Suppression of Calcium Influx Reduces Coxsackievirus B3 Lethality With Elevated Interferon Beta Responses in Mice

ABSTRACT

The disease course of severe enterovirus (EV) infection with hepatic necrosis is usually fulminant and fatal. Coxsackievirus (CVB3) is the emerging and important serotype of newborn EV inducing hepatic necrosis. Calcium (Ca²⁺) regulates host immunity, type I interferon (IFN‐I), and viral infections. The interaction of Ca²⁺, IFN‐I, and CVB3‐induced hepatitis remains to be investigated. To address these issues, we used the Ca²⁺ blocker manidipine, which reduces Ca²⁺ influx into cells and is used in the clinic, the human hepatoma cell line (HuH7) for in vitro studies, and a murine infection model. In vitro results showed that CVB3 infection increased levels of intracellular Ca²⁺ and Ca²⁺‐binding proteins, calmodulin and calcineurin, which are IFN‐I suppressors. Moreover, manidipine decreased CVB3 titers in a manner dependent on IFN‐I. Mouse results revealed that manidipine reduced CVB3 lethality, viral loads, and organ damage of infected mice with elevated levels of IFN‐β protein and mRNAs encoding IFN‐β and interferon‐stimulated genes (ISGs), especially in the liver. Mechanism studies showed that manidipine enhanced the levels of mRNAs encoding IFN‐β or ISG, IFNB1 promoter activity, and IFN‐β induction pathways of both RLR and STING in infected HuH7 cells. Overall, CVB3 infection increases Ca²⁺ influx to suppress IFN‐β, and blocking Ca²⁺ influx has the potential to reduce CVB3 infection by enhancing IFN‐β.

1. Introduction

Enteroviruses (EVs) belong to the Picornaviridae and are transmitted through the fecal‐oral route [1, 2, 3, 4, 5, 6]. Many EV serotypes can cause mortality and irreversible sequelae in young children, because effective antivirals are unavailable for all EVs. Fatal EV outbreaks are frequently reported [1, 2, 3, 4, 5, 6]. Many cases are associated with fulminant hepatitis and isolation of coxsackievirus B3 (CVB3) from the liver [2, 5, 6]. CVB3 has become an emerging etiological agent of hepatitis among infants [2, 5, 6] and has long been a notorious pathogen inducing acute myocarditis [1, 7, 8]. The expression of coxsackievirus and adenovirus receptor (CAR), a CVB3 receptor [7, 8], in both the heart and liver [6, 7, 8] explains the severe symptoms, myocarditis, and hepatitis, of infected patients. Vaccines are unavailable for CVB3. Enterovirus A71 (EV‐A71) is the EV serotype inducing brainstem encephalitis and threatens the health of young children for decades [4]. Reports searching for EV antivirals mostly focus on EV‐A71. Several potential EV‐A71 antivirals were tested, but failed in clinical trials due to drug resistance because of virus mutations or side effects [9, 10]. A better understanding of viral pathogeneses is needed to develop effective EV antivirals.

Calcium (Ca²⁺) is a versatile second messenger regulating essential and diverse cellular activities [11]. The intracellular Ca²⁺ level is lower than the extracellular Ca²⁺ level in resting cells. Upon stimulation, the intracellular Ca²⁺ level is elevated to initiate signaling pathways regulating cellular responses. The voltage‐gated Ca²⁺ channels on the cell membrane trigger Ca²⁺ inflow (influx) into cells to increase the intracellular Ca²⁺ level [11, 12, 13]. Several types of voltage‐gated Ca²⁺ channels have been identified. Long‐lasting (L‐type) and transient opening (T‐type) Ca²⁺ channels are found in the cardiovascular system and serve as targets for the treatment of hypertension. Manidipine inhibits both l‐ and T‐type Ca²⁺ channels, has a high safety profile with a lower incidence of side effects (peripheral edema), and represents the first‐line treatment option for patients with essential mild‐to‐moderate hypertension [13, 14].

Viruses target voltage‐gated Ca²⁺ channels to induce Ca²⁺ influx and signaling pathways [15, 16, 17]. The roles of Ca²⁺‐mediated responses in viral infections are controversial. Ca²⁺ signaling can be hijacked by viruses to promote viral entry, replication, assembly, budding, or dissemination [15, 16, 17]. However, Ca²⁺ signaling can suppress viruses by inducing type I interferon (IFN‐I) once viruses are recognized by pattern recognition receptors (PRRs), which activate mitochondrial antiviral signaling protein (MAVS) and TANK‐binding kinase 1 (TBK1) [17]. Notably, few viruses can increase Ca²⁺ and Ca²⁺‐binding proteins, calmodulin and calcineurin, to suppress IFN‐I by reducing MAVS and TBK1 [18, 19].

During CVB3 infection, issues regarding the intracellular Ca²⁺ dynamics, Ca²⁺‐binding proteins, and the connection between Ca²⁺ signaling and viral pathogenesis or host immune responses remain to be investigated. To address these issues with a focus on CVB3‐induced hepatitis, we used Ca²⁺ channel blockers, in vitro studies, and a murine infection model. We showed that CVB3 infection increased Ca²⁺ to suppress IFN‐β, and Ca²⁺ channel blockers used in the clinic could be potential CVB3 antivirals.

2. Materials and Methods

2.1. Cells and Viruses

The human muscle (rhabdomyosarcoma, RD) cell line was used for propagation and titration of CBV3. The green monkey kidney epithelial cell line (Vero) with a genetic defect in the production of IFNs, especially IFN‐I [20], was used to assess the effect of Ca²⁺ signaling on IFN‐I in CVB3 replication. RD and Vero cells were maintained according to the instructions of the American Type Culture Collection. As CVB3 induces hepatitis in humans, the human hepatoma cell line, HuH7, was used for the study and maintained in Dulbecco's Modified Eagle Medium with 10% fetal bovine serum according to the instructions of the Japanese Collection of Research Bioresources Cell Bank. CVB3 (isolate No. 17020091) was obtained from the patient with liver necrosis in National Cheng Kung University Hospital and used for in vitro assays. This isolate was adapted in mice four times [21] and used for the murine infection model. In this murine infection model, the most abundant viral load was detected in the mouse liver.

2.2. Cell Viability Assay

The cell viability of HuH7 cells treated without or with various concentrations of manidipine (Cayman) for 24 h was measured by using the Cell Counting Kit‐8 reagent (Enzo Life Sciences) according to manufacturer instructions.

2.3. Measurement of Ca2⁺ Concentration in a Single Cell

Intracellular Ca²⁺ concentration was measured at 37°C by the Fura‐2 fluorescence ratio method [22] using a single‐cell fluorimeter. In brief, cells attached to glass‐bottom dishes were cultured in serum‐free culture medium with 2 μM of Fura‐2/acetoxymethyl ester (Fura‐2/AM) at 37°C for 30 min before cells were washed three times with phosphate‐buffered saline (PBS). Then the dish with cells was placed on the stage of the Olympus IX71 inverted microscope equipped with the Xenon illumination system and an IMAGO CCD camera (TILL Photonics). The excitation wavelength was alternated between 340 nm (I340) and 380 nm (I380) by using the Polychrome IV monochromator (TILL Photonics). The fluorescence intensity of excitation at 510 nm was monitored to calculate the intracellular Ca2⁺ levels by the TILLvisION 4.0 program (Till Photonics). The ratios 510 nm/340 nm and 510 nm/380 nm are directly related to the amount of intracellular Ca²⁺ [22].

2.4. In Vitro Assay for the Antiviral Effect of Manidipine

HuH7 and Vero cells were infected with CVB3 at a multiplicity of infection (MOI) of 0.001 for 2 h, treated with or without manidipine, harvested 22 h later, and subjected to the plaque assay to determine viral titers or to western blotting to quantify proteins.

2.5. Western Blotting

The total proteins of human cell cultures were extracted, measured for concentrations, separated by 10% SDS‐PAGE, and blotted onto nitrocellulose membranes as previously described [21]. Blots were blocked by 5% bovine serum albumin to prevent nonspecific binding before incubation with primary antibodies against EV VP3 (clone L66J; Invitrogen) or human proteins, β‐actin (clone AC‐15; Sigma‐Aldrich), calmodulin (Cell Signaling Technology), calcineurin (Cell Signaling Technology), IRF‐3 (Abcam), phosphorylated (p)‐IRF‐3 (S386, Cell Signaling Technology), IRF‐7 (Cell Signaling Technology), p‐IRF‐7 (Ser477; Cell Signaling Technology), MAVS (Cell Signaling Technology), STING (Abcam), p‐STING (Ser366; Affinity), DRP‐1 (Abcam), p‐DRP‐1 (Ser616; Cell Signaling Technology), TBK1 (Abcam), or p‐TBK1 (Ser172; Abcam) and with corresponding horseradish peroxidase‐conjugated secondary antibodies for chemiluminescence detection. Images were detected and photographed by the eBLOT Touch Imager and analyzed by the ImageJ software (National Institutes of Health). β‐actin was used for normalization.

2.6. Infection and Manidipine Treatment of Mice

All mouse experiment protocols were approved by the Institutional Animal Care and Use Committee at National Cheng Kung University with the approval number 109297. Fourteen‐day‐old mice were infected with 5 × 10⁶ plaque‐forming units (PFU)/mouse of CVB3 or mock‐infected by intraperitoneal inoculation. Mice were treated with one shot of manidipine (1 or 10 mg/kg) or PBS daily for 7 days starting from 1 day post‐infection by intraperitoneal injection and monitored for survival and body weights. Mouse tissues were collected, weighed, and subjected to the plaque assay to determine viral titers or to hematoxylin and eosin (H&E) staining. Images of H&E staining were obtained by using the Olympus DP12 digital microscope camera. Mouse blood was collected and processed into serum. Aspartate aminotransferase (AST) and alanine transaminase (ALT) in serum were assessed by commercially available enzyme‐linked immunosorbent assay (ELISA) kits (Abcam). Mouse livers were harvested, frozen at −80°C, and homogenized in the cell lysis buffer (Cell Signaling Technology) containing the protease inhibitor cocktail (Sigma‐Aldrich). Mouse liver and serum samples were subjected to the commercially available ELISA kit for the detection of mouse IFN‐β (BioLegend) with the detection limits of 2.7 pg/mL.

2.7. Quantitative Real‐Time RT‐PCR

Total RNA was extracted from cells or mouse tissues, and cDNA was synthesized with the master mix with Oligo (dT) or random primers as previously described [21]. The synthesized cDNA was used for quantitative real‐time PCR with primers for mRNA encoding mouse IFN‐β (forward primer: GGTGGAATGAGACTATTGTTG and reverse primer: AGGACATCTCCCACGTC), CXCL10 (forward primer: GCTGGGATTCACCTCAAGAA and reverse primer: CTTGGGGACACCTTTTAGCA), Mx1 (forward primer: CTGAGATGACCCAGCACCTGAA and reverse primer: CTCCAGGAACCAGCTGCACTTAC), β‐actin (forward primer: AACCCTAAGGCCAACCGTGAAAAGATGACC and reverse primer: CCAGGGAGGAAGAGGATGCGGC), human IFN‐β (forward primer: TGGTGGTGAAGCTGTAGCC and reverse primer: CTATCCCTGTACGCCTCTGG), CXCL10 (forward primer: GTGGCATTCAAGGAGTACCTC and reverse primer: TGATGGCCTTCGATTCTGGATT) or β‐actin (forward primer: CTATCCCTGTACGCCTCTGG and reverse primer: TGGTGGTGAAGCTGTAGCC). PCR was performed with an initiation of 10 min at 95°C, followed by 40 cycles of denaturation (95°C, 15 s) and annealing (60°C, 1 min) with the Fast SYBR Green Master Mix (Applied Biosystems). The threshold cycle (Ct) of each product was determined and normalized to that of β‐actin as ΔCt.

2.8. Assay of the Promoter Activity of Human IFN‐β

HuH7 cells were transfected with the luciferase reporter plasmid containing the promoter encoding human IFN‐β (IFN‐β‐Luc) as previously described [23]. The plasmid expressing Renilla luciferase was used as an internal control to normalize transfection efficiency. The empty vector (pcDNA6.0/Myc‐His) was used to normalize the total amount of plasmids. After transfection or stimulation for 16–24 h, cells were lysed with the passive lysis buffer (Promega). The luciferase activities in lysates were measured by the Dual‐Luciferase assay (Promega) and detected by the SpetraMax i3x system (Molecular Devices) according to manufacturer instructions.

2.9. Statistical Analyses

Data are expressed as mean ± standard error (SE) values. For statistical comparison, Kaplan–Meier survival curves of mice were analyzed by the log‐rank test, and the rest of the mouse data were analyzed by the Mann–Whitney U test. In vitro data were analyzed by the Student's t‐test. All P values are for two‐tailed significance tests.

3. Results

3.1. Suppression of Ca²⁺ Influx Induced by CVB3 via Ca²⁺ Channel Blockers Reduces CVB3 Yields in an IFN‐Dependent Manner In Vitro

We used manidipine and HuH7 cells for in vitro studies to uncover the role of Ca²⁺ in CVB3 infection. We first assessed the effect of manidipine on the viability of HuH7 cells and obtained the value of 50% cellular cytotoxicity concentration (CC₅₀) to be > 500 μM (Figure 1 and Table S1). Comparable results were obtained from other cell lines (RD, SK‐N‐SH, and Vero), which also support CVB3 replication (Table S1 and Figure S1).

Figure 1.

The effect of manidipine on cell viability. The viability of HuH7 cells treated without or with various concentrations of manidipine for 24 h is shown. The value of cells without manidipine treatment was set as 100%. Data represent means ± SE (error bars) of ≥ 3 samples/data point.

We assessed the intracellular Ca²⁺ levels of HuH7 cells before and after CVB3 infection. The intracellular Ca²⁺ level was low before infection, and CVB3 infection instantly increased the intracellular Ca²⁺ level (Figure 2), showing that CVB3 infection triggers Ca²⁺ influx. The intracellular Ca²⁺ level of infected cells remained elevated at 18 h post‐infection (hpi). We tested to reduce the intracellular Ca²⁺ level of infected cells by treatment with manidipine at 2 hpi and found that manidipine at the concentration of 25 μM, which failed to significantly reduce cell viability, rapidly decreased the intracellular Ca²⁺ level by about 50%, showing that manidipine decreases Ca²⁺ influx of infected cells. The intracellular Ca²⁺ level of infected cells treated with manidipine remained low at 18 hpi.

Figure 2.

Effects of CVB3 and manidipine on intracellular calcium levels. Intracellular calcium levels of HuH7 cells mock‐infected or infected with CVB3 (MOI = 5) and treated without or with manidipine (25 μM) for the indicated times are shown. The data are the representative of three independent experiments.

We then tested the therapeutic effect of manidipine on CVB3 by treating cells with the drug after infection. HuH7 cells infected with CVB3 (MOI = 0.001) for 2 h were treated without or with manidipine (10 or 25 μM) and harvested at 24 hpi to determine viral titers. Manidipine decreased CVB3 titers of HuH7 cells in a dose‐dependent manner (Figure 3A) with the 50% effective concentration (EC₅₀) of 15 μM (Table S1). The selectivity index (CC₅₀/EC₅₀) of manidipine for CVB3 in HuH7 cells is > 33 (Table S1). Manidipine at the concentration of 25 μM, which failed to significantly affect cell viability but significantly reduced the CVB3 yield, was used for further studies. Manidipine (25 μM) also decreased the level of CVB3 capsid protein, VP3, in HuH7 cells (Figure 3B).

Figure 3.

Manidipine decreases CVB3 titers and protein in vitro. (A) HuH7 cells were infected with CVB3 (MOI = 0.001) for 2 h, treated without or with various concentrations of manidipine, and harvested 24 h post‐infection to determine viral titers. (B) HuH7 cells were infected with CVB3, treated without (−) or with (+) manidipine (25 μM) as described above, harvested at indicated hours post‐infection (hpi), and subjected to western blotting. Values of the CVB3 protein VP3 were normalized to those of actin in samples. Value of infected samples without manidipine treatment and harvested at 6 h post‐infection were set as 1. Data represent means + SE (error bars) of ≥ 3 samples/group. *p < 0.05 and **p < 0.01.

Intracellular Ca²⁺ can regulate the expression of IFNs [17], which is shown to suppress CVB3 replication efficiently [24]. As Vero cells are genetically defective in the production of IFNs, especially IFN‐I [20], we tested the antiviral activity of manidipine on CVB3 in Vero cells. Notably, manidipine at the concentration of 25 μM, which decreased CVB3 titers in HuH7 and SK‐N‐SH cells (Figures 3A and S2A), and even a higher concentration (50 μM) failed to reduce CVB3 titers in Vero cells (Figure 4), showing that manidipine reduces CVB3 replication in a manner dependent on IFN.

Figure 4.

Manidipine fails to reduce CVB3 titers in Vero cells. Vero cells were infected with CVB3 (MOI = 0.001) for 2 h, treated without or with various concentrations of manidipine, and harvested 24 h post‐infection to determine viral titers. Data represent means + SE (error bars) of ≥ 3 samples/group. ***p < 0.001.

Nicardipine is another Ca²⁺ blocker inhibiting both l‐ and T‐type Ca²⁺ channels and approved by the US Food and Drug Administration for the treatment of severe high blood pressure (hypertension) and chest pain (angina) [25]. We assessed nicardipine for its effect on cell viability and obtained the value of CC₅₀ to be > 500 μM in both HuH7 and Vero cells (Figure S3A,B). We measured the antiviral activity of nicardipine, which reduced CVB3 titers in a dose‐dependent manner with the EC₅₀ value of 13 μM in HuH7 cells (Figure S3C). We measured the antiviral activity of nicardipine, which failed to reduce CVB3 titers in Vero cells at concentrations of 10–100 μM (Figure S3D), showing that nicardipine reduces CVB3 replication in a manner dependent on IFN, like manidipine. We chose manidipine with a high safety profile for further studies.

3.2. Manidipine Decreases CVB3 Lethality, Viral Loads, and Organ Damage in Infected Mice

We tested the antiviral effect of manidipine in vivo using the murine model with 2‐week‐old C57BL/6 mice infected with mouse‐adapted CVB3 by intraperitoneal inoculation. We first assessed the manidipine dosage and found that treatment with manidipine at the dose of 10 g/kg, but not 1 mg/kg, once daily for 7 days starting from 1 day post‐infection (dpi) by intraperitoneal injection increased the survival rate of infected mice (Figure 5A,B ). Manidipine at both doses of 10 and 1 mg/kg failed to decrease the body weights of infected mice (Figure 5C), suggesting that the toxicity effect of manidipine on infected mice under these two doses is minimal. We then monitored viral loads in mouse organs and tissues and found that manidipine at the dose of 10 mg/kg significantly decreased viral loads in the liver on both 3 and 5 dpi as well as in the heart on 5 dpi and slightly reduced viral loads in the central nervous system (brain, brain stem, and spinal cord) on 3 or 5 dpi (Figure 5D). Our H&E staining results showed that CVB3 infection of mice induced damage in the liver with lesions as well as leukocyte infiltration, and that manidipine ameliorated the liver damage of infected mice on 7 dpi (Figure 5E). AST and ALT are two liver enzymes released into serum when the liver is damaged. We measured these two liver enzymes in the mouse serum on 7 dpi and showed that CVB3 infection increased serum AST and ALT levels and that manidipine decreased serum AST and ALT levels of infected mice (Figure 5F). Overall, manidipine reduced viral loads and damage, especially in the liver of infected mice.

Figure 5.

Manidipine reduces CVB3 infection in mice. Mice were infected with CVB3, treated with saline or various doses of manidipine (n = 10/group), and monitored for survival (A, B) and body weights (C). (D) Viral titers in organs/tissues harvested on indicated times are shown. (E) Livers of naïve mice, mice treated with manidipine (10 mg/kg), and infected mice treated with saline (CVB3) or manidipine (CVB3 + manidipine) were harvested on day 7 post‐infection and subjected to H&E staining. Scale bar, 100 μm. Data are the representative of at least 3 samples/group from two independent experiments. (F) Sera of mice mock‐infected (−) or infected with virus (+) and treated without (−) or with (+) or manidipine (10 mg/kg) were harvested on 7 days post‐infection to assay for AST and ALT. Data represent means ± SE (error bars) of ≥ 5 samples/data point (D) or group (F). *p < 0.05, **p < 0.01, and ***p < 0.001.

3.3. Manidipine Increases Liver Levels of IFN‐β Protein and mRNAs of Ifnb1 and Interferon‐Stimulated Genes in Infected Mice

We assessed IFN‐I proteins in mice by ELISAs and showed that CVB3, but not manidipine, enhanced the IFN‐β level in the liver of mice on 5 dpi (Figure 6A). Notably, manidipine further enhanced the liver IFN‐β level of infected mice on 5 dpi. In the mouse serum, CVB3 slightly increased the IFN‐β level, but manidipine failed to further enhance the IFN‐β level of infected mice, on both 3 and 5 dpi (Figure S4). For IFN‐α protein, CVB3, but not manidipine, enhanced the mouse liver and serum cytokine levels on both 3 and 5 dpi (Figure S5). In the liver, manidipine failed to further enhance the IFN‐α levels of infected mice on both 3 and 5 dpi. In the serum, manidipine slightly enhanced the IFN‐α levels of infected mice on both 3 and 5 dpi and by about twofold on 5 dpi.

Figure 6.

Manidipine enhances the expression of IFN‐β and ISGs in the livers of CVB3‐infected mice. (A) Livers of mice infected with (+) or without (−) CVB3 and treated without or with manidipine (10 mg/kg) were harvested on day 5 post‐infection and assayed for IFN‐β by ELISA. (B) Livers of mice without treatment (Naïve), treated with manidipine (Manidipine), infected with CVB3 (CVB3), or infected with CVB3 and treated with manidipine (CVB3 + manidipine) were harvested at the indicated times and subjected to quantitative RT‐PCR for the indicated mRNAs. Data represent means ± SE (error bars) of ≥ 5 samples/group or data point. Values of naïve mouse samples harvested on day 3 post‐infection were set as 1 (B). *p < 0.05, **p < 0.01, and ***p < 0.001.

We also found that manidipine significantly enhanced the mRNA levels of Ifnb1 and interferon‐stimulated genes, Myxoma resistance (Mx) 1 and C‐X‐C Motif Chemokine Ligand 10 (Cxcl10), in the liver of infected mice on both 3 and/or 5 dpi by 4‐16‐fold (Figure 6B). In the heart, manidipine slightly enhanced the levels of mRNA encoding IFN‐β in infected mice on both 3 and 5 dpi (Figure S6A,B). Additionally, manidipine slightly enhanced the levels of mRNA encoding IFN‐γ in the liver and heart of infected mice on 5 dpi by threefold (Figure S6D,F).

As manidipine protected mice from CVB3 infection with elevated IFN‐β responses in mice, we tested the drug to protect A129 mice, which lack IFN‐α/β receptors, from CVB3 infection. Our additional results showed that manidipine failed to protect A129 mice from CVB3 infection (Figure S7), suggesting that IFN‐I is needed to protect manidipine‐treated mice from CVB3 infection.

3.4. Manidipine Enhances Levels of IFNB1 mRNA, Promoter Activity, and Induction Pathways in Infected Cells

To investigate the induction of IFN‐β by CVB3 infection and/or manidipine, we performed in vitro studies using HuH7 cells and found that CVB3, but not manidipine (25 μM), enhanced the mRNA levels of IFNB1 and CXCL10 in HuH7 cells at 12 hpi and that manidipine further enhanced the mRNA levels of IFNB1 and CXCL10 in infected HuH7 cells at 12 hpi (Figure 7A) in manners like those observed in mice. Furthermore, we studied the activation of IFNB1 promoter and found that CVB3, but not manidipine, significantly activated the IFNB1 promoter and that manidipine further enhanced the IFNB1 promoter activity of infected HuH7 cells as demonstrated by a reporter assay (Figure 7B).

Figure 7.

Manidipine enhances levels of IFNB1 and CXCL10 mRNAs and IFNB1 promoter activity in infected cells. (A) Levels of indicated cytokine mRNAs normalized to those of internal control, ACTN mRNA in HuH7 cells without treatment (Naïve), treated with manidipine (Manidipine, 25 μM), infected with CVB3 (CVB3), or infected with CVB3 and treated with manidipine (CVB3 + manidipine) at the indicated times are shown. (B) Levels of IFNB1 promoter activity in HuH7 cells infected without (−) or with (+) CVB3 and treated without (−) or with (+) manidipine are shown. Data represent means ± SE (error bars) of > 3 samples/group. Values of naïve cells harvested at 3 h post‐infection were set as 1 (A). *p < 0.05, **p < 0.01, and ***p < 0.001.

Among PRRs, retinoic‐acid‐inducible gene I (RIG‐I)‐like receptors (RLRs), including RIG‐I and melanoma differentiation‐associated protein‐5 (MDA5), Toll‐like receptor 3 (TLR3), and TLR7/8, are RNA sensors capable of sensing CVB3 RNA genomes [26, 27, 28] (Figure S9). To induce IFN‐I, RLRs increase MAVS to activate (phosphorylate) TBK1, which activates IRF3 and IRF7 by phosphorylation [29]. TLR3 and TLR7/8 increase tumor necrosis factor receptor‐associated factor 3 (TRAF3) and TRAF6 to activate TBK1, which induces IRF3 or IRF7 activation. Although CVB3 is an RNA virus, reports showed that CVB3 can activate cGAS‐stimulator of interferon genes (STING), a classical DNA sensor, before activating TBK1 and then IRF3 to induce IFN‐I, which suppresses CVB3 replication efficiently [24, 30].

Normally, Ca²⁺ is shown to promote RLR, TLR, and STING pathways to induce IFN‐I [17]. However, viruses can target Ca²⁺ to suppress PRR pathways. Classical swine fever virus is found to increase intracellular Ca²⁺ and its binding protein, calmodulin, to reduce MAVS and IFN‐I [18]. Calcineurin is a phosphatase which gains enzymatic activity only upon association with Ca²⁺‐calmodulin [19]. Vesicular stomatitis virus and herpes simplex virus serotype 1 are reported to recruit calcineurin to suppress IFN‐I signaling by deactivating TBK1 through dephosphorylation [19]. Notably, Ca²⁺ influx stimulated by the Ca²⁺ ionophore, ionomycin, has been shown to cause mitochondria fission to suppress the production of IFN‐β induced by the STING ligand (DMXAA) via the pathway of STING/TBK1/IRF3 [31]. Accordingly, we assessed Ca²⁺‐binding proteins, calmodulin and calcineurin, IFN‐I suppressors, and found that manidipine reduced the levels of these two proteins in infected cells at 24 hpi (Figure 8). We assessed the RLR pathway by examining MAVS and phosphorylated TBK1, IRF3, as well as IRF7 and found that manidipine enhanced the levels of these four proteins in infected cells at 12 or 24 hpi (Figure 8). We assessed the mitochondria fission mediator, dynamin‐related protein 1 (Drp1) [31] and STING and found that manidipine reduced the level of phosphorylated Drp1, but enhanced the level of phosphorylated STING, at 24 hpi (Figure 8). We assessed the TLR3 and TLR7/8 pathways by examining TRAF3 and TRAF6 and found that manidipine failed to enhance the levels of these two proteins at 6, 12, and 24 hpi (data not shown). These results showed that manidipine enhances the RLR pathway, MAVS/TBK1/IRF3 (IRF7), and suppresses mitochondrial fission to enhance the STING/TBK1/IRF3 pathway (Figure S9).

Figure 8.

Effects of manidipine on Ca²⁺ and IFN‐β signaling pathways in infected cells. (A) HuH7 cells were infected with CVB3 (MOI = 5) for 2 h, treated without or with manidipine (25 μM), harvested at the indicated times, and subjected to western blotting. (B) Values of the indicated protein were normalized to those of actin in the samples. Values of infected samples harvested at 12 h post‐infection were set as 1. Data represent means+ SE (error bars) of ≥ 3 samples/group. *p < 0.05 and **p < 0.01.

4. Discussion

Our additional results show that manidipine reduces EV‐A71 titers in the human neuroblastoma cell line, SK‐N‐SH, but not in Vero cells (Figure S2D,E), in a manner similar to that of CVB3. We also tested manidipine in EV‐A71‐infected mice and found that the drug protected mice from infection (Figure S8). In addition to CVB3, another EV serotype, echovirus 11, is reported to induce fatal hepatitis in young children of Taiwan [3, 5]. We tested and found that manidipine decreased echovirus 11 titers in HuH7 and/or SK‐N‐SH cells (Figure S2B,C). Echovirus 11 fails to infect mice, so mouse in vivo results are unavailable. Both our in vitro and in vivo results reveal that manidipine inhibits EVs in a manner not specific to a particular cell line or EV serotype and suggest that manidipine could be a potential treatment for EVs. Antivirals are unavailable for all EVs, as side effects and drug resistance account for the failure of several EV antivirals tested in clinical trials [9, 10]. The development of new therapies for any virus is a lengthy and costly process, so repurposing of clinical drugs as treatments for CVB3 is another option. Both manidipine and nicardipine have a high safety profile with a lower incidence of side effects, so repurposing of manidipine for the treatment of EVs can avoid toxicity.

We show that CVB3 infection instantly triggers Ca²⁺ influx, suggesting that viral capsid (structural) proteins or the interaction of the virus with its receptor induce Ca²⁺ influx. Because suppression of both l‐ and T‐type voltage‐gated Ca²⁺ channels by manidipine treatment immediately reduces Ca²⁺ influx by 50%, l‐type and/or T‐type voltage‐gated Ca²⁺ channels should be partially responsible for CVB3 infection to initiate Ca²⁺ influx during the early stage of infection. An in vitro report found that expression of CVB3 non‐structural protein 2B, which is expressed late during infection, increases the influx of extracellular Ca²⁺ [32]. This may explain our result showing that the elevated intracellular Ca²⁺ level of CVB3‐infected cells was sustained for a long time, 18 hpi. As CVB3 infection triggers Ca²⁺ influx to increase viral replication, future studies should be allocated to investigate how CVB3 infection induces Ca²⁺ influx by identifying the viral proteins and Ca²⁺ channel types involved in order to have a better understanding of viral pathogenesis for the development of effective antivirals.

Many reports show that viral infections induce Ca²⁺ influx to promote every step of the viral replication cycle, like entry, replication, assembly, budding, and dissemination [15, 16, 17]. Here, we reveal that CVB3 induces Ca²⁺ influx to promote viral replication by suppressing IFN‐β induction pathways and production. Although we show that manidipine can be a potential antiviral agent by increasing IFN‐β to reduce viral yields and protein expression, further mechanistic studies are needed to determine whether the antiviral effect of manidipine results from inhibition of viral entry, replication, assembly, or release. Viral infections induce IFN‐β to protect the host from infections. IFN‐β production is tightly regulated [33], because excessive IFN‐β can damage the infected host. Ca²⁺ has been shown to positively and negatively regulate IFN‐β production. Numerous reports show that Ca²⁺ increases IFN‐β induction pathways and production. Few in vitro studies show Ca²⁺ acting as a negative regulator. Our present study is novel in showing that viral infection increases Ca²⁺ to reduce IFN‐β production, leading to the enhancement of viral replication and disease severity in vivo. Ca²⁺ inhibits IFN‐β production by suppressing both the RLR pathway, MAVS/TBK1/IRF3 (IRF7), and the STING/TBK1/IRF3 pathway. Our findings are obtained by using manidipine, which partially decreases CVB3‐induced Ca²⁺ influx by 50%. Further studies should address whether a high and sustained level of Ca²⁺ influx induced by a virus, such as CVB3, diminishes IFN‐β induction pathways and production, but a low level of Ca²⁺ influx triggered by other viruses induces IFN‐β induction pathways and production. We show that Ca²⁺‐binding proteins, calmodulin and calcineurin, which can suppress IFN‐I, are reduced by manidipine in infected cells. Calmodulin and calcineurin are multifunctional proteins involved not only in IFN‐I suppression but also in broader immune responses, such as T‐cell activation [34, 35]. Their upregulation may reflect a host immune response to CVB3 infection or a transition from the innate to adaptive responses, rather than solely contributing to immune evasion. Transformed cell lines are used for our studies. RD and Vero cells, which lack robust IFN‐I responses, are commonly used for EV propagation [20, 36]. HuH7 cells have limitations in RLR‐mediated signaling [37]. Our results may not fully reflect the complexity of human cells or organ‐specific immune responses during CVB3 infection. Future studies using human primary cells or organoid systems are needed to further validate our findings.

Manidipine has been shown to inhibit viruses, such as DNA viruses, human cytomegalovirus (HCMV), and RNA viruses, Japanese encephalitis virus (JEV), Zika virus of flaviviruses, Lujo virus, and lymphocytic choriomeningitis virus of arenaviruses, SARS‐CoV‐2, and severe fever with thrombocytopenia syndrome virus [38, 39, 40, 41, 42]. Only the JEV study tests manidipine (in mice) in vivo [42], and the rest of the studies are performed in vitro. Few of these studies investigate the antiviral mechanism of manidipine. Manidipine is shown to be the entry inhibitor of Lujo virus without a detailed mechanism [38]. The following two reports identify the viral factors involved but leave unanswered questions. Manidipine is found to halt the replication of HCMV by targeting the viral immediate‐early 2 (IE2) protein [39]. The JEV study, which selects virus resistant to manidipine, identifies that the mutation in viral protein NS4B confers resistance [42]. The issues regarding how manidipine interacts with HCMV IE2 and JEV NS4B are unknown. Both HCMV IE2 and JEV NS4B are reported to block IFN‐β production [43, 44], suggesting the possibility that manidipine may decrease HCMV and JEV via IFN‐β.

Both manidipine and nicardipine inhibit l‐ and T‐type Ca²⁺ channels and are used to treat patients with hypertension. Our in vitro study shows that nicardipine reduces CVB3 titers (Figure S3C). Nicardipine has been tested in hundreds of children and found to be well tolerated, safe, and effective in children of all ages for control of hypertension irrespective of underlying pathology [45, 46]. Manidipine is well tolerated with adverse effects mostly related to vasodilation in patients with hypertension treated with 10 or 20 mg of manidipine daily for up to 12 months [47]. Manidipine is contraindicated in pediatric patients, despite the fact that the report regarding the adverse effects of manidipine on young children is unavailable. Overall, our study is novel in showing that CVB3 infection hijacks the cellular Ca²⁺ signaling by inducing Ca²⁺ influx to suppress IFN‐β induction pathways and production, leading to the enhancement of viral replication and disease severity in vivo (Figure S9). Therefore, blocking Ca²⁺ influx could be an effective strategy for developing potential antivirals.

Author Contributions

Yi‐Ling Hsiao and Cheng‐Huei Hung contributed equally to this study by performing experiments and analyzing data. Ming Te Yeh supervised and provided suggestions. Shun‐Hua Chen conducted the study, obtained fundings, and wrote the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supporting File 1

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request. The data are not publicly available due to privacy or ethical restrictions.