Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 May 1.
Published in final edited form as: Am J Physiol Renal Physiol. 2026 Apr 9;330(5):F619–F630. doi: 10.1152/ajprenal.00037.2026

GPR183 contributes to renal macrophage infiltration and fibrosis in kidney injury

Qian Zhang 1,2,3,#, Yan Wang 1,2,4,#, Yu Fan 1,2, Seung Seok Han 1,2,5, Han Xie 1,2, Eugene P Rhee 1,2,*, Donghai Wen 1,2,*
PMCID: PMC13129883  NIHMSID: NIHMS2165944  PMID: 41954905

Abstract

Macrophages play a key role in kidney inflammation and fibrosis. The oxysterol receptor G protein–coupled receptor 183 (GPR183) is an important immunomodulatory receptor, but its role in kidney disease is undefined. In this study, we investigated the contribution of GPR183 to renal injury using adenine diet–induced chronic kidney disease and folic acid–induced nephropathy models. Both models exhibited marked upregulation of the cholesterol hydroxylases CH25H and CYP7B1, along with increased GPR183 expression in the kidney. Immunofluorescence analysis demonstrated that GPR183 co-localized with M1 macrophage markers within injured kidneys. Genetic deletion of GPR183 selectively reduced renal M1 macrophage accumulation and proinflammatory cytokine expression without affecting M2 macrophage infiltration, leading to improved renal function. GPR183 deficiency also significantly attenuated renal fibrosis, as evidenced by decreased collagen deposition and reduced expression of fibronectin and α–smooth muscle actin. In primary bone marrow–derived macrophages, GPR183 deletion suppressed lipopolysaccharide (LPS) and interferon γ (IFN-γ)–induced M1 polarization through inhibition of NF-κB signaling. Finally, analysis of publicly available human single-cell RNA sequencing data demonstrated substantial GPR183 expression in immune cells, including macrophages, in patients with chronic kidney disease. These findings identify GPR183 as a key regulator of macrophage phenotype in kidney injury and demonstrate that activation of the oxysterol–GPR183 axis promotes inflammatory and fibrotic renal remodeling. Targeting GPR183 may therefore represent a novel therapeutic strategy for the treatment of progressive kidney disease.

Keywords: GPR183, Macrophage, Kidney

NEW & NOTEWORTHY

This study identifies GPR183 as a previously unrecognized regulator of macrophage polarization and renal fibrogenesis. We demonstrate that kidney injury activates an oxysterol–GPR183 signaling axis that promotes NF-κB–dependent M1 macrophage polarization. Genetic deletion of GPR183 selectively limits inflammatory macrophage accumulation, attenuates fibrosis, and preserves renal function, establishing GPR183 as a novel therapeutic target in progressive kidney disease.

Graphical Abstract

graphic file with name nihms-2165944-f0010.jpg

INTRODUCTION

Progressive kidney disease is driven by sustained inflammation and maladaptive tissue remodeling that culminate in irreversible fibrosis and loss of renal function (1, 2). Among the immune cells that orchestrate these processes, macrophages play a central regulatory role (3–6). Depending on environmental cues, macrophages adopt distinct functional phenotypes, broadly categorized as proinflammatory M1 and reparative M2 states (7–9). M1 macrophages amplify tissue injury through production of inflammatory cytokines and reactive oxygen species, whereas M2 macrophages facilitate resolution of inflammation and tissue repair (7–9). An imbalance favoring M1 polarization is strongly associated with the progression of chronic kidney disease (CKD) and poor clinical outcomes (7–9).

Recent work has highlighted the importance of metabolic signals in controlling macrophage phenotype (10, 11). Oxysterols, oxidized derivatives of cholesterol, have emerged as potent immunomodulatory molecules that regulate immune cell trafficking and activation (12–15). Among their receptors, G protein–coupled receptor 183 (GPR183; also known as EBI2) is activated by the oxysterol 7α,25-dihydroxycholesterol and plays a critical role in immune cell positioning and inflammatory responses (16–22). Emerging studies show that oxysterol–GPR183 signaling shapes macrophage function in chronic inflammatory and metabolic diseases. For instance, GPR183 modulates macrophage polarization, cytokine production, and metabolic state, influencing outcomes in chronic pain, mycobacterium tuberculosis, SARS-CoV2 and influenza infections (23–25). Its function in renal pathophysiology has not been explored.

Kidney injury is associated with profound alterations in cellular metabolism, including enhanced oxysterol production (26–28). Whether this metabolic shift contributes to immune dysregulation and fibrotic progression in the kidney is unknown. We hypothesized that activation of the oxysterol–GPR183 signaling axis promotes macrophage M1 polarization, thereby amplifying renal inflammation and fibrosis.

In the present study, we investigated the role of GPR183 in two distinct murine models of kidney injury, adenine diet and folic acid–induced nephropathies (29, 30). By integrating in vivo genetic deletion with mechanistic studies in primary macrophages, we demonstrate that GPR183 is a key regulator of macrophage polarization, renal inflammation, and fibrotic remodeling. Our findings uncover a previously unrecognized metabolic–immune pathway driving kidney disease progression and identify GPR183 as a potential therapeutic target for CKD.

MATERIALS AND METHODS

Animals and Experimental Models

Gpr183 heterozygous mice (Gpr183 +/−) on a C57BL/6 background were obtained from Cyagen (https://www.cyagen.com/mouseatlas/S-KO-09375). In-house breeding of Gpr183 +/− mice was performed to generate Gpr183 −/− (knockout, KO) and Gpr183 +/+ (wild-type, WT) littermates. Ten-week-old male mice were used for all experiments. Animals were maintained under specific pathogen–free conditions with free access to food and water. All procedures were approved by the Institutional Animal Care and Use Committee at Mass General Brigham and conducted in accordance with institutional guidelines. To induce adenine diet nephropathy, mice were fed a 0.2% adenine-containing diet (TD.130900; Envigo) for 3 weeks (31). To induce folic acid nephropathy, mice received a single intraperitoneal injection of folic acid (250 mg/kg; F7876; Sigma-Aldrich) dissolved in sodium bicarbonate solution. Mice were sacrificed either 1 week (for inflammation and macrophage analysis) or 4 weeks (for fibrosis analysis) following injection (32). At the end of the treatment period, mice were euthanized, and blood and kidney tissues were collected for further analysis.

Isolation and Culture of Primary Bone Marrow–Derived Macrophages (BMDMs)

Primary BMDMs were cultured as described previously (33). In brief, bone marrow cells were isolated from femurs and tibias of WT and GPR183 KO mice. Cells were cultured in complete DMEM (11985-092, Gibco), supplemented with 10% fetal bovine serum and 10 ng/mL macrophage colony–stimulating factor (M-CSF) (315-02, Peprotech) for 7 days to generate mature BMDMs. Media was replaced every 2–3 days. For M1 polarization, BMDMs were stimulated with lipopolysaccharide (LPS, 100 ng/mL) (00-4976-93, Invitrogen) and interferon-γ (IFN-γ, 20 ng/mL) (315-05, Peprotech). For M2 polarization, cells were treated with interleukin-4 (IL-4, 20 ng/mL) (214-14, Peprotech).

Immunoblot Analysis

Kidney tissues or cultured BMDMs were lysed in RIPA buffer containing protease and phosphatase inhibitors. Protein concentrations were determined using a BCA assay. Equal amounts of protein were separated by SDS-PAGE and transferred onto PVDF membranes. Membranes were blocked and incubated with primary antibodies against GPR183 (NBP2-27352, Novus Biologicals), CD86 (AF-441-NA, R&D Systems), phosphorylated p65 (#3033, Cell Signaling Technology), total p65 (#8242, Cell Signaling Technology), fibronectin (NBP1-91258, Novus Biologicals), α-SMA (sc-32251, Santa Cruz Biotechnology), Arg-1 (#93668, Cell Signaling Technology), GAPDH (ab8245, Abcam), and β-actin (sc-47778, Santa Cruz Biotechnology). After incubation with appropriate HRP-conjugated secondary antibodies, signals were detected using enhanced chemiluminescence and quantified by densitometry.

Quantitative Real-Time PCR

Total RNA was extracted from kidney tissues or BMDMs using RNeasy Mini Kit (74104, Qiagen) and reverse transcribed into cDNA using SuperScript™ IV First-Strand Synthesis System (18091050, Thermo Fisher Scientific). Quantitative PCR was performed using the SYBR Green Master Mix (1000029284, Thermo Fisher Scientific). The following primers were used: CH25H forward: CTGACCTTCTTCGACGTGCT; CH25H reverse: GGGAAGTCATAGCCCGAGTG; CYP7B1 forward: CGGAAATCTTCGATGCTCCAAAG; CYP7B1 reverse: GCTTGTTCCGAGTCCAAAAGGC. TNF-α forward: ATG GCC TCC CTC TCA TCA GT; TNF-α reverse: TTT GCT ACG ACG TGG GCT AC; IL-1β forward: TGT CTG AAG CAG CTA TGG CAA; IL-1β reverse: TAG CCC TCC ATT CCT GAA AGC; IL-6 forward: CCC CAA TTT CCA ATG CTC TCC; IL-6 reverse: CGC ACT AGG TTT GCC GAG TA; CTGF forward: CTC TAG CGA GAG CTG AGC AT; CTGF reverse: ACA AGG CTC TGA CTC CTG AC; GAPDH forward: CCCTTAAGAGGGATGCTGCC; GAPDH reverse: TACGGCCAAATCCGTTCACA. Relative gene expression levels were normalized to GAPDH and calculated using the 2^–ΔΔCt method.

Immunofluorescence and Histological Analysis

Kidney tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned. Sirius Red staining was performed according to the manufacturer’s protocol (ab150681, Abcam) to evaluate collagen deposition and fibrosis. For immunofluorescence, sections were incubated with primary antibodies against F4/80 (#71299, Cell Signaling Technology), CD80 (AF740, R&D Systems), CD86 (AF-441-NA, R&D Systems), Arg-1(#93668, Cell Signaling Technology), CD163 (#68922, Cell Signaling Technology), and GPR183 (NBP2-27352, Novus Biologicals), followed by fluorescent secondary antibodies and nuclear counterstaining with DAPI. Images were captured using a fluorescence microscope and analyzed using ImageJ.

Renal Function Assessment

Mouse serum creatinine was measured using liquid chromatography/mass spectrometry (LC/MS) as described previously (34). In brief, 10 μl of mouse serum was extracted with 90 μl acetonitrile/methanol (3:1) containing creatinine-d3 (Sigma). After centrifugation, supernatant was separated using a 2.1x150 mm Atlantis HILIC Silica 3 μm column (Waters). The peaks for creatinine (transition 114.15/44.04) and creatinine-d3 (117.15/47.04) were monitored in the positive ion mode on a TSQ Quantiva Triple Quadrupole MS (Thermo Fisher Scientific).

Single-cell RNA Sequencing

Human kidney single-cell RNA-sequencing datasets were obtained from the Kidney Precision Medicine Project (KPMP). The analysis included 18 nondiabetic CKD kidney samples from individuals aged 20–79 years with HbA1c <6.5% and no history of diabetes, as well as 4 healthy kidney samples from individuals aged 20–79 years with HbA1c <6.5%, no history of hypertension or diabetes, an albumin-to-creatinine ratio <30 mg/g, and an estimated glomerular filtration rate ≥90 mL/min/1.73 m2. Downstream analyses were performed using Seurat (version 4.3.0) in R (version 4.2.2). Quality control filtering was applied to exclude low-quality cells based on the following criteria: 200–6,000 detected genes per cell, ≥500 unique molecular identifiers (UMIs) per cell, and mitochondrial gene expression ≤30%. Doublets were identified and removed using scDblFinder in a cluster-aware manner. Data normalization and batch correction were performed using SCTransform, with regression of mitochondrial percentage and total UMI counts, followed by additional batch integration using Harmony based on sample identity. Dimensionality reduction was conducted using principal component analysis, and Uniform Manifold Approximation and Projection (UMAP) embeddings were generated. A k-nearest neighbor graph was constructed using the top principal components, and unsupervised clustering was performed using the FindClusters function. Data visualization was performed using the ggplot2 package. Gene expression patterns were visualized on UMAP embeddings and using dot plots.

Statistical Analysis

Data are presented as mean ± SEM. Statistical analyses were performed using GraphPad Prism. Comparisons between two groups were conducted using unpaired Student’s t-test, while multiple-group comparisons were analyzed using ANOVA with Tukey’s multiple comparison test. A value of P < 0.05 was considered statistically significant.

RESULTS

Increased expression of cholesterol hydroxylases CH25H/CYP7B1 and GPR183 in adenine diet–induced mouse nephropathy.

We first evaluated activation of the GPR183 signaling axis in kidneys from mice fed an adenine diet (Figure 1A). The most potent known endogenous ligand for GPR183, 7α,25-dihydroxycholesterol, is not readily measured with commercially available assays. Therefore, we assessed the expression of the key enzymes involved in its biosynthesis, the cholesterol hydroxylases CH25H and CYP7B1. Renal CH25H mRNA levels were markedly increased in mice fed an adenine diet compared with control diet–fed mice, whereas CYP7B1 mRNA levels showed a trend toward elevation that did not reach statistical significance (Figure 1B and C). Consistent with these findings, immunoblot analysis demonstrated a significant increase in GPR183 protein expression in kidneys from adenine diet–fed mice compared with controls (Figure 1D and E). Together, these results are consistent with activation of the GPR183 signaling axis in adenine diet–induced mouse nephropathy.

Figure 1. Increased expression of cholesterol hydroxylases CH25H/CYP7B1 and GPR183 in adenine diet–induced mouse nephropathy.

Figure 1.

Open in a new tab

(A) Schematic of the experimental design. Ten-week-old C57BL/6 male mice were fed either a control diet or an adenine-containing diet for 3 weeks, followed by tissue collection at sacrifice. (B and C) Quantitative PCR analysis of CH25H and CYP7B1 mRNA expression in kidneys from control- and adenine diet–treated mice. (D and E) Immunoblotting and densitometric quantification of GPR183 protein levels in kidneys from control- and adenine diet–treated mice. Data are mean ± SEM; Student’s two-tailed unpaired t-test (B, C and E); *P<0.05.

Localization of GPR183 in M1 macrophages in adenine diet–induced mouse nephropathy.

To determine the cellular source of increased GPR183 protein expression in kidneys from adenine diet–fed mice, we performed double-label immunofluorescence (IF) staining. Significant GPR183 expression was detected in macrophages, as evidenced by its colocalization with F4/80, a pan-macrophage marker, consistent with previous reports (23, 25). Further analysis demonstrated that GPR183 primarily colocalized with the M1 macrophage markers CD80 and CD86, whereas minimal colocalization was observed with the M2 marker arginase-1 (Arg-1) (Figure 2). These findings indicate that GPR183 expression is associated with M1-like macrophages in adenine diet–induced mouse nephropathy.

Figure 2. Localization of GPR183 in M1 macrophages in adenine diet–induced mouse nephropathy.

Figure 2.

Open in a new tab

Representative double-label immunofluorescence images showing colocalization of GPR183 with the pan-macrophage marker F4/80, the M1 macrophage markers CD80 and CD86, and the M2 macrophage marker Arginase-1 (Arg-1). GPR183 is predominantly expressed in M1 macrophages, with minimal expression in M2 macrophages, in kidneys from mice fed an adenine-containing diet.

Deletion of GPR183 reduces M1 but not M2 macrophage infiltration in adenine diet–induced mouse nephropathy.

To investigate the role of GPR183 in renal macrophage infiltration, C57BL/6 WT and GPR183 KO mice were fed an adenine or control diet for 3 weeks (Figure 3A). Deletion of GPR183 in KO mouse kidneys was confirmed by immunoblot analysis (Figure 3B). In adenine fed mice, IF staining demonstrated a significant reduction in M1 macrophage infiltration in KO kidneys compared with WT kidneys, as assessed by the M1 markers CD80 and CD86. In contrast, no significant difference was observed in M2 macrophage infiltration between WT and KO mice on adenine diet, as evaluated by staining for the M2 markers Arg-1 and CD163 (Figure 3C–G). Consistent with these findings, quantitative PCR analysis revealed that renal expression of M1-associated proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6), was significantly reduced in KO mice compared with WT controls on adenine diet (Figure 3H–I).

Figure 3. Deletion of GPR183 reduces M1 but not M2 macrophage infiltration in adenine diet–induced mouse nephropathy.

Figure 3.

Open in a new tab

(A) Schematic of the experimental design. Ten-week-old wild-type (WT) or GPR183 knockout (KO) male mice were fed either a control diet or an adenine-containing diet for 3 weeks, followed by tissue collection at sacrifice. (B) Confirmation of GPR183 deletion in KO mice by immunoblotting of kidney tissue from adenine diet–treated animals. (C–G) Representative immunofluorescence images and quantification of M1 macrophage markers (CD80, CD86) and M2 macrophage markers (Arg-1, CD163) in kidneys from adenine diet–treated WT and KO mice. GPR183 deficiency resulted in a marked reduction in CD80 and CD86 expression compared with WT, whereas Arg-1 and CD163 levels were not significantly altered. (H–J) Quantitative PCR analysis of M1 macrophage–associated cytokines, including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6), in kidneys from adenine diet–treated WT and KO mice. Data are mean ± SEM; Student’s two-tailed unpaired t-test (D-J); ns: not significant; *P<0.05; ***P<0.001.

Deletion of GPR183 alleviates fibrosis in adenine diet–induced mouse nephropathy.

Sirius Red staining revealed no significant differences in renal fibrosis between WT and KO mice on control diet. In contrast, adenine diet–fed KO mice exhibited a marked reduction in renal fibrosis compared with WT mice, as demonstrated by decreased Sirius Red–positive staining (Figure 4A and B). Consistent with these histological findings, serum creatinine levels were lower in KO mice compared with WT mice following the adenine diet, although this difference did not reach statistical significance (p = 0.0502). No difference in serum creatinine was observed under control diet conditions (Figure 4C). Furthermore, immunoblot analysis confirmed reduced expression of fibrotic markers, including fibronectin (FN) and α–smooth muscle actin (α-SMA), in kidneys from KO mice compared with WT mice after adenine diet (Figure 4D–F).

Figure 4. Deletion of GPR183 alleviates fibrosis in adenine diet–induced mouse nephropathy.

Figure 4.

Open in a new tab

(A–B) Representative Sirius Red staining images and quantification of renal fibrosis in wild-type (WT) and GPR183 knockout (KO) mice treated with either a control diet or an adenine-containing diet. (C) Serum creatinine (SCr) levels in WT and KO mice under control or adenine diet conditions. (D–F) Immunoblot analysis and densitometric quantification of the fibrosis markers fibronectin (FN) and α–smooth muscle actin (α-SMA) in kidneys from WT and GPR183 KO mice fed an adenine-containing diet. Data are mean ± SEM; two-way ANOVA with Tukey’s multiple comparison test (B and C) and Student’s two-tailed unpaired t-test (E and F); ns: not significant; *P<0.05; ***P<0.001.

Increased expression of cholesterol hydroxylases CH25H/CYP7B1 and GPR183 in folic acid–induced mouse nephropathy.

To further validate the role of GPR183 in renal injury, we employed an additional mouse model of nephropathy induced by folic acid injection (Figure 5A). Because macrophage infiltration peaks approximately one week after folic acid administration and subsequently declines, we selected this time point to assess GPR183 expression and macrophage accumulation (32). Quantitative PCR analysis demonstrated that renal mRNA levels of both cholesterol hydroxylases, CH25H and CYP7B1, were significantly increased in folic acid–treated mice compared with vehicle-treated controls (Figure 5B and C). Consistent with these findings, immunoblot analysis revealed a marked increase in GPR183 protein expression in kidneys from folic acid–treated mice relative to controls.

Figure 5. Increased expression of cholesterol hydroxylases CH25H/CYP7B1 and GPR183 in folic acid–induced mouse nephropathy.

Figure 5.

Open in a new tab

(A) Schematic of the experimental design. Ten-week-old C57BL/6 male mice received a single intraperitoneal injection of either vehicle (0.3 M sodium bicarbonate) or folic acid (250 mg/kg body weight) and were sacrificed one week later for tissue collection. (B–C) Quantitative PCR analysis of CH25H and CYP7B1 mRNA expression in kidneys from vehicle- or folic acid (FA)–treated mice. (D–E) Immunoblotting and densitometric quantification of GPR183 protein levels in kidneys from vehicle- or FA-treated mice. Data are mean ± SEM; Student’s two-tailed unpaired t-test (B, C and E); *P<0.05; **P<0.01.

Deletion of GPR183 reduces M1 but not M2 macrophage infiltration in folic acid–induced mouse nephropathy.

To further examine the role of GPR183 in renal macrophage infiltration during folic acid–induced nephropathy, WT and GPR183 KO mice were administered a single intraperitoneal injection of folic acid (250 mg/kg) and sacrificed one week later (Figure 6A). Consistent with the findings in the adenine diet model, KO mice exhibited a significantly reduced level of M1 macrophage infiltration in the kidney compared with WT mice, as evidenced by decreased CD80- and CD86-positive staining on immunofluorescence analysis. In contrast, no significant differences were observed in M2 macrophage infiltration between WT and KO mice, as assessed by staining for the M2 markers Arg-1 and CD163 (Figure 6B–F). In agreement with these observations, quantitative PCR analysis revealed lower renal expression of M1-associated proinflammatory cytokines, including TNF-α, IL-1β, and IL-6, in KO mice compared with WT mice, although the reductions in TNF-α and IL-1β did not reach statistical significance (Figure 6G–I).

Figure 6. Deletion of GPR183 reduces M1 but not M2 macrophage infiltration in folic acid–induced mouse nephropathy.

Figure 6.

Open in a new tab

(A) Schematic of the experimental design. Ten-week-old wild-type (WT) or GPR183 knockout (KO) male mice received a single intraperitoneal injection of folic acid (250 mg/kg body weight) and were sacrificed one or four weeks later for tissue collection. (B-F) Representative immunofluorescence images and quantification of M1 macrophage markers (CD80, CD86) and M2 macrophage markers (Arg-1, CD163) in kidneys from folic acid (FA)–treated WT and KO mice. GPR183 deficiency resulted in a marked reduction in CD80 and CD86 expression compared with WT, whereas Arg-1 and CD163 levels were not significantly altered. (G-I) Quantitative PCR analysis of M1 macrophage–associated cytokines, including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6), in kidneys from folic acid–treated WT and KO mice. Data are mean ± SEM; Student’s two-tailed unpaired t-test (C-I); ns: not significant; *P<0.05; **P<0.01.

Deletion of GPR183 alleviates fibrosis in folic acid–induced mouse nephropathy.

To further investigate the role of GPR183 in renal fibrosis during folic acid–induced nephropathy, WT and GPR183 KO mice were administered a single intraperitoneal injection of folic acid (250 mg/kg) and sacrificed four weeks later. Similar to the adenine diet model, KO mice exhibited significantly reduced renal fibrosis compared with WT mice, as demonstrated by decreased Sirius Red–positive staining (Figure 7A, B). Consistent with the histological findings, serum creatinine levels were significantly lower in KO mice relative to WT controls (Figure 7C). Furthermore, immunoblot analysis confirmed reduced expression of the fibrotic markers FN and α-SMA in kidneys from KO mice compared with WT mice (Figure 7D–F).

Figure 7. Deletion of GPR183 alleviates fibrosis in folic acid–induced mouse nephropathy.

Figure 7.

Open in a new tab

Ten-week-old male mice received a single intraperitoneal injection folic acid (FA, 250 mg/kg body weight) and were sacrificed 4 weeks later for tissue collection. (A–B) Representative Sirius Red staining images and quantification of renal fibrosis in wild-type (WT) and GPR183 knockout (KO) mice treated with FA. (C) Serum creatinine (SCr) levels in WT and KO mice treated with FA. (D–F) Immunoblot analysis and densitometric quantification of the fibrosis markers fibronectin (FN) and α–smooth muscle actin (α-SMA) in kidneys from WT and KO mice treated with FA. Data are mean ± SEM; Student’s two-tailed unpaired t-test (B, C, E and F); *P<0.05; ***P<0.001.

Deletion of GPR183 inhibits M1 polarization in bone marrow–derived macrophages (BMDMs).

To further elucidate the mechanisms by which GPR183 promotes M1 macrophage accumulation during kidney injury, primary BMDMs were isolated from WT and GPR183 KO mice and cultured in vitro. Cells were stimulated with lipopolysaccharide (LPS) and interferon-γ (IFN-γ) to induce M1 polarization. BMDMs from WT mice showed markedly increased CH25H and CYP7B1 mRNA expression following treatment with LPS/IFN-γ, whereas GPR183 expression did not change significantly (Figure 8A–D). Because CH25H and CYP7B1 are key enzymes involved in the biosynthesis of the endogenous GPR183 ligand, 7α,25-OHC, these findings suggest that GPR183-mediated signaling may be activated in BMDMs after LPS/IFN-γ stimulation through increased ligand production. BMDMs derived from KO mice exhibited significantly reduced M1 polarization compared with WT cells, as demonstrated by decreased expression of the M1 marker CD86 on immunoblot analysis (Figure 8E, F). Consistent with this finding, quantitative PCR analysis revealed significantly lower expression of M1-associated proinflammatory cytokines, including TNF-α, IL-1β, and IL-6, in KO BMDMs relative to WT controls (Figure 8G–I). Because NF-κB signaling plays a central role in regulating M1 polarization, we next examined NF-κB activation (35). Immunoblot analysis showed reduced levels of phosphorylated p65 (p-p65) in KO BMDMs compared with WT following LPS/IFN-γ stimulation, indicating attenuated NF-κB activation (Figure 8J, K). To assess the effect of GPR183 deletion on M2 polarization, BMDMs from WT and KO mice were treated with IL-4. KO BMDMs exhibited increased expression of the M2 marker Arg-1, as determined by immunoblot analysis (Figure 8L, M). Moreover, expression of the M2-associated cytokine connective tissue growth factor (CTGF) was significantly higher in KO BMDMs compared with WT cells (Figure 8N). Collectively, these results indicate that GPR183 promotes macrophage M1 polarization, at least in part, through activation of the NF-κB signaling pathway, while suppressing M2 polarization in BMDMs.

Figure 8. Deletion of GPR183 inhibits M1 polarization in bone marrow–derived macrophages (BMDMs).

Figure 8.

Open in a new tab

Primary BMDMs were isolated from wild-type (WT) or GPR183 knockout (KO) mice and cultured for 7 days prior to stimulation. Lipopolysaccharide (LPS) plus interferon-γ (IFN-γ) were used to induce M1 polarization, whereas interleukin-4 (IL-4) was used to induce M2 polarization. (A, B) Quantitative PCR analysis of CH25H and CYP7B1 mRNA expression and (C, D) immunoblot analysis with densitometric quantification of GPR183 in primary BMDMs isolated from WT mice treated with or without LPS/IFN-γ. (E, F) Immunoblot analysis and densitometric quantification of the M1 marker CD86 in primary BMDMs from WT and KO mice treated with or without LPS/IFN-γ. CD86 expression was significantly reduced in KO BMDMs following LPS/IFN-γ stimulation compared with WT controls. (G-I) Quantitative PCR analysis of M1-associated proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6), in WT and KO BMDMs treated with or without LPS/IFN-γ. (J, K) Immunoblot analysis and densitometric quantification of NF-κB signaling. (L, M) Immunoblot analysis and densitometric quantification of the M2 marker arginase-1 (Arg-1) in WT and KO BMDMs treated with or without IL-4. (N) Quantitative PCR analysis of M2-associated cytokine, connective tissue growth factor (CTGF) in WT and KO BMDMs treated with IL-4. Data are mean ± SEM; two-way ANOVA with Tukey’s multiple comparison test (F, G, H, I and K); Student’s two-tailed unpaired t-test (A, B, D, M and N); ns: not significant; *P<0.05; **P<0.01.

GPR183 expression is increased in immune cell populations in human CKD

To define the cellular sources and expressional of GPR183 in human kidney, we analyzed single-cell RNA-seq data integrated across CKD and healthy samples from KPMP. Unsupervised clustering and UMAP visualization identified expected major kidney parenchymal populations (PT, TAL, DCT, PC/IC, PODO) along with stromal (FB), endothelial (ENDO), and immune compartments (lymphoid and myeloid) (Figure 9A). Across the integrated atlas, GPR183 transcripts localized predominantly to immune clusters, with minimal signal detected in renal epithelial, endothelial, or stromal populations (Figure 9B, C). In particular, dot-plot quantification demonstrated significant GPR183 expression within the lymphoid and myeloid cells, while other annotated kidney cell types showed little to no GPR183 expression (Figure 9C). When stratified by disease state, GPR183 expression remained concentrated within the immune compartment but appeared more prominent in CKD samples compared with healthy controls on the feature plots (Figure 9B), consistent with disease-associated immune infiltration and/or activation in CKD kidneys.

Figure 9. Single-cell RNA-sequencing identifies increased immune-restricted expression of GPR183 in human kidney samples from CKD.

Figure 9.

Open in a new tab

(A) Uniform manifold approximation and projection (UMAP) of integrated kidney single-cell transcriptomes annotated into major renal epithelial and non-epithelial compartments, including proximal tubule (PT), PT-dedifferentiated cells, thick ascending limb (TAL), distal convoluted tubule (DCT), collecting duct principal cells (PC) and intercalated cells (IC), podocytes (PODO), endothelial cells (ENDO), fibroblasts (FB), myofibroblasts (MF), and immune lineages (lymphoid and myeloid). (B) Feature plots showing GPR183 transcript abundance overlaid on the UMAP, split by disease status (CKD vs. healthy). Color intensity indicates relative GPR183 expression. (C) Dot plot summarizing GPR183 expression across annotated cell identities in both healthy and CKD.

DISCUSSION

In this study, we identify GPR183 as a key regulator of macrophage polarization and renal fibrosis in experimental kidney injury. Using two distinct murine models of nephropathy, adenine diet–induced and folic acid–induced, we demonstrate that kidney injury is associated with increased expression of cholesterol hydroxylases CH25H and CYP7B1, enhanced GPR183 expression, accumulation of macrophages, and progressive renal fibrosis. Genetic deletion of GPR183 markedly attenuated M1 macrophage infiltration, reduced inflammatory cytokine production, and protected against renal fibrotic remodeling and functional decline. Mechanistically, we show that GPR183 promotes M1 polarization through activation of the NF-κB signaling pathway while restraining M2 polarization. In human kidneys, single-cell RNA sequencing data further demonstrate increased GPR183 expression in immune cells from patients with CKD.

GPR183 has been shown to modulate macrophage function. For example, GPR183-deficient mice exhibit reduced macrophage recruitment to the lungs during early mycobacterium tuberculosis infection (24). Similarly, loss-of-function mutation of Gpr183 or pharmacologic inhibition of GPR183 decreases macrophage infiltration and inflammatory cytokine production in the lungs of mice infected with influenza A virus or SARS-CoV-2 (25). By contrast, activation of GPR183 has been shown to trigger pain responses through upregulation of the C–C motif chemokine CCL22 in macrophages (23). Macrophage polarization is a key determinant of renal injury progression (3–6). M1 macrophages amplify inflammation and tissue damage through production of proinflammatory cytokines, whereas M2 macrophages contribute to resolution of inflammation and tissue repair (7–9). Our data demonstrate that GPR183 expression in injured kidneys is highly enriched in M1-like macrophages, with minimal expression in M2-like macrophages, and further, that GPR183 deletion selectively reduces M1 macrophage accumulation without affecting M2 macrophage infiltration in two nephropathy models. These findings establish GPR183 as a potential determinant of macrophage fate that can drive a proinflammatory phenotype during kidney injury.

Upstream of GPR183 activation, we observed marked induction of the cholesterol hydroxylases CH25H and CYP7B1, enzymes responsible for generating the potent endogenous GPR183 ligand 7α,25-dihydroxycholesterol. Although direct quantification of 7α,25-dihydroxycholesterol in tissue remains technically challenging, expression of its biosynthetic enzymes CH25H and CYP7B1 is widely used as a surrogate marker of activation of the oxysterol–GPR183 signaling axis (20, 36–38). The coordinated upregulation of these enzymes observed in our models is consistent with enhanced ligand production within the injured kidney microenvironment. CH25H expression is typically low under basal conditions in kidney parenchymal cells but is strongly induced during inflammatory responses, particularly in immune cells such as macrophages and dendritic cells. Thus, increased CH25H expression in injured kidneys likely reflects inflammatory activation of the oxysterol biosynthetic pathway. This local metabolic reprogramming could create a paracrine/autocrine signaling circuit that amplifies macrophage-driven inflammation via GPR183. While 7α,25-dihydroxycholesterol is considered the most potent endogenous ligand for GPR183, other cholesterol metabolites, including 7α,27-dihydroxycholesterol and 25-hydroxycholesterol, have also been shown to activate GPR183 (13–15). Recently, highly multiplexed ligand-screening platforms have shown that many G-protein coupled receptors, including GPR183, may also have other, previously unanticipated ligands (35). Whether these metabolites may serve as endogenous ligands for GPR183 and contribute to CKD pathogenesis warrants further investigation.

Our mechanistic studies in primary bone marrow–derived macrophages provide evidence that GPR183 promotes M1 polarization by activating NF-κB signaling (39). GPR183 deletion significantly reduced LPS/IFN-γ–induced NF-κB activation, as reflected by decreased p65 phosphorylation, leading to diminished expression of M1 markers and proinflammatory cytokines. Conversely, GPR183-deficient macrophages exhibited enhanced M2 polarization in response to IL-4, with increased expression of Arg-1 and CTGF. These results position GPR183 as a key regulator of macrophage plasticity, controlling the balance between inflammatory and reparative programs. However, the present study does not investigate the direct and detailed mechanisms of GPR183-mediated signaling in macrophages and does not distinguish the specific contribution of GPR183 to macrophage proliferation, differentiation, and polarization. It also remains unclear whether GPR183 primarily influences polarization of kidney-resident macrophages or of macrophages recruited from the circulation.

In addition to macrophages, GPR183 is expressed in other immune cell populations, including lymphocytes. Previous studies have shown that GPR183 regulates B cell migration and positioning within lymphoid organs, suggesting that it may also influence lymphocyte trafficking and local immune responses in the kidney (40–42). Consistent with prior reports (17, 18), we also detected GPR183 expression in lymphocytes in our current dataset. Although these effects were not directly examined in our study, they may contribute to renal inflammation and represent an important area for future investigation. Our current study focused primarily on macrophages because their contribution to inflammation and fibrosis in CKD is well established. In addition, our mechanistic experiments in mouse models demonstrated that Gpr183 deficiency alters macrophage polarization and reduces M1-like macrophage–associated inflammatory responses. However, because we used a global Gpr183 knockout model, we cannot exclude potential contributions from other immune compartments, including lymphoid cells such as T cells and B cells, to the observed phenotype. Future studies using cell type–specific deletion of Gpr183, such as myeloid- or lymphoid-specific knockout models, will be necessary to more precisely define the relative contributions of these immune cell populations to kidney injury and fibrosis.

Importantly, the immunologic effects of GPR183 translated directly into structural and functional renal protection. GPR183 knockout mice displayed reduced interstitial fibrosis, decreased fibronectin and α-SMA expression, and significantly improved serum creatinine in both models of kidney injury. These findings link GPR183-driven macrophage polarization to fibrotic remodeling and disease progression, demonstrating how immune dysregulation promotes chronic kidney damage. Several established signals promote M1 macrophage activation in the injured kidney, including TLR ligands, IFN-γ, Angiotensin II, hypoxia, and inflammasome activation (43–45). Our findings identify GPR183 as a previously unrecognized metabolic regulator that converges on NF-κB signaling to amplify M1 polarization in this inflammatory network. This positions GPR183 upstream of canonical inflammatory signaling and reveals a novel metabolic–immune checkpoint that drives sustained renal inflammation and fibrotic progression.

Collectively, our study reveals a previously unrecognized metabolic–immune signaling axis in kidney disease in which GPR183 activation drives NF-κB–dependent M1 polarization and promotes renal inflammation and fibrosis. Targeting the GPR183 pathway therefore represents a promising therapeutic strategy to rebalance macrophage polarization, suppress inflammation, and slow the progression of chronic kidney disease.

GRANTS

This work was supported by NIH grants: K08DK132411 (to DW) and R01DK108803 (to EPR). The KPMP is supported by the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) through the following grants: U01DK133081, U01DK133091, U01DK133092, U01DK133093, U01DK133095, U01DK133097, U01DK114866, U01DK114908, U01DK133090, U01DK133113, U01DK133766, U01DK133768, U01DK114907, U01DK114920, U01DK114923, U01DK114933, U24DK114886, UH3DK114926, UH3DK114861, UH3DK114915, and UH3DK114937. We gratefully acknowledge the essential contributions of our patient participants and the support of the American public through their tax dollars.

Footnotes

DISCLOSURES

All authors have declared that no conflict of interest exists.

DATA AVAILABILITY

All data needed to evaluate the conclusions in the paper are present in the paper. The single-cell RNA sequencing dataset generated from the KPMP is publicly available at https://KPMP.org.

REFERENCES

  • 1.Eddy AA. Overview of the cellular and molecular basis of kidney fibrosis. Kidney Int Suppl (2011) 4: 2–8, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Noronha IL, Fujihara CK, and Zatz R. The inflammatory component in progressive renal disease--are interventions possible? Nephrol Dial Transplant 17: 363–368, 2002. [DOI] [PubMed] [Google Scholar]
  • 3.Cao Q, Harris DC, and Wang Y. Macrophages in kidney injury, inflammation, and fibrosis. Physiology (Bethesda) 30: 183–194, 2015. [DOI] [PubMed] [Google Scholar]
  • 4.Niu D, Yang JJ, and He DF. The role of macrophages in renal fibrosis and therapeutic prospects. PeerJ 13: e19769, 2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wang X, Chen J, Xu J, Xie J, Harris DCH, and Zheng G. The Role of Macrophages in Kidney Fibrosis. Front Physiol 12: 705838, 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ma Y, Yang F, Yang J, Wang K, Hu J, and Wu Q. The multifaceted role of macrophages in kidney physiology and diseases. Front Immunol 16: 1642525, 2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Meng XM, Tang PM, Li J, and Lan HY. Macrophage Phenotype in Kidney Injury and Repair. Kidney Dis (Basel) 1: 138–146, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Tian S, and Chen SY. Macrophage polarization in kidney diseases. Macrophage (Houst) 2: 2015. [Google Scholar]
  • 9.Engel JE, and Chade AR. Macrophage polarization in chronic kidney disease: a balancing act between renal recovery and decline? Am J Physiol Renal Physiol 317: F1409–F1413, 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Viola A, Munari F, Sanchez-Rodriguez R, Scolaro T, and Castegna A. The Metabolic Signature of Macrophage Responses. Front Immunol 10: 1462, 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rodriguez-Morales P, and Franklin RA. Macrophage phenotypes and functions: resolving inflammation and restoring homeostasis. Trends Immunol 44: 986–998, 2023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Canfran-Duque A, Rotllan N, Zhang X, Andres-Blasco I, Thompson BM, Sun J, Price NL, Fernandez-Fuertes M, Fowler JW, Gomez-Coronado D, Sessa WC, Giannarelli C, Schneider RJ, Tellides G, McDonald JG, Fernandez-Hernando C, and Suarez Y. Macrophage-Derived 25-Hydroxycholesterol Promotes Vascular Inflammation, Atherogenesis, and Lesion Remodeling. Circulation 147: 388–408, 2023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Foo CX, Bartlett S, and Ronacher K. Oxysterols in the Immune Response to Bacterial and Viral Infections. Cells 11: 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Choi C, and Finlay DK. Diverse Immunoregulatory Roles of Oxysterols-The Oxidized Cholesterol Metabolites. Metabolites 10: 2020. [Google Scholar]
  • 15.de Freitas FA, Levy D, Reichert CO, Cunha-Neto E, Kalil J, and Bydlowski SP. Effects of Oxysterols on Immune Cells and Related Diseases. Cells 11: 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hannedouche S, Zhang J, Yi T, Shen W, Nguyen D, Pereira JP, Guerini D, Baumgarten BU, Roggo S, Wen B, Knochenmuss R, Noel S, Gessier F, Kelly LM, Vanek M, Laurent S, Preuss I, Miault C, Christen I, Karuna R, Li W, Koo DI, Suply T, Schmedt C, Peters EC, Falchetto R, Katopodis A, Spanka C, Roy MO, Detheux M, Chen YA, Schultz PG, Cho CY, Seuwen K, Cyster JG, and Sailer AW. Oxysterols direct immune cell migration via EBI2. Nature 475: 524–527, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Daugvilaite V, Arfelt KN, Benned-Jensen T, Sailer AW, and Rosenkilde MM. Oxysterol-EBI2 signaling in immune regulation and viral infection. Eur J Immunol 44: 1904–1912, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sun S, and Liu C. 7alpha, 25-dihydroxycholesterol-mediated activation of EBI2 in immune regulation and diseases. Front Pharmacol 6: 60, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chen H, Huang W, and Li X. Structures of oxysterol sensor EBI2/GPR183, a key regulator of the immune response. Structure 30: 1016–1024 e1015, 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kjaer VMS, Daugvilaite V, Stepniewski TM, Madsen CM, Jorgensen AS, Bhuskute KR, Inoue A, Ulven T, Benned-Jensen T, Hjorth SA, Hjorto GM, Moo EV, Selent J, and Rosenkilde MM. Migration mediated by the oxysterol receptor GPR183 depends on arrestin coupling but not receptor internalization. Sci Signal 16: eabl4283, 2023. [DOI] [PubMed] [Google Scholar]
  • 21.Bartlett S, Gemiarto AT, Ngo MD, Sajiir H, Hailu S, Sinha R, Foo CX, Kleynhans L, Tshivhula H, Webber T, Bielefeldt-Ohmann H, West NP, Hiemstra AM, MacDonald CE, Christensen LVV, Schlesinger LS, Walzl G, Rosenkilde MM, Mandrup-Poulsen T, and Ronacher K. GPR183 Regulates Interferons, Autophagy, and Bacterial Growth During Mycobacterium tuberculosis Infection and Is Associated With TB Disease Severity. Front Immunol 11: 601534, 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Emgard J, Kammoun H, Garcia-Cassani B, Chesne J, Parigi SM, Jacob JM, Cheng HW, Evren E, Das S, Czarnewski P, Sleiers N, Melo-Gonzalez F, Kvedaraite E, Svensson M, Scandella E, Hepworth MR, Huber S, Ludewig B, Peduto L, Villablanca EJ, Veiga-Fernandes H, Pereira JP, Flavell RA, and Willinger T. Oxysterol Sensing through the Receptor GPR183 Promotes the Lymphoid-Tissue-Inducing Function of Innate Lymphoid Cells and Colonic Inflammation. Immunity 48: 120–132 e128, 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Qi Z, Zhong W, Jiao B, Chen K, Yang X, Wang L, Zeng W, Huang J, and Xie J. Activation of G-protein-coupled receptor 183 initiates inflammatory pain via macrophage CCL22 secretion. Eur J Pharmacol 954: 175872, 2023. [DOI] [PubMed] [Google Scholar]
  • 24.Ngo MD, Bartlett S, Bielefeldt-Ohmann H, Foo CX, Sinha R, Arachchige BJ, Reed S, Mandrup-Poulsen T, Rosenkilde MM, and Ronacher K. A Blunted GPR183/Oxysterol Axis During Dysglycemia Results in Delayed Recruitment of Macrophages to the Lung During Mycobacterium tuberculosis Infection. J Infect Dis 225: 2219–2228, 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Foo CX, Bartlett S, Chew KY, Ngo MD, Bielefeldt-Ohmann H, Arachchige BJ, Matthews B, Reed S, Wang R, Smith C, Sweet MJ, Burr L, Bisht K, Shatunova S, Sinclair JE, Parry R, Yang Y, Levesque JP, Khromykh A, Rosenkilde MM, Short KR, and Ronacher K. GPR183 antagonism reduces macrophage infiltration in influenza and SARS-CoV-2 infection. Eur Respir J 61: 2023. [Google Scholar]
  • 26.Zager RA, Burkhart KM, Johnson AC, and Sacks BM. Increased proximal tubular cholesterol content: implications for cell injury and “acquired cytoresistance”. Kidney Int 56: 1788–1797, 1999. [DOI] [PubMed] [Google Scholar]
  • 27.Florens N, Calzada C, Lyasko E, Juillard L, and Soulage CO. Modified Lipids and Lipoproteins in Chronic Kidney Disease: A New Class of Uremic Toxins. Toxins (Basel) 8: 2016. [Google Scholar]
  • 28.Siems W, Quast S, Peter D, Augustin W, Carluccio F, Grune T, Sevanian A, Hampl H, and Wiswedel I. Oxysterols are increased in plasma of end-stage renal disease patients. Kidney Blood Press Res 28: 302–306, 2005. [DOI] [PubMed] [Google Scholar]
  • 29.Yang Q, Su S, Luo N, and Cao G. Adenine-induced animal model of chronic kidney disease: current applications and future perspectives. Ren Fail 46: 2336128, 2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yan LJ. Folic acid-induced animal model of kidney disease. Animal Model Exp Med 4: 329–342, 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wen D, Zheng Z, Surapaneni A, Yu B, Zhou L, Zhou W, Xie D, Shou H, Avila-Pacheco J, Kalim S, He J, Hsu CY, Parsa A, Rao P, Sondheimer J, Townsend R, Waikar SS, Rebholz CM, Denburg MR, Kimmel PL, Vasan RS, Clish CB, Coresh J, Feldman HI, Grams ME, Rhee EP, Consortium CKDB, and Investigators CS. Metabolite profiling of CKD progression in the chronic renal insufficiency cohort study. JCI Insight 7: 2022. [Google Scholar]
  • 32.Luan J, Fu J, Jiao C, Hao X, Feng Z, Zhu L, Zhang Y, Zhou G, Li H, Yang W, Yuen PST, Kopp JB, Pi J, and Zhou H. IL-18 deficiency ameliorates the progression from AKI to CKD. Cell Death Dis 13: 957, 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mendoza R, Banerjee I, Manna D, Reghupaty SC, Yetirajam R, and Sarkar D. Mouse Bone Marrow Cell Isolation and Macrophage Differentiation. Methods Mol Biol 2455: 85–91, 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wen D, Zhang Q, van Agthoven J, Weins A, Rosales IA, Zhou W, Kim T, Parada XV, Colvin RB, Pollak MR, Grams ME, Schmidt IM, Waikar SS, Arnaout MA, and Rhee EP. Testican-2 Interaction with the Extracellular Matrix and Podocyte Protection. J Am Soc Nephrol 2025. [Google Scholar]
  • 35.Chen H, Rosen CE, Gonzalez-Hernandez JA, Song D, Potempa J, Ring AM, and Palm NW. Highly multiplexed bioactivity screening reveals human and microbiota metabolome-GPCRome interactions. Cell 186: 3095–3110 e3019, 2023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Liu C, Yang XV, Wu J, Kuei C, Mani NS, Zhang L, Yu J, Sutton SW, Qin N, Banie H, Karlsson L, Sun S, and Lovenberg TW. Oxysterols direct B-cell migration through EBI2. Nature 475: 519–523, 2011. [DOI] [PubMed] [Google Scholar]
  • 37.Gold ES, Diercks AH, Podolsky I, Podyminogin RL, Askovich PS, Treuting PM, and Aderem A. 25-Hydroxycholesterol acts as an amplifier of inflammatory signaling. Proc Natl Acad Sci U S A 111: 10666–10671, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yi T, Wang X, Kelly LM, An J, Xu Y, Sailer AW, Gustafsson JA, Russell DW, and Cyster JG. Oxysterol gradient generation by lymphoid stromal cells guides activated B cell movement during humoral responses. Immunity 37: 535–548, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mussbacher M, Derler M, Basilio J, and Schmid JA. NF-kappaB in monocytes and macrophages - an inflammatory master regulator in multitalented immune cells. Front Immunol 14: 1134661, 2023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Chu C, Moriyama S, Li Z, Zhou L, Flamar AL, Klose CSN, Moeller JB, Putzel GG, Withers DR, Sonnenberg GF, and Artis D. Anti-microbial Functions of Group 3 Innate Lymphoid Cells in Gut-Associated Lymphoid Tissues Are Regulated by G-Protein-Coupled Receptor 183. Cell Rep 23: 3750–3758, 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ruiz F, Wyss A, Rossel JB, Sulz MC, Brand S, Moncsek A, Mertens JC, Roth R, Clottu AS, Burri E, Juillerat P, Biedermann L, Greuter T, Rogler G, Pot C, Misselwitz B, and Swiss IBDCSG. A single nucleotide polymorphism in the gene for GPR183 increases its surface expression on blood lymphocytes of patients with inflammatory bowel disease. Br J Pharmacol 178: 3157–3175, 2021. [DOI] [PubMed] [Google Scholar]
  • 42.Bub L, Evren E, Verwaerde S, Ruscitti C, Vanneste D, Ghosh P, Gao Y, Sleiers N, Deng R, Lopez Montes M, Howley K, La Rocca R, Niehrs A, Glaros V, Reina-Campos M, Dahlen B, Smed-Sorensen A, Lund H, Kreslavsky T, Bjorkstrom NK, Reboldi A, Bossios A, Marichal T, Lambrecht BN, and Willinger T. Sensing of metabolic signals via GPR183 promotes occupation of lung macrophage niches by monocytes. J Exp Med 223: 2026. [Google Scholar]
  • 43.Wen Y, and Crowley SD. The varying roles of macrophages in kidney injury and repair. Curr Opin Nephrol Hypertens 29: 286–292, 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Li M, Wang M, Wen Y, Zhang H, Zhao GN, and Gao Q. Signaling pathways in macrophages: molecular mechanisms and therapeutic targets. MedComm (2020) 4: e349, 2023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tang PM, Nikolic-Paterson DJ, and Lan HY. Macrophages: versatile players in renal inflammation and fibrosis. Nat Rev Nephrol 15: 144–158, 2019. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data needed to evaluate the conclusions in the paper are present in the paper. The single-cell RNA sequencing dataset generated from the KPMP is publicly available at https://KPMP.org.

RESOURCES