cariogenic microorganisms. The significant reduction in S. sobrinus and C. albicans detected in treated biofilms suggests that pathogen proliferation can be limited by L. reuteri through multiple mechanisms of action. These mechanisms likely involve competition for nutrients, prevention of pathogen attachment to available adhesion sites, and the secretion of antimicrobial compounds including reuterin, reutericyclin, and hydrogen peroxide (Yu et al. 2020; Köhler et al. 2012; Mu et al. 2018; Jørgensen et al. 2017). Similar inhibitory effects of L. reuteri on microbial growth and biofilm development have been described previously, although most of those studies were performed using single-species experimental models (Félix-Sicairos et al. 2024; Rajão et al. 2025). Comparable outcomes have also been reported with other probiotics; for instance, Srivastava et al. documented that L. plantarum decreased bacterial viability by 99.99% and fungal viability by 99.34% in a dual-species biofilm model (Srivastava et al. 2020). It should also be considered that microbial quantification using real-time PCR may differ from culture-based approaches. Molecular techniques detect total microbial DNA, including signals from non-viable cells, whereas culture-based methods selectively quantify viable microorganisms. These methodological differences may contribute to variations in measured microbial load and should be taken into account when interpreting antibiofilm effects.

Beyond its effects on microbial abundance, L. reuteri also influenced the expression of key virulence genes in both microorganisms. In S. sobrinus, expression of the gtfI gene was significantly reduced following probiotic treatment. The gtfI gene is responsible for the production of glucosyltransferase-I, an enzyme that catalyzes the synthesis of insoluble glucans within the extracellular matrix. These glucan polymers enhance microbial attachment and support the development of cariogenic biofilms (Xu et al. 2018). Downregulation of gtfI therefore suggests suppression of cariogenic potential through reduced glucan synthesis and destabilization of the extracellular polymeric matrix. In this study, L. reuteri treatment significantly reduced gtfI expression, indicating impaired glucan synthesis and a less robust EPS matrix (Bertolini et al. 2022). Previous reports suggest that secondary metabolites of L. reuteri, such as reuterin, can directly interfere with pathogen gene regulation, while environmental changes induced by the probiotic, including pH modification and nutrient depletion, may also create stress conditions that indirectly suppress virulence gene transcription (Kang et al. 2011; Spinler et al. 2008).

A similar effect was also detected in C. albicans, where probiotic exposure led to significant downregulation of the HWP1 gene. This gene encodes Hyphal Wall Protein 1, a surface-associated adhesin that facilitates host tissue attachment and contributes to the development and structural maturation of C. albicans biofilms (Martorano-Fernandes et al. 2023; Al-Khairallah and Al-Yasiri 2022). The marked downregulation of HWP1 observed in the treated group indicates that L. reuteri may interfere with hyphal morphogenesis and consequently reduce the invasive and adhesive capacity of C. albicans within polymicrobial biofilms. Environmental changes induced by probiotic activity, including altered pH conditions and metabolic competition, may contribute to this regulatory effect. These observations are in agreement with earlier studies suggesting that metabolites released by probiotic microorganisms can disrupt the formation of virulent biofilms by pathogenic species (Köhler et al. 2012). For example, Srivastava et al. reported that supernatant obtained from Lactobacillus plantarum suppressed bacterial gtf gene expression as well as the HWP1 adhesin gene of C. albicans in a dual-species biofilm system (Srivastava et al. 2020).

Taken together, the reductions observed in biofilm biomass, microbial counts, and virulence gene expression provide converging evidence of the antibiofilm potential of L. reuteri. These findings indicate that probiotic intervention may influence both quantitative and qualitative aspects of cariogenic biofilms, affecting not only microbial growth but also the molecular mechanisms underlying pathogenicity.

While the present indicates are promising, several limitations should be considered. In this study, antibiofilm activity was evaluated using crystal violet staining and real-time PCR–based quantification of microbial load and gene expression. While these techniques provide reliable quantitative measurements, additional methods such as scanning electron microscopy (SEM) or viability assays could provide further insight into structural alterations in biofilm architecture and microbial viability. Future studies incorporating complementary approaches such as scanning electron microscopy, confocal imaging, or viability assays may further clarify the structural and functional mechanisms through which L. reuteri modulates polymicrobial biofilms associated with ECC.

Conclusion

The present study demonstrates that Limosilactobacillus reuteri inhibits dual-species biofilms formed by clinical isolates of Streptococcus sobrinus and Candida albicans. Probiotic exposure reduced biofilm biomass, microbial counts, and the expression of virulence genes (gtfI and HWP1), indicating suppression of key pathogenic mechanisms. These indicates suggest that caries-causing polymicrobial biofilms may be promisingly modulated by a probiotic strategy known as L. reuteri.

Author contributions

Conceptualization: R.G., M.F.R.;Methodology: R.G., M.F.R.;Investigation: R.G.;Data curation: R.G.;Formal analysis: R.G.;Visualization: R.G.;Writing – original draft: R.G.;Writing – review & editing: R.G., M.F.R., M.S.;Supervision: M.F.R., M.S.All authors reviewed and approved the final manuscript.

Funding

No funding was provided by public institutions, commercial entities, or non-profit organizations for the conduct of this research.

Data availability

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.