Validation of ferroptosis in zebrafish as a reliable model for phenotypic studies

Abstract

In recent years, ferroptosis has attracted considerable attention as a novel form of cell death. With the deepening of research into its mechanisms, ferroptosis has gained increasing significance. Currently, the vast majority of ferroptosis-related studies are conducted on mice; however, mouse breeding requires a relatively long time, and the cost of gene screening is high. In contrast, zebrafish, as a small-sized vertebrate model organism with a short growth cycle, shares 85% genetic homology with humans.Zebrafish larvae have transparent bodies, which allows for convenient and intuitive observation of their developmental status during the early developmental stage. Would conducting ferroptosis-related experiments on zebrafish larvae be more convenient and efficient than on mice? To verify this hypothesis, the present study treated zebrafish embryos with two ferroptosis inducers (Erastin, FIN56) and ammonium ferric citrate (FAC). The levels of reactive oxygen species (ROS), glutathione (GSH)/oxidized glutathione (GSSG) ratio, somatic cell death, and the expression levels of ferroptosis-related genes and proteins were detected, and differentiated from apoptotic and autophagic indicators. Additionally, ferroptosis-induced impairment of vascular development was observed in transgenic zebrafish with vascular-specific fluorescence. The results of this study indicate that: A ferroptosis model can be successfully established in zebrafish; Ferroptosis significantly inhibits angiogenesis in zebrafish. These findings lay a foundation for future ferroptosis-related research using zebrafish.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-43493-w.

Introduction

Ferroptosis, newly named by The Nomenclature Committee on Cell Death (NCCD) in 2014, is one of the four major forms of cell death, alongside necrosis, apoptosis, and autophagy. Initial research on ferroptosis focused on neural cells^1,2, and subsequent studies have identified ferroptosis in tumor cells, hepatocytes, cardiomyocytes, and other cell types^3–5. With the continuous advancement of ferroptosis research, new discoveries and breakthroughs have been made in understanding the mechanisms underlying the occurrence and development of various diseases, highlighting the great significance of further investigating ferroptosis.

Currently, most animal models for ferroptosis research are mice, particularly ferroptosis-related transgenic mice. The construction of these models during experiments requires a long time, validation is complex, and some indicators are not easily verified quickly. Thus, can zebrafish models be employed for ferroptosis experiments? As a vertebrate model organism, zebrafish shares 85% genetic homology with humans, and its signal transduction pathways are highly similar to those of humans^6–9. Furthermore, zebrafish possesses favorable traits such as genetic tractability and low cost, making it suitable for large-scale genetic and chemical screening of new targets. Research results obtained from zebrafish models can complement those from mouse models, enabling the exploration of relevant issues at different levels.

In this study, zebrafish embryos were treated with ferroptosis inducers(Erastin, FIN56) and FAC. ROS probes and enzyme-linked immunosorbent assay (ELISA) were used to detect changes in ROS levels and GSH/GSSG ratio in larvae. Cell staining was employed to assess cell death indicators. Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot were used to determine the expression changes of ferroptosis-related genes and proteins, which were differentiated from autophagic and apoptotic indicators. Additionally, the correlation between vascular developmental disorders and ferroptosis was observed in a transgenic zebrafish model with vascular-specific fluorescence. This study aimed to investigate whether classical ferroptosis indicator changes occur in the zebrafish model, thereby accumulating experimental data for the establishment of a ferroptosis model using zebrafish.

Materials and methods

Zebrafish and transgenic lines

Wild-type zebrafish and transgenic zebrafish (Tg: fli-EGFP) were provided by Suzhou Murui Biotechnology Co., Ltd. The fli gene is expressed in vascular endothelial cells, allowing the observation of green fluorescence under a fluorescence microscope, which facilitates the analysis of vascular changes. All animal experiments were approved by the institutional animal care and use committee of Soochow University. All methods were carried out in accordance with relevant guidelines and regulations. And all methods are reported in accordance with ARRIVE guidelines.

Zebrafish rearing

Adult zebrafish were reared in recirculating water with a 14 h/10 h light/dark cycle, and the water temperature was maintained at 28 °C. They were fed three times a day, with fresh brine shrimp in the morning and evening. For zebrafish mating experiments, male and female zebrafish were paired in advance in the evening and separated using a partition. At 9:00 the next morning, the partition was removed to initiate spawning. Embryos were collected after 30 min and placed in E3 medium (60 mmol༏L NaCl, 0.67 mmol༏L KCl, 0.3 mmol༏L NaHCO₃, 0.9 mmol༏L CaCl₂, pH 7.2) containing methylene blue. Developmental stages were marked by hours post-fertilization (hpf), and embryos were cultured in a light-controlled incubator (14 h/10 h light/dark cycle) at 28 °C. During larval rearing, paramecia were fed daily starting from 5 days post-fertilization, and the status of the larvae was observed.All zebrafish involved in the animal experiments were anesthetized with 200 mg/L tricaine methanesulfonate (MS-222, Sigma, USA). Following the experiments, the zebrafish were euthanized via rapid freezing at 2–4 °C.

Zebrafish treatment drugs

1. Ferroptosis inducer: Erastin (Sigma, USA), which induces Fe-dependent non-apoptotic cell death by acting on mitochondria; the working concentration used in this experiment was 30 µM.

2. Ferroptosis inhibitor: Ferrostatin-1 (Ferr-1) (Sigma, USA), a selective inhibitor of Erastin-induced ferroptosis, with a working concentration of 20 µM.

3. Second ferroptosis inducer: FIN56 (MCE, China), a specific ferroptosis inducer that induces ferroptosis by degrading GPX4 protein, with a working concentration of 20 µM.

4. Ammonium ferric citrate (FAC), a ferrous iron agent, with a working concentration of 200 µM.

5. Deferoxamine (DFO), an iron chelator, with a working concentration of 100 µM.

Stock solutions of the above reagents were prepared with dimethyl sulfoxide (DMSO) and diluted to working concentrations with E3 medium.

Experimental groups

At 24 hpf, larvae were treated with drugs diluted in E3 medium for 48 h before sample collection. The control group was treated with the same amount of DMSO (0.01%). Both drug solutions and DMSO solutions were refreshed daily until sample collection. The experimental groups are shown in the following table:

Wild-type zebrafish	Transgenic zebrafish
a. Control group b. Erastin-treated group (Era group) c. Erastin + Ferrostatin-1-treated group (Era + Fer-1 group) d. FIN56-treated group (FIN56 group) e. FAC-treated group (FAC group) f. FAC + DFO-treated group (FAC + DFO group)	a. Control group b. Erastin-treated group (Era group) c. Erastin + Ferrostatin-1-treated group (Era + Fer-1 group)

For wild-type zebrafish, 10 larvae per group in the control and treatment groups were used for ROS detection and acridine orange staining; 30 larvae per group were used for qPCR, GSH/GSSG detection, and Western blot analysis.

For transgenic zebrafish, 10 larvae per group in the control and treatment groups were used for specific fluorescence observation.

Detection methods

Trypan blue staining: Trypan blue is a cell viability dye that stains dead cells blue and is commonly used for the identification of dead cells in tissue and cell cultures. 0.2 g of trypan blue was dissolved in 100 mL of phosphate-buffered saline (PBS) to prepare a 0.2% trypan blue staining solution. Larvae in the control and treatment groups were treated with 0.003% phenylthiourea (PTU) at 8 hpf to inhibit pigment formation until sample collection. Ten larvae from each group were incubated with 0.2% trypan blue staining solution at room temperature for 60 min, washed three times with E3 medium, observed under a stereomicroscope, photographed, and the number of blue-stained dead cells was counted.

ROS probe detection and quantification: Reactive Oxygen Species Detection Kit (Solarbio CA1410, China) was used for the detection and quantification of ROS in cells. 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA) has cell membrane permeability and does not fluoresce in the reduced state; upon oxidation, the reagent emits strong green fluorescence and remains in the cells. After drug treatment, i.e., on the 4th day post-fertilization, zebrafish larvae were treated with anesthetic (50 mg/L), washed with PBS, and incubated with 10 µM DCFH-DA fluorescent probe at 37 °C for 30 min. After washing with E3 medium, images were captured under a fluorescence microscope(DFM-60 C, Caikon, China) within 30 min to observe and photograph the ROS content in zebrafish. The Fluorescence intensity of entire larva was quantitatively analyzed using ImageJ software. The same magnification, exposure time, gain, and contrast settings were used throughout the measurement process.

GSH/GSSG detection: Glutathione (GSH) and Oxidized Glutathione (GSSG) Detection Kit (Beyotime S0053, China) was used. After treating 24 hpf zebrafish embryos for 48 h, 30 zebrafish from each treatment group were collected into EP tubes. GSH and GSSG were extracted from the control and treatment groups according to the kit instructions for reaction color development. The absorbance of the samples at a wavelength of 412 nm was measured using a spectrophotometer. The contents of GSH and GSSG in each sample were calculated based on the standard curve, and the GSH/GSSG ratio was determined.

Malondialdehyde(MDA) detection: MDA Detection Kit (Beyotime S0131S, China) was used. After treating 24 hpf zebrafish embryos for 48 h, 30 zebrafish from each treatment group were collected into EP tubes. MDA were extracted from the control and treatment groups according to the kit instructions for reaction color development. The absorbance of the samples at a wavelength of 532 nm was measured using a spectrophotometer. The contents of MDA in each sample were calculated based on the standard curve.

Western blot: Thirty larvae from each control and treatment group were collected after 48 h of drug treatment. 0.5 mL of RIPA lysis buffer was added, and the samples were ground on ice and lysed for 15 min. After centrifugation at 12,000 rpm for 5 min at 4 °C, the supernatant was collected. The obtained proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and detected with the following antibodies: Anti-Glutathione Peroxidase 4 antibody (1:2000, abcam, ab125066) and Anti-Beta Actin antibody (1:2000, HUABIO, R1207-1) to analyze protein expression levels.

Acridine orange staining: Acridine orange is a fluorescent dye that stains apoptotic bodies with yellow-green fluorescence and is used for the detection of apoptosis. 0.05 g of acridine orange was diluted with distilled water to 100 mL to prepare a 0.5 mg/mL acridine orange stock solution, which was then diluted 1:100 to a final concentration of 5 µg/mL. Ten larvae from each control and treatment group were added to 1 mL of acridine orange staining solution with a final concentration of 5 µg/mL, incubated at room temperature for 30 min, washed three times with E3 medium, and excited with 488 nm laser under a fluorescence microscope to observe and photograph the fluorescence of the larvae.

qRT-PCR: Total RNA was extracted from 30 larvae in each control and treatment group using an RNA extraction kit from Invitrogen (Carlsbad, USA). Then, 1 µg of RNA was reverse-transcribed into complementary DNA (cDNA) using oligo (dT) 20 primers and M-MLV reverse transcriptase. The cDNA was diluted 10-fold as the amplification template, and β-actin was used as the internal reference gene. RT-qPCR was performed on a SYBR^® Premix Ex Taq™ (Takara, China) instrument using a StepOne Real-Time PCR detection system. The relative expression level of the target gene was calculated using the 2 − ΔΔCT method, and each group of data was repeated with at least three independent samples. Primer sequences are shown in Supplementary Table 1.

Fluorescence observation of transgenic zebrafish: Ten larvae from each control and treatment group of Tg(fli-EGFP) were placed under a fluorescence microscope and excited with 488 nm laser to observe and photograph the green fluorescence of the cardiovascular system in the larvae.

Statistical analysis

All data were expressed as mean ± standard deviation. Student’s t-test and Student–Newman–Keuls test (one-way analysis of variance) were used to analyze differences between groups. Each experiment was repeated at least three times. A P value < 0.05 was considered statistically significant.

Results

Erastin induces ferroptosis in zebrafish

To confirm the occurrence of ferroptosis in zebrafish, trypan blue staining was used to detect cell death. Statistical results showed that the number of dark blue dotted stained cells in the tail of zebrafish in the Era group was higher than that in the control group, while the number was lower in the Era + Fer-1 group than in the Era group (Fig. 1A, C). Ferroptosis leads to an increase in intracellular ROS. The results of ROS content detection using the fluorescent probe DCFH-DA showed that the fluorescence intensity of zebrafish in the Erastin-treated group was significantly higher than that in the control group; after treatment with Ferrostatin-1, the fluorescence intensity was significantly lower than that in the Erastin group, and quantitative analysis of fluorescence intensity indicated a statistically significant difference (P < 0.01) (Fig. 1B, D). The detection results of the reduced GSH/GSSG ratio in zebrafish showed that the GSH/GSSG ratios in both the Era group and the Era + Fer-1 group were significantly lower than that in the Control group (Fig. 1E). The GSH content in both the Era group and the Era + Fer-1 group was significantly lower than that in the control group, while there was no significant difference in GSH content between the Era group and the Era + Fer-1 group (Fig. 1F). There was no significant difference in GSSG content among the three groups of zebrafish (Fig. 1G). The results of malondialdehyde (MDA) content detection for lipid oxidation in zebrafish showed that the MDA level in the Era group was significantly higher than that in the control group. However, after treatment with the ferroptosis inhibitor (Fer-1), the MDA level decreased significantly and showed no statistically significant difference compared with the control group (Fig. 1H). Western blot analysis of proteins from the three groups of zebrafish revealed that the Gpx4 protein level in the Era group was lower than that in the Control group and the Era + Fer-1 group, with no significant difference between the Control group and the Era + Fer-1 group (Fig. 1I). quantitative real-time PCR results showed that compared with the Control group, the expression of gpx4a in the Era group showed a downward trend; the expression level of gpx4a in the Era + Fer-1 group was approximately 5 times that in the Era group (Fig. 1J). The RNA expression levels of ferroptosis-related genes ptgs2a, ptgs2b, acsl4a, slc7a11, and ROS production-related gene cat in the Era group were increased to varying degrees compared with the Control group, and after treatment with Era + Fer-1, the expression of these genes was significantly decreased compared with the Era group (Fig. 1K-O). To differentiate from apoptosis and autophagy, acridine orange staining results showed that there was no significant difference in the number of yellow-green apoptotic bodies among the three groups of zebrafish (Supplementary Fig. 1A). There were no statistically significant differences in the RNA expression levels of apoptosis-related genes (casp3a, casp9, tp53), autophagy-related genes (ulk1a, map1lc3b), and some ROS generation genes (sod1, sod2) among the three groups (Fig. 1I-M, Supplementary Fig. 1B). The above results indicate that Erastin treatment induced ferroptosis rather than autophagy or apoptosis in zebrafish.

Fig. 1.

Erastin induces ferroptosis in zebrafish, which can be rescued by the ferroptosis inhibitor Ferrostatin-1. Erastin increases somatic cell death in zebrafish. Larvae treated with PTU were stained with 0.2% trypan blue for 1 h, n = 10. The red arrows indicate the deeply stained dead cells by trypan blue in zebrafish larvae, and the other similarly shaped deeply stained areas in the head and tail of the larvae are dead cells(A), and the stained dead cells in the entire larva were quantitatively counted (C). Erastin (30 µM) can induce an increase in ROS in zebrafish, and Fer-1 can rescue this process (B), and the average fluorescence intensity of the entire larva was quantitatively analyzed, n = 10 (D). After Erastin treatment, the GSH/GSSG ratio in zebrafish tissues decreases, GSH content significantly decreases, and there is no statistical difference in GSSG content, n = 30 (E, F, G). After Erastin treatment, the MDA content in zebrafish tissues increases, n = 30 (H). Zebrafish larvae at 24 hpf were treated with Erastin and Ferrostatin-1 for 48 h, then sampled for Western blot detection, n = 70 (I). Zebrafish larvae at 24 hpf were treated with Erastin and Ferrostatin-1 for 48 h, then sampled for quantitative real-time PCR detection, n = 30 (J-O).n.

FIN56 also induces ferroptosis in zebrafish cells

To further confirm that ferroptosis can occur in zebrafish somatic cells, another ferroptosis chemical (FIN56) with a different mechanism of action from Erastin was used to treat 24 hpf zebrafish embryos for 48 h. Trypan blue staining results showed that the number of dark blue dotted stained cells in the tail of zebrafish in the FIN56 group was higher than that in the control group (Fig. 2A, B). The fluorescent probe DCFH-DA was used to detect changes in ROS content in zebrafish larvae, and fluorescence intensity was statistically analyzed using ImageJ. It was found that the ROS level in zebrafish in the FIN56 group was significantly increased (P < 0.01) (Fig. 2C, D). Compared with the control group, after FIN56 treatment, there was no significant change in GSH content, but GSSG content was significantly increased, and the GSH/GSSG ratio was significantly decreased (Fig. 2E, F, G). The results of malondialdehyde (MDA) content detection for lipid oxidation in zebrafish showed that the MDA level in the FIN56 group was significantly higher than that in the control group(Fig. 2H). At the protein level, Western blot results indicated that the Gpx4 protein content in the FIN56-treated group was significantly lower than that in the control group(Fig. 2I). At the gene level, quantitative analysis of ferroptosis-related genes (gpx4a, ptgs2a, ptgs2b, acsl4a, slc7a11) and ROS generation-related genes cat was performed, and the results showed that their RNA expression levels were increased to varying degrees (Fig. 2J-O). Acridine orange staining results showed no significant increase in apoptotic bodies in the treatment group (Supplementary Fig. 2A). There were no statistically significant differences in the RNA expression levels of autophagy and apoptosis-related genes (ulk1a, casp3a, casp9, tp53) (Supplementary Fig. 2B). These results demonstrate that both FIN56 and Erastin can induce ferroptosis in zebrafish.

Fig. 2.

FIN56 induces ferroptosis in zebrafish FIN56 can increase somatic cell death in zebrafish. Larvae treated with PTU were stained with 0.2% trypan blue for 1 h, n = 10. The red arrows indicate the deeply stained dead cells by trypan blue in zebrafish larvae, and the other similarly shaped deeply stained areas in the head and tail of the larvae are dead cells(A), and the stained dead cells in the entire larva were quantitatively counted (B). Treatment with FIN56 (20 µM) can induce an increase in ROS in zebrafish (C), and the average fluorescence intensity of the entire larva was quantitatively analyzed, n = 10 (D). After FIN56 treatment, the GSH/GSSG ratio in zebrafish tissues decreases, there is no statistical difference in GSH content, and GSSG content significantly increases, n = 30 (E, F, G). After FIN56 treatment, the MDA content in zebrafish tissues increases, n = 30 (H). Zebrafish larvae at 24 hpf were treated with FIN56 for 48 h, then sampled for Western blot detection, n = 70 (I). Zebrafish larvae at 24 hpf were treated with FIN56 for 48 h, then sampled for quantitative real-time PCR detection, n = 30 (J-O).

FAC induces ferroptosis in zebrafish cells

Subsequently, this study verified whether FAC can induce ferroptosis in zebrafish. 24 hpf zebrafish embryos were treated with E3 medium, FAC, and FAC + iron chelator DFO for 48 h, respectively. Trypan blue staining results showed that the number of dark blue dotted stained cells in the tail of zebrafish in the FAC group was higher than that in the control group, while the number was lower in the FAC + DFO group than in the FAC group (Fig. 3A, B). Then, the fluorescent probe DCFH-DA was used to detect the ROS content in zebrafish larvae, and fluorescence intensity was statistically analyzed using ImageJ. It was found that the ROS level in zebrafish in the FAC group was significantly increased (P < 0.01), and after simultaneous treatment with DFO, the ROS level was significantly lower than that in the FAC group (P < 0.01) (Fig. 3C, D). The detection results of GSH/GSSG showed that compared with the control group, after FAC treatment, there was no significant change in GSH content in zebrafish larvae, but GSSG content was significantly increased, and the GSH/GSSG ratio was significantly decreased (Fig. 3E, F, G). The detection results of MDA content showed that compared with the control group, after FAC treatment, MDA content was significantly increased, and after DFO treatment, the FAC-induced elevation of MDA showed a decreasing trend, but there was no statistically significant difference (Fig. 3H). At the protein level, the Gpx4 protein level in zebrafish in the FAC-treated group was significantly lower than that in the control group and also lower than that in the DFO-treated group(Fig. 3I). At the gene level, the ferroptosis-related gene gpx4a was significantly increased both in the FAC treated and DFO treated group. The expression levels of ptgs2a and slc7a11 in the FAC-treated group were significantly higher than those in the control group, and the levels in the FAC + DFO-treated group were lower than those in the FAC-treated group. The ROS-promoting gene cat showed a increasing trend in the FAC-treated group, and the expression of sod1 didn’t decrease after FAC + DFO treatment compared with the FAC-treated group. Acridine orange staining results of the three groups of zebrafish showed no significant differences (Supplementary Fig. 3A). Meanwhile, quantitative analysis of apoptosis and autophagy-related genes revealed no significant statistical differences in the expression levels of apoptosis genes (casp3a, casp9, tp53) among the three groups. Among the autophagy genes (ulk1a, map1lc3b), only the expression level of ulk1a in the FAC + DFO-treated group was lower than that in the FAC group (Supplementary Fig. 3B). These results confirm that FAC induces ferroptosis rather than autophagy or apoptosis in zebrafish.

Fig. 3.

FAC induces ferroptosis in zebrafish, which can be rescued by the iron chelator DFO. FAC can increase somatic cell death in zebrafish. Larvae treated with PTU were stained with 0.2% trypan blue for 1 h, n = 10. The red arrows indicate the deeply stained dead cells by trypan blue in zebrafish larvae, and the other similarly shaped deeply stained areas in the head and tail of the larvae are dead cells(A), and the stained dead cells in the entire larva were quantitatively counted (C). FAC (200 µg/ml) can induce an increase in ROS in zebrafish, and DFO can rescue this process (B), and the average fluorescence intensity of the entire larva was quantitatively analyzed, n = 8 (D). FAC induces a decrease in the GSH/GSSG ratio in zebrafish, no statistical difference in GSH content, and a significant increase in GSSG content, n = 30 (E, F, G).FAC induces a increase in the MDA content in zebrafish, n = 30 (H). Zebrafish larvae at 24 hpf were treated with FAC and DFO for 48 h, then sampled for Western blot detection, n = 70 (I). Zebrafish larvae at 24 hpf were treated with FAC and DFO for 48 h, then sampled for quantitative real-time PCR detection, n = 30 (J-O).

Ferroptosis inhibits angiogenesis in zebrafish

To confirm the effect of ferroptosis on zebrafish, Tg(fli: EGFP) transgenic zebrafish with vascular-specific fluorescence were treated with Erastin for 48 h. The results showed that the fluorescence intensity of the dorsal longitudinal vessels and intersegmental vessels in the Erastin-treated group was significantly weaker than that in the control group. This is considered to be due to a certain degree of inhibition of angiogenesis, and this inhibition was reversed after the application of Ferrostatin-1.(Fig. 4).

Fig. 4.

Erastin inhibits angiogenesis in zebrafish Impaired angiogenesis was observed in Tg(fli: EGFP) fluorescent zebrafish after Erastin treatment, which was rescued by Ferrostatin-1, n = 10.

Discussion

This study conducted preliminary research on ferroptosis in zebrafish and established a novel zebrafish model for studying ferroptosis. Firstly, Erastin mainly inhibits GSH synthesis by acting on System Xc- on the cell surface and simultaneously upregulates the expression of prostaglandin-endoperoxide synthase 2 (PTGS2, a marker gene for ferroptosis) to induce ferroptosis^1,10,11. GPX4 is a core regulatory protein of ferroptosis, whose main function is to scavenge harmful superoxides and block the lipid peroxidation chain reaction^12,13. The specific ferroptosis inducer FIN56 induces ferroptosis by degrading GPX4 protein through the activity of acetyl-CoA carboxylase^13,14. Therefore, we used these two inducers (Erastin and FIN56) that induce ferroptosis through different pathways to treat 24 hpf zebrafish embryos for 48 h. In this study, trypan blue staining was used to detect cell death in zebrafish, and the results showed an increase in somatic cell death compared with the control group, which was inhibited by the ferroptosis inhibitor Ferrostatin-1. This indicates that the cell death induced by ferroptosis inducers is indeed related to ferroptosis. When cells undergo ferroptosis, intracellular lipid ROS will increase^15,16. In this study, the fluorescent probe DCFH-DA was used to detect the ROS content in zebrafish larvae, and it was found that the ROS level in zebrafish in the Erastin group was significantly increased, the expression of ROS generation-related genes sod1, sod2, and cat was increased, and decreased after Ferrostatin-1 treatment. This confirms that excessive ROS is indeed produced when treated with ferroptosis inducers; at the same time, Erastin leads to the massive consumption of GSH in zebrafish, while FIN56 causes the massive accumulation of GSSG by degrading GPX4 protein, both of which significantly reduce the GSH/GSSG ratio, thereby inducing ferroptosis. The above results are consistent with existing research results^17–21. To further verify ferroptosis in zebrafish, we analyzed the expression of ferroptosis-related genes and proteins. In the Erastin-treated group, the expression of ptgs2a, ptgs2b, and slc7a11 was significantly increased, the expression of gpx4a and gpx4b showed a downward trend, and Western blot results confirmed the decrease in Gpx4 protein level. These changes can be reversed by Ferrostatin-1. In the FIN56-treated group, the increased expression of gpx4a and gpx4b may be a stress-induced increase at the mRNA level after inducer treatment, which was verified by the subsequent Western blot showing a significant decrease in GPX4 protein content. Acridine orange staining of zebrafish did not show a significant increase in apoptotic bodies, and there were no significant differences in the expression of most apoptosis and autophagy-related genes. In summary, ferroptosis rather than apoptosis or autophagy did occur in zebrafish. The upregulated expression of ptgs2a and acsl4a induced by FAC treatment, which was subsequently downregulated after DFO intervention, combined with the distinct expression pattern of gpx4a, may suggest that the mechanism underlying FAC-induced ferroptosis is different from that of Erastin, and the mode of ferroptosis rescue by DFO also differs from that of Fer-1. Similar results in ptgs2a, acsl4a gene expression were obtained in subsequent experiments with FAC and DFO treatment, indicating that increased iron can indeed induce ferroptosis in zebrafish, and a zebrafish ferroptosis model can be established using FAC treatment.

Table 1.

Primer sequences.

Gene	Sequence (5’ to 3’) F	Sequence (5’ to 3’) R
gpx4a	ATTGATGTGAATGGCGACGG	CTTCACAACCTGGCCTTCAC
gpx4b	CCTGGAAGTGAAGCGGAGAT	CAGTGTTCCTCTGCCTTTGG
ptgs2a	GGCGTGTGTTTATCCAAGGG	TTGATGCGTGTGAGAAGCTC
ptgs2b	TGTCTGTACGGAAATGGGCT	AGTGTTGGGAGAAGGCTTCA
slc7a11	TTTCGTGACTGAGGAGGTGG	GCTCATCTGCTGACATCACTG
sod1	CAAGGCCGTTTGTGTGCTTA	AAAGCATGGACGTGGAAACC
sod2	TCATCACAGCAAGCACCATG	TTCAATGCAGGCTGAAGGGA
cat	ATGGCCCATTTTGACCGAGA	CTTTGGAGTAGCGCGTGATG
ulk1a	GAAGCTCCAAAGTCCCTCCC	ACTGGCTCACTGGTGAACTG
map1lc3b	TCCAAACAAGATCCCGGTCA	GACCAGCAGGAAGAAAGCCT
casp3a	AACTTTGATCGCAGGACAGG	CGCAACTGTCTGGTCATTGT
casp9	GGGGTCTTCACTCAGGACAT	AGTCTCACGCAGGGAATCAA
tp53	AAACGACAGCCAAGAGTTCG	CCGGCAAGTACTCCTCATCA
acsl4a	GAGCAGGCACTATCACCGAA	TTGCGTAAGCGCAGATGTTG

.

Zebrafish vascular formation is similar to that of early mammals^22,23. Within one week after fertilization, embryos can obtain oxygen through diffusion without relying on circulation, allowing embryos with vascular defects to continue developing^24–26. Therefore, zebrafish is an excellent model for studying vascular diseases. Existing studies have shown that ferroptosis plays an important role in arterial atherosclerosis and cerebral microangiopathy^27–30. In this study, we found that after Erastin treatment, the fluorescence intensity of the dorsal longitudinal anastomotic vessels and intersegmental vessels in Tg(fli: EGFP) transgenic zebrafish with vascular-specific fluorescence labeling was significantly weaker than that in the control group. We hypothesize that this phenomenon is attributable to the fact that ferroptosis induced by the ferroptosis inducer exerts a partial inhibitory effect on angiogenesis, and this inhibitory effect is reversed following the administration of Ferrostatin-1. Recent studies have demonstrated that ferroptosis in human umbilical vein endothelial cells (HUVECs) leads to a decrease in the expression levels of angiogenesis-related proteins VEGFA and ANG-1, thereby inhibiting angiogenesis³¹. Based on these findings, we have reason to speculate that ferroptosis occurring in zebrafish vascular endothelial cells results in impairment of vascular development.

The relationship between angiogenesis and osteogenesis also plays a crucial role in bone development, repair, and regeneration^32,33. Bone formation and maintenance depend on the delivery of oxygen, nutrients, and signaling molecules provided by the vascular system, while angiogenesis is regulated by the bone microenvironment. This bidirectional interaction is known as “osteogenesis-angiogenesis coupling"^34–41.Considering that one of the important methods for establishing zebrafish osteoporosis models is FAC treatment⁴², zebrafish will be an excellent model for studying osteogenesis-angiogenesis coupling and ferroptosis.

In this study, we conducted ferroptosis verification experiments using the ferroptosis inducers Erastin, FIN56, and the ferroptosis inhibitor Ferrostatin-1 in zebrafish, a model organism. FAC can also induce ferroptosis in zebrafish, which is inhibited by deferoxamine (DFO). At the same time, we found that ferroptosis of vascular endothelial cells leads to impaired vascular development and extension in zebrafish. We believe that zebrafish is a good animal model for studying ferroptosis-related diseases, and we plan to conduct more in-depth research on osteogenesis-angiogenesis coupling and ferroptosis using this model.

Conclusions

In recent years, ferroptosis has been proven to be related to diseases of the nervous and vascular systems, as well as various tumor diseases. We verified the occurrence of ferroptosis in the zebrafish model and found that the impairment of zebrafish vascular development after Erastin treatment may be caused by ferroptosis of endothelial cells. In conclusion, the zebrafish model will have broad application prospects in the research of ferroptosis and its related diseases.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Authors’ roles: Study design: ZC, GL, RZ, MW and YX. Technical and material support: HZ, AW, MZ and QW. Data analysis and interpretation: ZC, GL, RZ and MW. Drafting and revising manuscript: ZC, GL, RZ, MW and YX. ZC, GL, RZ and MW take responsibility for the integrity of the data analysis. All authors approved the final version of the manuscript.

Funding

This study was supported by grants from Natural Science Foundation of China (82072474);

Gusu Health Talent Program (GSWS2020024); Suzhou Industrial Park Healthcare Talent Support Initiative, 2024(42); Jiangsu Province Innovation and Entrepreneurship Doctorate, JSSCBS1178; Suzhou Gusu Health Talent Support Initiative, 2024(116).

Data availability

The data used to support the findings of this study are available from the corresponding author upon request.

Declarations

Competing interests

The authors declare no competing interests.