SIRT4 positively regulates autophagy via ULK1, but independently of HDAC6 and OPA1

Isabell Lehmkuhl; Khawar Amin; Lydia Gabriel; Nils Hampel; Afshin Iram; Julia Hesse; Constanze Wiek; Jasmin Thuy Vy Nguyen; Helmut Hanenberg; Jürgen Scheller; M Reza Ahmadian; Björn Stork; Doreen M Floss; Roland P Piekorz

doi:10.1002/2211-5463.70164

. 2025 Nov 20;16(5):870–884. doi: 10.1002/2211-5463.70164

SIRT4 positively regulates autophagy via ULK1, but independently of HDAC6 and OPA1

Isabell Lehmkuhl ¹, Khawar Amin ¹, Lydia Gabriel ¹, Nils Hampel ¹, Afshin Iram ¹, Julia Hesse ², Constanze Wiek ³, Jasmin Thuy Vy Nguyen ¹, Helmut Hanenberg ^3,⁴, Jürgen Scheller ¹, M Reza Ahmadian ¹, Björn Stork ⁵, Doreen M Floss ¹, Roland P Piekorz ^1,^✉

PMCID: PMC13145358 PMID: 41262010

Abstract

The sirtuin SIRT4 has been implicated in the control of autophagy and mitochondrial quality control via mitophagy. However, the role of SIRT4 in regulating autophagy/mitophagy induced by different stressors is unclear. Here, we show that cells expressing SIRT4(H161Y), a catalytically inactive, dominant‐negative mutant of SIRT4, fail to upregulate LC3B‐II. These cells also exhibit a reduced autophagic flux upon treatment with different inducers of mitophagy/autophagy, that is, CoCl₂‐triggered pseudohypoxia, CCCP (carbonyl cyanide 3‐chlorophenylhydrazone)/oligomycin‐mediated respiratory chain inhibition, or rapamycin treatment. Interestingly, SIRT4(H161Y) expression upregulated protein levels of HDAC6, which is involved in mitochondrial trafficking and autophagosome‐lysosome fusion, and inhibited the conversion of OPA1‐L to OPA1‐S, which is associated with increased mitochondrial fusion and decreased mitophagy. Both HDAC6 and OPA1 are SIRT4 interactors. However, the pharmacological inhibition of HDAC6 using Tubacin or of OPA1 using MYLS22 did not restore the stress‐induced upregulation of LC3B‐II levels upon autophagy/mitophagy treatment in SIRT4(H161Y)‐expressing cells. Remarkably, inhibition of autophagosome–lysosome fusion and thus disruption of late autophagic flux by BafA1 treatment also failed to restore LC3B‐II levels upon autophagy/mitophagy treatment, suggesting an inhibitory effect of SIRT4(H161Y) on the initiation/early phase of autophagy. Consistent with this, we demonstrate that SIRT4(H161Y) promotes the phosphorylation of ULK1 at S638 and S758 (mTORC1 targets), both of which mediate an important inhibitory regulation of autophagy initiation. Thus, our data suggest a positive regulatory function of SIRT4 in the ULK1‐dependent early regulation/initiation of stress‐induced autophagic flux, presumably via modulation of AMPK/mTORC1 signaling.

Keywords: autophagy, HDAC6, LC3, OPA1, SIRT4, ULK1

Cells expressing SIRT4 (H161Y), a catalytically inactive mutant of the sirtuin SIRT4, fail to upregulate LC3B‐II and exhibit a reduced autophagic flux under stress conditions. Interestingly, SIRT4(H161Y) promotes phosphorylation of ULK1 at S638 and S758 that are associated with inhibition of autophagy initiation. Thus, SIRT4 may function in ULK1‐dependent early regulation/initiation of autophagic flux, presumably via modulation of AMPK/mTORC1 signaling.

graphic file with name FEB4-16-870-g007.jpg

Abbreviations

AMPK: AMP‐activated protein kinase
BafA1: bafilomycin A₁
CCCP: carbonyl cyanide 3‐chlorophenylhydrazone
GDH: glutamate dehydrogenase
HDAC6: histone deacetylase 6
HIF1α: hypoxia inducible factor 1α
LC3B: microtubule‐associated protein 1 light chain 3 B
mTORC1: mammalian target of rapamycin complex 1
OPA1: optic atrophy 1
SIRT: sirtuin
SIRT4: sirtuin 4
ULK1: Unc‐51‐like kinase 1

Autophagy is a critical cellular process that is triggered by a variety of extra/intracellular stresses, resulting in the degradation and recycling of cellular components. Among the latter are damaged organelles such as mitochondria, which are degraded via mitophagy to maintain mitochondrial homeostasis and function [1, 2]. A major inducer of autophagy is the rapamycin‐mediated inhibition of the mammalian target of rapamycin complex 1 (mTORC1) [3], whereas increased mitophagy is triggered by hypoxia due to low oxygen levels or CoCl₂‐triggered pseudohypoxia [4]. Inhibition of the mitochondrial respiratory chain by treatment with carbonyl cyanide 3‐chlorophenylhydrazone (CCCP) and oligomycin also results in a strong mitophagic response [5]. Dysregulation of autophagy and mitophagy plays an important role in several pathological conditions, including aging, cancer therapy resistance, cardiovascular diseases, and neurodegenerative disorders and therefore represents a common therapeutic target in these diseases [6].

Autophagy is a highly regulated process consisting of four phases, that is, initiation controlled by the ULK1 initiation complex [7], elongation (phagophore formation and extension of autophagosomal membranes), maturation of autophagosomes, and finally degradation of contents following autophagosome–lysosome fusion [8, 9]. The elongation phase is associated with the microtubule‐associated protein 1A/1B‐light chain 3 (LC3) protein. LC3 is thereby widely used as a marker of autophagy due to its conversion from the cytosolic form (LC3‐I) to the lipidated, autophagosomal membrane bound form (LC3‐II) during autophagic flux [10]. At the regulatory level, autophagy is tightly controlled at its initiation phase by the Unc‐51‐like kinase 1 (ULK1) kinase [11]. Here, mTORC1‐mediated phosphorylation of ULK at serine residues 758 and 638 disrupts AMPK‐ULK1 interaction and therefore inhibits ULK1‐dependent initiation of autophagy [12]. Thus, the mTORC1–ULK1 interaction controls the initiation of autophagy.

Human sirtuins comprise a group of enzymes that mainly function in epigenetic regulation and gene expression control (SIRT1, SIRT2, SIRT6, and SIRT7 [13]), proliferation/cell survival and aging (e.g., SIRT6 [14]), and regulation of mitochondrial dynamics and metabolism (SIRT3, SIRT4, SIRT5 [15, 16]). SIRT4 is associated with cellular senescence and mitophagy [17, 18]. At the molecular level, SIRT4 interacts with the mitochondrial GTPase OPA1 and stabilizes its inner‐membrane bound long form (OPA1‐L) [17]. In contrast to the short form OPA1‐S, OPA1‐L promotes mitochondrial fusion and thereby counteracts fission that is typically required for mitophagy [19]. At the same time, SIRT4 inhibits MAPK‐mediated phosphorylation and activation of DRP1 leading to impaired mitochondrial fission [20]. The molecular interactions of SIRT4 with DRP1 and OPA1 are not well understood, and it is unknown, to which extent they are linked to impair mitophagy caused by (pseudo)hypoxia or inhibition of mitochondrial chain function. Another recently described SIRT4 interactor, histone deacetylase 6 (HDAC6) [21, 22], is known to regulate autophagy in terms of autophagosome transport and autophagosome–lysosome fusion [23, 24]. However, also here it is unclear whether and how the SIRT4‐HDAC6 interaction plays a role in regulation of autophagy/mitophagy triggered by different stressors.

The present study employs various autophagy and mitophagy stressors to define the role of SIRT4 in the regulation of autophagy/mitophagy. We observed an overall inhibitory impact of SIRT4(H161Y), an enzymatically inactive, dominant‐negative SIRT4 mutant, on LC3B‐II upregulation and autophagy. This phenotype could not be rescued by pharmacological inhibition of OPA1‐L and HDAC6, that were both upregulated upon SIRT4(H161Y) expression. However, in contrast to wild‐type SIRT4, SIRT4(H161Y) increased the inhibitory phosphorylation of ULK1. Thus, our findings imply that SIRT4 positively influences ULK1 and the regulation of early autophagy, presumably via the AMPK‐mTORC1‐ULK1 network.

Materials and methods

Reagents and antibodies

The following reagents were obtained from the indicated companies: CoCl₂ (Roth, Karlsruhe, Germany), Bafilomycin A₁ (BafA₁) and tubacin (Biomol, Hamburg, Germany), CCCP (carbonyl cyanide 3‐chlorophenylhydrazone; Sigma‐Aldrich), oligomycin and rapamycin (Biomol and Bio‐Techne GmbH, Wiesbaden, Germany), and MYLS22 (Biozol, Hamburg, Germany). Primary antibodies used in immunoblot analysis are listed in Table S1. Anti‐mouse (700 nm; LI‐COR IRDye #926‐32 213) or anti‐rabbit (800 nm; LI‐COR IRDye #926‐68 072) were used as secondary antibodies.

Cell culture

Parental and SIRT4 wild‐type/mutant expressing HEK293 cell lines were cultured at 37 °C and 5% CO₂ in DMEM (Dulbecco's modified Eagle medium) containing high glucose (4.5 g·L⁻¹; Thermo Fisher Scientific, Karlsruhe, Germany) with 10% fetal bovine serum (FBS; Thermo Fisher Scientific) and penicillin (100 units·mL⁻¹)/streptomycin (100 μg·mL⁻¹) (Genaxxon Bioscience, Ulm, Germany). Original HEK293 cells were obtained from the German Collection of Microorganisms and Cell Cultures GmbH (DSMZ: ACC 305; Cellosaurus: CVCL_0045). HEK293‐eGFP, HEK293‐SIRT4‐eGFP, and HEK293‐SIRT4(H161Y)‐eGFP cell lines as well as HEK293 cell lines stably expressing Myc‐Flag, SIRT4‐Myc‐Flag, or SIRT4(H161Y)‐Myc‐Flag have been described previously [17, 21] and were grown under selection with 400 μg·mL⁻¹ Geneticin/G418 (Genaxxon Bioscience). HEK293 cell lines were regularly authenticated by morphological growth, flow cytometry, and immunoblot analysis. Experiments were performed with mycoplasma‐free cell lines.

Treatment of HEK293 cell lines with mitophagy or autophagy inducers and selected inhibitors

HEK293 cell lines were subjected to mitophagy induction in a chemical hypoxia/pseudohypoxia model [4, 25] using CoCl₂ treatment at a concentration of 400 μm for 24 h or as indicated. Alternatively, mitophagy was triggered by mitochondrial membrane depolarization upon combined treatment with CCCP (5 μm) and oligomycin (5 μm) for 24 h. General autophagy was induced by rapamycin treatment (1.25 μm, 24 h). Inhibitors against HDAC6 (tubacin) and OPA1 (MYLS22) were used for a (co)treatment period of 24 h at concentrations of 2 and 50 μm, respectively. BafA₁, an inhibitor of autophagosome–lysosome fusion, was used for a (co)treatment period of 4 h at a concentration of 0.5 μm.

Preparation of total cell lysates and immunoblot analysis

Total cell lysates were generated using lysis buffer containing 0.3% CHAPS (3‐[(3‐cholamidopropyl) dimethylammonio]‐1‐propanesulfonate), 50 mm Tris/HCl (pH 7.4), 150 mm NaCl, 1 mm Na₃VO₄, 10 mm NaF, 1 mm EDTA, 1 mm EGTA, 2.5 mm Na₄O₇P₂, and 1 μm DTT. The cOmplete™ protease inhibitor cocktail (Sigma‐Aldrich) was used to prevent the degradation of proteins in the lysates. The latter were cleared by centrifugation (11 000 g at 4 °C for 20 min), and the protein concentration of the supernatants (total cell lysates) was determined using the Bradford assay (Roth). Relative quantification of protein levels (as compared to α‐tubulin or β‐actin protein loading controls) was performed by imagej‐based densitometric analysis of specific immunoblot signals.

Flow cytometry‐based methods

Measurement of autophagic flux using the GFP‐LC3‐RFP‐LC3ΔG probe

The expression vector pMRX‐IP‐GFP‐LC3‐RFP‐LC3(ΔG) (addgene plasmid #84572) [26] was transfected into HEK293 cell lines stably expressing Myc‐Flag, SIRT4‐Myc‐Flag, or SIRT4(H161Y)‐Myc‐Flag [21] using the Turbofect transfection reagent (Thermo Fisher Scientific). Stable cell lines expressing GFP‐LC3‐RFP‐LC3(ΔG) were grown in double selection media (400 μg·mL⁻¹ geneticin/G418; Genaxxon; 1.5 μg·mL⁻¹ puromycin; InvivoGen, Toulouse, France). GFP‐LC3‐RFP‐LC3ΔG works as an autophagic flux probe (GFP‐LC3) that upon ATG4‐mediated cleavage releases both GFP‐LC3 and RFP‐LC3ΔG. In contrast to GFP‐LC3, RFP‐LC3ΔG cannot be incorporated into the autophagosomal membrane and therefore serves as a cytosolic reference control [26]. The experimental GFP/RFP ratios, which decrease upon induction of autophagic flow that is followed by LC3B‐II degradation upon autophagosome–lysosome fusion, were measured by flow cytometry (BD FACS Canto II; BD, Heidelberg, Germany). Results were analyzed using flowjo v10 software (FlowJo, Inc., Ashland, OR, USA) and calculated as MFI (median fluorescence intensity).

Measurement of mitophagy using the pH‐sensitive and mitochondrially (mt) targeted mt‐mKEIMA probe

The retroviral plasmid pCHAC‐mt‐mKEIMA (addgene plasmid #72342) [27] was stably transduced into HEK293 cell lines stably expressing eGFP, SIRT4‐eGFP, or SIRT4(H161Y)‐eGFP [21] essentially as described [28]. Upon autophagosome–lysosome fusion and hence low auto‐lysosomal pH, mt‐mKEIMA (excitation/emission maxima λ = 586/620 nm at a pH < 5) can be employed as a quantitative marker of mitophagic activity [29]. Analysis was performed by flow cytometry (BD LSRFortessa; BD, Heidelberg, Germany), and results were evaluated using the flowjo v10 software (FlowJo, Inc.) and calculated as MFI (median fluorescence intensity).

Cellular analysis of mitochondrial mass using the MitoMark Green I probe

Mitochondrial content was determined by flow cytometry (BD FACS Canto II) using MitoMark Green I staining (biotechne‐Tocris; excitation/emission maxima λ ~ 490/516 nm). MitoMark Green I localizes to mitochondria independent of their membrane potential. Results were analyzed using the flowjo v10 software and calculated as MFI (median fluorescence intensity).

Representative data histograms are depicted for all flow cytometry‐based experiments in Figs S9–S21.

ShRNA‐mediated depletion of SIRT4

The generation of HEK293 cells with downregulated SIRT4 expression due to stable expression of a SIRT4‐specific shRNA has been described [25].

Real‐time PCR/qPCR analysis

mRNAs were isolated using the NucleoSpin(R) RNA Kit from Macherey‐Nagel (Düren, Germany). QPCR‐based quantification of mRNAs (50 ng mRNA per sample) was performed as instructed by the manufacturer using the iTaq™ Universal SYBR Green one‐step kit from Bio‐Rad (Dreieich, Germany). Primers used were as follows: SIRT4 (forward): 5′‐GTGGATGCTTTGCACACCAAGG‐3′, SIRT4 (reverse): 5′‐GGTTCAGGACTTGGAAACGCTC‐3′; GAPDH (forward) 5′‐ACCACCCTGTTGCTGTAGCCA‐3′, GAPDH (reverse) 5′‐GTCTCCTCTGACTTCAACAGC‐3′. Relative gene expression levels were calculated using the $2^{- ΔΔ C_{t}}$ method [30].

Statistical analysis

Data are presented as mean ± SD. Multiple comparisons were analyzed by one‐way or two‐way analysis of variance (ANOVA) followed by Tukey's post hoc test to identify group differences in variance analysis using the graphpad prism software (GraphPad Software, Boston, MA, USA). Statistical significance was set at the level of P ≤ 0.05 (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001).

Results

The enzymatically inactive SIRT4 mutant SIRT4(H161Y) inhibits stress‐induced LC3B‐II generation, autophagic flux, and mitophagy

First of all, we performed a comparative characterization of the role of SIRT4 in the regulation of mitophagy/autophagy caused by different stressors, in particular CoCl₂‐induced pseudohypoxia that activates HIF1α and upregulates LC3B‐II (Fig. S1). We employed HEK293 cells stably expressing eGFP (vector control), wild‐type SIRT4‐eGFP, or its catalytically inactive mutant SIRT4(H161Y)‐eGFP (Fig. S2A,B) [17, 25]. Interestingly, among the cell lines analyzed, HEK293‐SIRT4(HY)‐eGFP cells showed strongly reduced LC3B‐II levels upon CoCl₂ treatment for 24 h (Fig. 1A,B), whereas the levels of LCB‐I were comparable between the genotypes analyzed (Fig. 1C). Similar results were obtained for LC3B‐II when treating these cell lines with CoCl₂ for 36 h (Fig. S3). We extended these findings to flow cytometry‐based measurement of autophagic flux using the GFP‐LC3‐RFP‐LC3ΔG reporter probe [26], for which HEK293 cells stably expressing SIRT4‐myc‐Flag or its catalytically inactive mutant SIRT4(H161Y)‐myc‐Flag were generated (Fig. S2C,D). The results of these experiments were consistent with the LC3B‐II immunoblot analyses, observing the weakest CoCl₂‐triggered reduction in the GFP‐LC3/RFP‐LC3ΔG ratio (i.e., the lowest autophagic flux induction) for SIRT4(H161Y)‐myc‐Flag expressing cells (Fig. 1D). Moreover, flow cytometric analyses using mitochondria‐specific readouts showed that the CoCl₂ triggered increase in mitophagic activity (mt‐mKEIMA probe) was lowest in SIRT4(H161Y) expressing cells, concomitant with the strongest relative increase in mitochondrial content (Mitomark Green I probe) (Fig. 1E,F). Of note, the SIRT4(H161Y)‐mediated inhibition of autophagic flux was also observed in GFP‐LC3/RFP‐LC3ΔG ratio measurements upon CCCP/oligomycin‐triggered inhibition of mitochondrial membrane potential, resulting in mitophagy, as well as upon general autophagy induced by rapamycin‐mediated mTORC1 inhibition (Fig. S4A,B). The latter was confirmed through effective downregulation of pS6, a target of the mTORC1–p70S6‐kinase (p70S6K) axis (Fig. S4C). Taken together, expression of the dominant‐negative SIRT4(H161Y), and this at lower protein levels as compared to ectopic wild‐type SIRT4 (Fig. S2A,C), impairs autophagic flux upon CoCl₂‐induced pseudohypoxia, mitochondrial membrane depolarization, or rapamycin treatment.

Fig. 1 — Inhibitory impact of SIRT4(H161Y) on autophagic flux and mitophagy upon CoCl₂‐induced pseudohypoxia. (A) HEK293 cells stably expressing eGFP, SIRT4‐eGFP, or SIRT4(H161Y)‐eGFP were subjected to CoCl₂‐induced hypoxia followed by immunoblot analysis of LC3B‐I/II levels (n = 10). (B, C) Relative quantification of immunoblot signals of LC3B‐II and LC3B‐I was performed using imagej‐based densitometric evaluation and β‐actin levels as loading control. (D) HEK293 cells stably expressing myc‐Flag, SIRT4‐myc‐Flag, or SIRT4(H161Y)‐myc‐Flag were subjected to CoCl₂‐induced hypoxia followed by flow cytometry‐based analysis of autophagic flux using the GFP‐LC3‐RFP‐LC3ΔG probe (n = 8). The more the GFP‐LC3/RFP‐LC3ΔG ratio decreases, the higher is the autophagic flux. (E) Analysis of mitophagic activity using the mt‐mKEIMA fluorescent protein (n = 4). (F) Mitochondrial content analysis using the MitoMark Green I probe (n = 7). To determine statistical significance, two‐way ANOVA tests were employed (mean ± SD; *P < 0.05; **P < 0.01; ***P < 0.001). MFI, median fluorescent intensity.

SIRT4(H161Y)‐mediated inhibition of CoCl₂‐induced LC3B‐II increase and autophagic flux is not linked to increased HDAC6 levels and decreased acetylated α‐tubulin (acK40)

The autophagy regulator HDAC6 interacts with SIRT4 [21, 22] and is also found at increased levels upon expression of SIRT4 or SIRT4(H161Y) (Fig. 2A,B). In contrast to eGFP expressing controls, SIRT4 and SIRT4(HY) expressing cells maintained high HDAC6 protein levels and did not downregulate HDAC6 upon CoCl₂ treatment (Fig. 2C). Concomitantly, upregulated HDAC6 caused downregulation of acetylated α‐tubulin (acK40), which is a major HDAC6 target (Fig. 2D,E). Acetylated α‐tubulin (acK40) is required for efficient microtubule dynamics and transport processes in connection with autophagy/mitophagy. Given that pharmacological inhibition of HDAC6 can restore autophagy in various experimental model systems [31, 32, 33, 34], we next addressed the effect of the HDAC6 inhibitor tubacin on autophagic flux in SIRT4(H161Y) expressing cells. As expected, tubacin treatment resulted in clear upregulation of acetylated α‐tubulin (K40) levels in all genotypes analyzed (Fig. S5). However, at the same time, inhibition of HDAC6 failed to rescue CoCl₂‐induced LC3B‐II increase, autophagic flux, and mitophagy in HEK293‐SIRT4(H161Y) cells (Fig. 3). Of note, co‐treatment with tubacin and CCCP/oligomycin (Fig. S6A), but not tubacin and rapamycin (Fig. S7A), revealed a slight and significant rescue in autophagic flux as measured through the flow cytometric GFP‐LC3/RFP‐LC3ΔG ratio method. We conclude that the increased HDAC6 levels are not decisive for the impaired LC3B‐II/autophagic flux in SIRT4/SIRT4(H161Y) expressing HEK293 cells upon induction of mitophagy or autophagy.

Fig. 3 — The HDAC6 inhibitor tubacin fails to rescue LC3B‐II levels, autophagic flux, and mitophagy in SIRT4(H161Y) expressing HEK293 cells upon CoCl₂‐induced pseudohypoxia. (A) HEK293 cells stably expressing eGFP, SIRT4‐eGFP, or SIRT4(H161Y)‐eGFP were subjected to CoCl₂‐induced hypoxia in the presence or absence of the HDAC6 inhibitor tubacin followed by immunoblot analysis of LC3B‐I/II levels. One out of three experiments is shown. (B) Relative quantification of immunoblot signals of LC3B‐II depicted in A was performed using imagej‐based densitometric evaluation and β‐actin levels as loading control (A, B: n = 3). (C, D) HEK293 cells stably expressing FLAG, SIRT4‐myc‐Flag, or SIRT4(H161Y)‐myc‐Flag were subjected to CoCl₂‐induced hypoxia in the presence or absence of tubacin followed by flow cytometry‐based analysis of autophagic flux (C; n = 6) and mitophagic activity (D; n = 3). To determine statistical significance, two‐way ANOVA tests were employed (mean ± SD; **P < 0.01; ***P < 0.001). MFI, median fluorescent intensity.

Lack of CoCl₂‐induced LC3B‐II increase and autophagic flux in SIRT4(H161Y) expressing cells is not based on increased OPA1‐L stabilization and altered mitochondrial dynamics

SIRT4 interacts with the mitochondrial GTPase OPA1 and stabilizes its inner‐membrane bound long form (OPA1‐L) [17] that promotes mitochondrial fusion and thereby potentially counteracts mitophagy as compared to OPA1‐S [19, 35]. Upon CoCl₂ treatment, HEK293 cells expressing SIRT4(H161Y) maintained the highest OPA1‐L levels and therefore OPA1‐L/OPA1‐S ratios as analyzed over a period of 36 h (Fig. 4A,B). Next, we tested if the increased OPA1‐L may affect LC3B‐II upregulation. Therefore, HEK293 SIRT4(H161Y) cells were subjected to co‐treatment with the OPA1 inhibitor MYLS22 [36]. As indicated in Fig. 4C,D, MYLS22 reduced the OPA1‐L/OPA1‐S ratio in SIRT4(H161Y) expressing cells, although there was no additive/synergistic effect with CoCl₂ co‐treatment. However, although MYLS22 alone did upregulate LC3B‐II levels, co‐treatment using MYLS22 and CoCl₂ failed to significantly rescue LC3B‐II (Fig. 5A,B), autophagic flux, and mitophagy (Fig. 5C,D) in CoCl₂‐treated HEK293‐SIRT4(HY) cells. In addition, co‐treatment using MYLS22 and CCCP/oligomycin (Fig. S6B) or MYLS22 and rapamycin (Fig. S7B) did not significantly increase autophagic flux measured by the GFP‐LC3/RFP‐LC3ΔG ratio‐based method. Thus, our data indicate that altered mitochondrial dynamics is not the reason for the impaired LC3B‐II/autophagic flux in SIRT4(H161Y) expressing HEK293 cells upon induction of mitophagy or autophagy.

Fig. 4 — SIRT4(H161Y) inhibits CoCl₂‐induced conversion of OPA1‐L to OPA1‐S. (A) Immunoblot and densitometric analysis (B) of OPA1‐L/OPA1‐S protein levels in untreated and CoCl₂‐treated HEK293 cells expressing SIRT4 or SIRT4(H161Y) (n = 6). (C) The OPA1 inhibitor MYLS22 decreases the OPA1‐L/OPA1‐S protein ratio as quantified by densitometric analysis (D; n = 3). Cell treatment was performed for 24 h. To determine statistical significance, two‐way ANOVA tests were employed (mean ± SD; *P < 0.05; **P < 0.01; ***P < 0.001).

Fig. 5 — The OPA1 inhibitor MYLS22 fails to restore LC3B‐II levels, autophagic flux, and mitophagy in SIRT4(H161Y) expressing HEK293 cells upon CoCl₂‐induced pseudohypoxia. (A) Immunoblot and (B) densitometric analysis of LC3B‐II protein levels in untreated and CoCl₂‐treated HEK293 cells expressing SIRT4 or SIRT4(H161Y) in the presence or absence of MYLS22 (n = 3). (C) HEK293 cells stably expressing myc‐Flag, SIRT4‐myc‐Flag, or SIRT4(H161Y)‐myc‐Flag were subjected to CoCl₂‐induced hypoxia in the presence or absence of MYLS22 followed by flow cytometry‐based analysis of autophagic flux using the GFP‐LC3‐RFP‐LC3ΔG probe (n = 4). (D) HEK293 cells stably expressing eGFP, SIRT4‐eGFP, or SIRT4(H161Y)‐eGFP were subjected to CoCl₂‐induced hypoxia in the presence or absence of MYLS22 followed by flow cytometry‐based analysis of mitophagy using the mt‐mKEIMA probe (n = 3). To determine statistical significance, one‐way or two‐way ANOVA tests were employed (mean ± SD; *P < 0.05; ***P < 0.001). MFI, median fluorescent intensity.

BafA₁‐mediated inhibition of autophagosome–lysosome fusion fails to restore LC3B‐II levels in CoCl₂‐treated SIRT4(H161Y) expressing cells

Execution of autophagy depends on fusion of autophagosomes with lysosomes that can be inhibited by the V‐ATPase and SERCA inhibitor BafA₁ [37, 38, 39]. BafA₁ treatment is widely used to address the basis for increased LC3B‐II levels and autophagic flux, that is, to differentiate between increased biosynthesis/modification of LC3B‐I to LC3B‐II vs. increased auto‐lysosomal degradation of LC3B‐II [39]. Interestingly, under basal conditions, SIRT4(H161Y) expressing HEK293 cells displayed an approximately three‐fold increase in LC3B‐II upon BafA₁ treatment for a period of 4 h (Fig. 6). However, upon combined CoCl₂ treatment, BafA₁ failed to significantly increase LC3B‐II levels (Fig. 6), indicating that an accelerated degradation of LC3B‐II by the autolysosome does not account for the observed phenotype. These results suggest that the stress‐induced generation of LCB‐II is inhibited upon SIRT4(H161Y) expression at an earlier stage, that is, at the LC3B‐I to LC3BII conversion or even at the initiation of autophagy.

Fig. 6 — BafA₁ treatment does not restore LC3II‐B levels in SIRT4(H161Y) expressing HEK293 cells upon CoCl₂‐induced pseudohypoxia. (A) Immunoblot analysis and (B) densitometric evaluation of LC3B‐II vs. β‐Actin as loading control were performed (n = 3). To determine statistical significance, One‐Way ANOVA tests were employed (mean ± SD; *P < 0.05).

SIRT4(H161Y) promotes phosphorylation of ULK‐1 at Ser758 and Ser638 that are linked to negative regulation of early autophagy

Major upstream regulators of autophagy include mTORC1 that affects the central ULK1‐driven autophagy initiation complex in a negative manner [7, 8, 9, 11, 40, 41]. Given the interaction of SIRT4 with the AMPK/mTORC1 pathway [42, 43, 44], we asked whether the early regulatory phase of autophagy may be affected by ectopic expression of the dominant‐negative mutant SIRT4(H161Y). Therefore, we analyzed the relative levels of ULK1 phosphorylated at serine residues Ser758 and Ser638 that both represent mTORC1 substrates [7, 12, 45], associated with inhibition of ULK1 function and hence decreased initiation of autophagy. As indicated in Fig. 7, combined immunoblotting and densitometric analysis revealed that CoCl₂ treatment resulted in downregulation of ULK1^pS758 and ULK^pS638 levels in HEK293 cells that express eGFP or SIRT4‐eGFP. In contrast, in SIRT4(H161Y)‐GFP expressing HEK293 cells, CoCl₂ failed to reduce the amount of both ULK1^pS758 and ULK^pS638 as compared to the untreated controls. In conclusion, our findings suggest that expression of SIRT4(H161Y) negatively interferes with ULK1 dephosphorylation in response to stressors that induce autophagy.

Fig. 7 — SIRT4(H161Y) increases inhibitory phosphorylation of ULK1 upon CoCl₂‐induced pseudohypoxia. (A) HEK293 cells stably expressing eGFP, SIRT4‐eGFP, or SIRT4(H161Y)‐eGFP were subjected to CoCl₂‐induced hypoxia followed by immunoblot analysis of ULK1^pS758 and ULK1^pS638 levels. (B) Relative quantification of immunoblot signals of ULK1^pS758 (upper panel) and ULK1^pS638 (lower panel) was performed using imagej‐based densitometric evaluation and β‐Actin levels as loading control (n = 3). To determine statistical significance, two‐way ANOVA tests were employed (mean ± SD; *P < 0.05; **P < 0.01; ***P < 0.001).

Discussion

This study provides novel insight into the role of the sirtuin SIRT4 in the regulation of autophagy/mitophagy. In summary, we showed that (a) the dominant‐negative mutant SIRT4(H161Y)‐eGFP prevents LC3B‐II upregulation upon treatment with various inducers of mitophagy/autophagy; (b) mechanistically, this phenotype is independent of the SIRT4 interactors OPA1 and HDAC6 as shown by pharmacological inhibition experiments; (c) the low LC3B‐II levels due to SIRT4(H161Y) expression could not be restored by BafA₁‐mediated inhibition of autophagosome–lysosome fusion, therefore ruling out an increased auto‐lysosomal degradation of LC3B‐II at the late phase of autophagy; (d) interestingly, expression of SIRT4(H161Y) increased the levels of UKL1 kinase phosphorylated at the inhibitory residues S638 and S758, a scenario that is associated with inhibition of autophagy initiation.

One aim of this study was the characterization of the role of the SIRT4‐HDAC6 and SIRT4‐OPA1 interactions [17, 21] in the regulation of autophagy. HDAC6, that is upregulated in SIRT4/SIRT4(H161Y) expressing cells (Fig. 2), functions as major regulator of autophagic and mitophagic processes [23, 46], including microtubule‐based cargo/mitochondrial transport and autophagosome–lysosome fusion. Pharmacological inhibition of HDAC6 successfully restored functional autophagy in various pathophysiological systems [31, 32, 33, 34]. However, despite greatly restored levels of acetylated α‐tubulin (K40) (Fig. S5), tubacin‐mediated inhibition of HDAC6 was unable to rescue normal LC3B‐II increase and autophagic flux in SIRT4(HY161) expressing cells that were exposed to autophagy/mitophagy triggers (Fig. 3, Figs S6A and S7A). Furthermore, the functional interaction of SIRT4 with the mitochondrially inner‐membrane localized GTPase OPA1 [17, 47] also provided a potential molecular basis for the autophagy phenotype of SIRT4(H161Y) expressing cells. OPA1‐L, which was clearly increased/stabilized by SIRT4(H161Y) in CoCl₂‐treated cells (Fig. 4), promotes mitochondrial fusion and thereby counteracts mitophagy as compared to OPA1‐S that is linked to mitochondrial fission [19, 35]. However, the OPA1 inhibitor MYLS22 failed also to significantly rescue autophagy/mitophagy in our experimental systems (Fig. 5, Figs S6B and S7B). Taken together, deregulation of neither HDAC6 nor OPA1 seems causally linked to the decreased LC3B‐II levels in SIRT4(H161Y)‐expressing HEK293 cells. At first sight, our findings seem in line with a report from Liu et al., demonstrating that overexpression of SIRT4 or stress‐ or starvation‐induced increase of endogenous SIRT4 levels decreases the levels of PTEN and lastly promotes autophagy [48, 49]. However, the destabilizing effect on PTEN occurs also in the case of SIRT4(H161Y) expression [48], thus being not only SIRT4 enzymatically independent, but also ruling out the SIRT4‐PTEN interaction as molecular basis responsible for the autophagic phenotype in our experimental models. Of note, a direct interaction of SIRT4 with PTEN upstream of mTORC1 signaling requires a significant cytoplasmatic localization of SIRT4. The latter is actually the case, given that SIRT4 is distributed between the cytoplasm, nucleus, and mitochondria [21, 50]. Moreover, SIRT4 protein levels are controlled via degradation both by autophagy and the cytoplasmatic proteasome [25, 51]. Lastly, several recent reports attributed novel extramitochondrial roles to SIRT4 in microtubule dynamics and regulation of mitotic cell cycle progression [21], WNT/β‐catenin and hippo signaling [52, 53], C‐RAF‐MAPK signaling [54], direct nuclear regulation of the mRNA splicing factor U2AF2 [55], and SNARE complex formation required for autophagosome–lysosome fusion [56].

The impact of SIRT4 on autophagy seems to be tightly linked to its role in metabolic regulation through glutamate dehydrogenase (GDH) and downstream signaling towards AMPK [57, 58]. One possibility would be that mitochondrial SIRT4 inhibits GDH through ADP‐ribosylation [59], thus reducing conversion of glutamate (from glutamine) into α‐ketoglutarate. As a consequence, cytosolic glutamine levels increase which in turn activate mTORC1 and inhibit autophagy [58]. Indeed, Shaw et al. [60] described this scenario for increased SIRT4 levels under anabolic, that is, high‐glucose conditions. The authors observed an activation of mTORC1 (due to increased cytosolic glutamine), increased inhibitory ULK1^pS758 phosphorylation, and decreased LC3B‐II, all resulting ultimately in inhibition of autophagy [60]. Another mechanism lies in the possibility that SIRT4‐mediated inhibition of GDH may result in reduced ATP levels, that is, an increased AMP/ADP:ATP ratio that leads to an increased activation of AMPKα and ULK1 and thus more autophagy initiation [57]. The latter mechanism would be in line with our work and also with further findings from Wang et al. [44] describing that the pro‐autophagic SIRT4‐GDH↓‐AMPKα↑‐mTORC1↓ axis was negatively affected by expression of SIRT4(H161Y). Lastly, a recent report uncovered that SIRT4 activates autophagy also via AMPKα‐p53 signaling [42]; however, the regulation at the level of ULK1 has not been addressed.

AMPK takes over a bifunctional role in ULK1 phosphorylation and autophagy regulation. On the one side, AMPK‐mediated phosphorylation of S777 and S317 promotes activation of ULK1 [41]. On the other side, recent work by Park et al. [61] demonstrated that AMPK‐mediated phosphorylation of UKL1 residues S556 and T660 prevents dephosphorylation of the key inhibitory residue S758 and hence ULK1 activation towards autophagy initiation. Of note, the latter inhibitory mechanism of AMPK towards ULK1 has been demonstrated under glucose starvation to maintain autophagy competence and cellular survival during prolonged energy stress [61, 62].

Mitochondrial sirtuins, in particular SIRT3 and SIRT4, display antagonizing functions, but in part also similar cellular impacts. There are, however, no clear data for a compensatory cross talk between these SIRT isoforms. As for the antagonizing functions, SIRT3, for example, increases the activity of glutamate dehydrogenase (GDH/GLUD1) by its deacetylation [63], whereas GDH is inhibited via SIRT4‐mediated ADP‐ribosylation [59]. Interestingly, however, in terms of autophagy regulation, both SIRT4 (our data) and SIRT3 [64, 65] seem to positively regulate autophagy via the AMPK‐ULK1 pathway. As for SIRT5, its regulatory role in autophagy and mitophagy is rather unclear [49]. However, in the context of glutamine and ammonia metabolism, an increased autophagy and mitophagy was observed upon depletion of SIRT5 or upon its pharmacological inhibition [66]. Conversely, overexpression of SIRT5 inhibited autophagy. Consistent with this, Barreca et al. [67] observed increased inhibitory ULK^pS758 levels and a reduced LC3B‐II response in cells treated with the selective SIRT5 activator MC3138. Taken together, all three sirtuins seem to impact on the ULK1‐dependent early regulation of autophagy. However, whereas SIRT3 and SIRT4 promote autophagy, SIRT5 rather displays an inhibitory role.

In addition to overexpression of the dominant‐negative mutant SIRT4(H161Y), we also performed shRNA‐mediated depletion of endogenous SIRT4 expression in HEK293 cells (Fig. S8). Under conditions, where SIRT4 mRNA levels were downregulated by 50–60%, we observed a normal pseudo‐hypoxic (HIF1α) response. In addition, the CoCl₂‐mediated increase in LC3B‐II protein levels in SIRT4 shRNA expressing cells was comparable to CoCl₂‐treated cells that express the pLKO.1 control vector. Overall, the degree of SIRT4 downregulation by 50–60% may not be sufficient yet to impair the stress‐induced LC3B‐II response. However, there are consistent findings that gene knockout of SIRT4 or SIRT4 knockdown strongly impairs autophagy, as measured by the reduced amount of autophagosomes or LC3B‐II levels [42]. Moreover, an actual in vivo study in Caenorhabditis elegans genetically identifies the SIRT4 homolog sir‐2.2 as important positive regulator of mitophagy and autophagy [68]. Thus, the positive regulatory role of SIRT4 in autophagy seems to be evolutionarily conserved.

Conclusions

In contrast to wild‐type SIRT4, the dominant‐negative mutant SIRT4(H161Y) promotes inhibitory phosphorylation of ULK1 at S758 and S638 that is associated with the negative regulation of autophagy initiation and subsequent LC3B‐II‐linked autophagic flux. These findings form the basis of our working model (Fig. 8), which suggests that SIRT4 positively regulates via its enzymatic activity the early autophagic phase. However, the underlying molecular mechanism(s) of the interaction of SIRT4 with the AMPK‐mTORC1‐ULK1 network, whether directly in the cytoplasm or indirectly via mitochondrial metabolic regulation of the AMP/ATP ratio and AMPKα modulation, remain to be elucidated.

Fig. 8 — Working model suggesting a regulatory role of SIRT4 in AMPK‐dependent activation and mTORC1‐driven inactivation of ULK1, a central driver of autophagy initiation. Activation of ULK1 involves AMPK‐mediated phosphorylations of S777 and S317, whereas the mTORC1 targets S758 and S638 are linked to ULK1 inhibition. Residues S556 and T660, which can also be phosphorylated by AMPK thereby preventing dephosphorylation of the S758 and hence ULK1 activation [61], are not depicted in this model. PE, phosphatidylethanolamine anchor. Model modified after [40, 69]. Created with BioRender.com.

Conflict of interest

The authors declare no conflict of interest.

Author contributions

RPP, IL, and KA initiated the project and designed the study. IL, KA, LG, NH, AI, JTVN, DMF, and RPP performed and analyzed the experiments. JH, CW, HH, JS, MRA, BS, and DMF provided expertise and essential methods and reagents. RPP wrote the manuscript. All authors read, discussed, corrected, and approved the final version of the manuscript. This paper fulfills the requirements of an MD thesis by Isabell Lehmkuhl.

Supporting information

Fig. S1. CoCl₂ treatment induces a pseudo‐hypoxic response in wild‐type HEK293 cells.

Fig. S2. Generation and characterization of HEK293 cell lines stably expressing C‐terminal eGFP fusion or myc‐Flag tagged versions of SIRT4 or SIRT4(H161Y).

Fig. S3. Inhibitory impact of SIRT4(H161Y) on autophagic flux upon CoCl₂‐induced pseudohypoxia.

Fig. S4. SIRT4(H161Y) inhibits autophagic flux upon CCCP/oligomycin‐mediated mitochondrial stress or Rapamycin treatment.

Fig. S5. Immunoblot analysis of acetylated α‐tubulin (K40) protein levels in CoCl₂‐treated HEK293 cell lines expressing eGFP‐fused (A) or myc‐Flag‐tagged (B) SIRT4 or SIRT4(H161Y) in the presence or absence of the HDAC6 inhibitor tubacin.

Fig. S6. Impact of tubacin or MYLS22 treatment on the inhibited autophagic flux of CCCP/oligomycin‐treated HEK293‐SIRT4(H161Y) cells.

Fig. S7. Impact of tubacin or MYLS22 treatment on the inhibited autophagic flux of rapamycin‐treated HEK293‐SIRT4(H161Y) cells.

Fig. S8. ShRNA‐mediated downregulation of SIRT4 expression does not translate into a decreased LC3B‐II response upon CoCl₂ treatment.

Figs S9–S21. Representative data histograms are depicted for all flow cytometry‐based experiments to measure autophagic flux (GFP‐LC3‐RFP‐LC3ΔG), mitophagy (mt‐mKEIMA), and mitochondrial content (MitoMark).

FEB4-16-870-s002.pdf^{(1.8MB, pdf)}

Table S1. Primary antibodies used in this study.

FEB4-16-870-s001.docx^{(20.6KB, docx)}

Acknowledgements

We thank Christine Cosmovici (Institute of Virology) for help with flow cytometry measurements using the mt‐mKEIMA probe, and Ursula Duerkop and Yvonne Arlt for expert technical assistance. This work was funded in part by the Stiftung für Altersforschung of the Heinrich Heine‐University Düsseldorf (grant 701.810.783 to RPP). Open Access funding enabled and organized by Projekt DEAL.

Edited by Gabor Juhasz

Data accessibility

The data that support the findings of this study are available in Figs 1, 2, 3, 4, 5, 6, 7 and the Supporting Information of this article.

References

1. Zhang J (2013) Autophagy and mitophagy in cellular damage control. Redox Biol 1, 19–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Zimmermann M and Reichert AS (2017) How to get rid of mitochondria: crosstalk and regulation of multiple mitophagy pathways. Biol Chem 399, 29–45. [DOI] [PubMed] [Google Scholar]
3. Panwar V, Singh A, Bhatt M, Tonk RK, Azizov S, Raza AS, Sengupta S, Kumar D and Garg M (2023) Multifaceted role of mTOR (mammalian target of rapamycin) signaling pathway in human health and disease. Signal Transduct Target Ther 8, 375. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Munoz‐Sanchez J and Chanez‐Cardenas ME (2019) The use of cobalt chloride as a chemical hypoxia model. J Appl Toxicol 39, 556–570. [DOI] [PubMed] [Google Scholar]
5. Georgakopoulos ND, Wells G and Campanella M (2017) The pharmacological regulation of cellular mitophagy. Nat Chem Biol 13, 136–146. [DOI] [PubMed] [Google Scholar]
6. Lee K and Yun J (2022) Mitophagy stimulation as a novel strategy for the treatment of mitochondrial diseases. J Gene Med 19, 49–56. [Google Scholar]
7. Zachari M and Ganley IG (2017) The mammalian ULK1 complex and autophagy initiation. Essays Biochem 61, 585–596. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Raufi AG, Liguori NR, Carlsen L, Parker C, Hernandez Borrero L, Zhang S, Tian X, Louie A, Zhou L, Seyhan AA et al. (2021) Therapeutic targeting of autophagy in pancreatic ductal adenocarcinoma. Front Pharmacol 12, 751568. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Caponio D, Veverova K, Zhang SQ, Shi L, Wong G, Vyhnalek M and Fang EF (2022) Compromised autophagy and mitophagy in brain ageing and Alzheimer's diseases. Aging Brain 2, 100056. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Mizushima N and Yoshimori T (2007) How to interpret LC3 immunoblotting. Autophagy 3, 542–545. [DOI] [PubMed] [Google Scholar]
11. Alers S, Loffler AS, Wesselborg S and Stork B (2012) The incredible ULKs. Cell Commun Signal 10, 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Kim J, Kundu M, Viollet B and Guan KL (2011) AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 13, 132–141. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Mendes KL, Lelis DF and Santos SHS (2017) Nuclear sirtuins and inflammatory signaling pathways. Cytokine Growth Factor Rev 38, 98–105. [DOI] [PubMed] [Google Scholar]
14. Mostoslavsky R, Chua KF, Lombard DB, Pang WW, Fischer MR, Gellon L, Liu P, Mostoslavsky G, Franco S, Murphy MM et al. (2006) Genomic instability and aging‐like phenotype in the absence of mammalian SIRT6. Cell 124, 315–329. [DOI] [PubMed] [Google Scholar]
15. Jaiswal A, Xudong Z, Zhenyu J and Saretzki G (2021) Mitochondrial sirtuins in stem cells and cancer. FEBS J 289, 3393–3415. [DOI] [PubMed] [Google Scholar]
16. Ji Z, Liu GH and Qu J (2022) Mitochondrial sirtuins, metabolism, and aging. J Genet Genomics 49, 287–298. [DOI] [PubMed] [Google Scholar]
17. Lang A, Anand R, Altinoluk‐Hambuchen S, Ezzahoini H, Stefanski A, Iram A, Bergmann L, Urbach J, Bohler P, Hansel J et al. (2017) SIRT4 interacts with OPA1 and regulates mitochondrial quality control and mitophagy. Aging (Albany NY) 9, 2163–2189. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Lang A, Grether‐Beck S, Singh M, Kuck F, Jakob S, Kefalas A, Altinoluk‐Hambuchen S, Graffmann N, Schneider M, Lindecke A et al. (2016) MicroRNA‐15b regulates mitochondrial ROS production and the senescence‐associated secretory phenotype through sirtuin 4/SIRT4. Aging (Albany NY) 8, 534–559. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. MacVicar TD and Lane JD (2014) Impaired OMA1‐dependent cleavage of OPA1 and reduced DRP1 fission activity combine to prevent mitophagy in cells that are dependent on oxidative phosphorylation. J Cell Sci 127, 2313–2325. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Fu L, Dong Q, He J, Wang X, Xing J, Wang E, Qiu X and Li Q (2016) SIRT4 inhibits malignancy progression of NSCLCs, through mitochondrial dynamics mediated by the ERK‐Drp1 pathway. Oncogene 36, 2724–2736. [DOI] [PubMed] [Google Scholar]
21. Bergmann L, Lang A, Bross C, Altinoluk‐Hambuchen S, Fey I, Overbeck N, Stefanski A, Wiek C, Kefalas A, Verhulsdonk P et al. (2020) Subcellular localization and mitotic interactome analyses identify SIRT4 as a centrosomally localized and microtubule associated protein. Cells 9, 1950. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Mathias RA, Greco TM, Oberstein A, Budayeva HG, Chakrabarti R, Rowland EA, Kang Y, Shenk T and Cristea IM (2014) Sirtuin 4 is a lipoamidase regulating pyruvate dehydrogenase complex activity. Cell 159, 1615–1625. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Chang P, Li H, Hu H, Li Y and Wang T (2021) The role of HDAC6 in autophagy and NLRP3 inflammasome. Front Immunol 12, 763831. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Shi L, Song Z, Li C, Deng F, Xia Y, Huang J, Wu X and Zhu J (2022) HDAC6 inhibition alleviates ischemia‐ and cisplatin‐induced acute kidney injury by promoting autophagy. Cells 11, 3951. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Hampel N, Georgy J, Mehrabipour M, Lang A, Lehmkuhl I, Scheller J, Ahmadian MR, Floss DM and Piekorz RP (2023) CoCl₂‐triggered pseudohypoxic stress induces proteasomal degradation of SIRT4 via polyubiquitination of lysines K78 and K299. FEBS Open Bio 13, 2187–2199. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, Kodama A, Ishihara T, Mizushima T and Mizushima N (2016) An autophagic flux probe that releases an internal control. Mol Cell 64, 835–849. [DOI] [PubMed] [Google Scholar]
27. Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, Sideris DP, Fogel AI and Youle RJ (2015) The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524, 309–314. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Drews L, Zimmermann M, Westhoff P, Brilhaus D, Poss RE, Bergmann L, Wiek C, Brenneisen P, Piekorz RP, Mettler‐Altmann T et al. (2020) Ammonia inhibits energy metabolism in astrocytes in a rapid and glutamate dehydrogenase 2‐dependent manner. Dis Model Mech 13, dmm047134. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Williams JA, Zhao K, Jin S and Ding WX (2017) New methods for monitoring mitochondrial biogenesis and mitophagy in vitro and in vivo. Exp Biol Med (Maywood) 242, 781–787. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Schmittgen TD and Livak KJ (2008) Analyzing real‐time PCR data by the comparative C(T) method. Nat Protoc 3, 1101–1108. [DOI] [PubMed] [Google Scholar]
31. Guedes‐Dias P, de Proenca J, Soares TR, Leitao‐Rocha A, Pinho BR, Duchen MR and Oliveira JM (2015) HDAC6 inhibition induces mitochondrial fusion, autophagic flux and reduces diffuse mutant huntingtin in striatal neurons. Biochim Biophys Acta 1852, 2484–2493. [DOI] [PubMed] [Google Scholar]
32. Liang T, Qi C, Lai Y, Xie J, Wang H, Zhang L, Lin T, Jv M, Li J, Wang Y et al. (2020) HDAC6‐mediated alpha‐tubulin deacetylation suppresses autophagy and enhances motility of podocytes in diabetic nephropathy. J Cell Mol Med 24, 11558–11572. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Shen Z, Ji K, Cai Z, Huang C, He X, Xu H and Chen G (2021) Inhibition of HDAC6 by Tubastatin A reduces chondrocyte oxidative stress in chondrocytes and ameliorates mouse osteoarthritis by activating autophagy. Aging (Albany NY) 13, 9820–9837. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Agrawal A, Clayton EL, Cavazos CL, Clayton BA and Rodney GG (2025) Histone deacetylase 6 inhibition promotes microtubule acetylation and facilitates autophagosome‐lysosome fusion in dystrophin‐deficient mdx mice. Acta Physiol (Oxf) 241, e14243. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Gilkerson R, De La Torre P and St Vallier S (2021) Mitochondrial OMA1 and OPA1 as gatekeepers of organellar structure/function and cellular stress response. Front Cell Dev Biol 9, 626117. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Noguchi M, Kohno S, Pellattiero A, Machida Y, Shibata K, Shintani N, Kohno T, Gotoh N, Takahashi C, Hirao A et al. (2023) Inhibition of the mitochondria‐shaping protein Opa1 restores sensitivity to gefitinib in a lung adenocarcinomaresistant cell line. Cell Death Dis 14, 241. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Mauvezin C, Nagy P, Juhasz G and Neufeld TP (2015) Autophagosome‐lysosome fusion is independent of V‐ATPase‐mediated acidification. Nat Commun 6, 7007. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Mauvezin C and Neufeld TP (2015) Bafilomycin A1 disrupts autophagic flux by inhibiting both V‐ATPase‐dependent acidification and Ca‐P60A/SERCA‐dependent autophagosome‐lysosome fusion. Autophagy 11, 1437–1438. [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Zhou J, Sinha RA, Lesmana R, Yau WWY and Yen PM (2018) Pharmacological inhibition of lysosomal activity as a method for monitoring thyroid hormone‐induced autophagic flux in mammalian cells in vitro. In Thyroid Hormone Nuclear Receptor: Methods and Protocols. Vol. 1801 (Plateroti M and Samarut J, eds), pp. 111–122. Springer, New York, NY. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Zhang J (2015) Teaching the basics of autophagy and mitophagy to redox biologists–mechanisms and experimental approaches. Redox Biol 4, 242–259. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Wang H, Liu Y, Wang D, Xu Y, Dong R, Yang Y, Lv Q, Chen X and Zhang Z (2019) The upstream pathway of mTOR‐mediated autophagy in liver diseases. Cells 8, 1597. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Li J, Zhan H, Ren Y, Feng M, Wang Q, Jiao Q, Wang Y, Liu X, Zhang S, Du L et al. (2022) Sirtuin 4 activates autophagy and inhibits tumorigenesis by upregulating the p53 signaling pathway. Cell Death Differ 30, 313–326. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Qin M, Xie Z, Cao T, Wang Z, Zhang X, Wang F, Wei W, Jin M, Ma J, Zeng L et al. (2022) Autophagy in rat muller glial cells is modulated by the Sirtuin 4/AMPK/mTOR pathway and induces apoptosis under oxidative stress. Cells 11, 2645. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Wang YS, Du L, Liang X, Meng P, Bi L, Wang Y, Wang C and Tang B (2019) Sirtuin 4 depletion promotes hepatocellular carcinoma tumorigenesis through regulating adenosine‐monophosphate–activated protein kinase alpha/mammalian target of rapamycin axis in mice. Hepatology 69, 1614–1631. [DOI] [PubMed] [Google Scholar]
45. Shang L, Chen S, Du F, Li S, Zhao L and Wang X (2011) Nutrient starvation elicits an acute autophagic response mediated by Ulk1 dephosphorylation and its subsequent dissociation from AMPK. Proc Natl Acad Sci USA 108, 4788–4793. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Passaro E, Papulino C, Chianese U, Toraldo A, Congi R, Del Gaudio N, Nicoletti MM, Benedetti R and Altucci L (2021) HDAC6 inhibition extinguishes autophagy in cancer: recent insights. Cancers (Basel) 13, 6280. [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Lechado Terradas A, Zittlau KI, Macek B, Fraiberg M, Elazar Z and Kahle PJ (2021) Regulation of mitochondrial cargo‐selective autophagy by posttranslational modifications. J Biol Chem 297, 101339. [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Liu M, Wang Z, Ren M, Yang X, Liu B, Qi H, Yu M, Song S, Chen S, Liu L et al. (2019) SIRT4 regulates PTEN stability through IDE in response to cellular stresses. FASEB J 33, 5535–5547. [DOI] [PubMed] [Google Scholar]
49. Baeken MW (2024) Sirtuins and their influence on autophagy. J Cell Biochem 125, e30377. [DOI] [PubMed] [Google Scholar]
50. Ramadani‐Muja J, Gottschalk B, Pfeil K, Burgstaller S, Rauter T, Bischof H, Waldeck‐Weiermair M, Bugger H, Graier WF and Malli R (2019) Visualization of Sirtuin 4 distribution between mitochondria and the nucleus, based on bimolecular fluorescence self‐complementation. Cells 8, 1583. [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Baeken MW, Schwarz M, Kern A, Moosmann B, Hajieva P and Behl C (2021) The selective degradation of sirtuins via macroautophagy in the MPP(+) model of Parkinson's disease is promoted by conserved oxidation sites. Cell Death Discov 7, 286. [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Wang Y, Yue J, Xiao M, Lu X and Chin YE (2022) SIRT4‐catalyzed deacetylation of Axin1 modulates the Wnt/beta‐catenin signaling pathway. Front Oncol 12, 872444. [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Yang S, Xu W, Liu C, Jin J, Li X, Jiang Y, Zhang L, Meng X, Zhan J and Zhang H (2022) LATS1 K751 acetylation blocks activation of hippo signalling and switches LATS1 from a tumor suppressor to an oncoprotein. Sci China Life Sci 65, 129–141. [DOI] [PubMed] [Google Scholar]
54. Mehrabipour M, Nakhaei‐Rad S, Dvorsky R, Lang A, Verhulsdonk P, Ahmadian MR and Piekorz RP (2024) SIRT4 as a novel interactor and candidate suppressor of C‐RAF kinase in MAPK signaling. Life Sci Alliance 7, e202302507. [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Yang G, Xiang J, Yang X, Liu X, Li Y, Li L, Kang L, Liang Z and Yang S (2024) Nuclear translocation of SIRT4 mediates deacetylation of U2AF2 to modulate renal fibrosis through alternative splicing‐mediated upregulation of CCN2. Elife 13, RP98524. [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Huang H, Ouyang Q, Mei K, Liu T, Sun Q, Liu W and Liu R (2023) Acetylation of SCFD1 regulates SNARE complex formation and autophagosome‐lysosome fusion. Autophagy 19, 189–203. [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Herzig S and Shaw RJ (2018) AMPK: guardian of metabolism and mitochondrial homeostasis. Nat Rev Mol Cell Biol 19, 121–135. [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Villar VH, Merhi F, Djavaheri‐Mergny M and Duran RV (2015) Glutaminolysis and autophagy in cancer. Autophagy 11, 1198–1208. [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Haigis MC, Mostoslavsky R, Haigis KM, Fahie K, Christodoulou DC, Murphy AJ, Valenzuela DM, Yancopoulos GD, Karow M, Blander G et al. (2006) SIRT4 inhibits glutamate dehydrogenase and opposes the effects of calorie restriction in pancreatic beta cells. Cell 126, 941–954. [DOI] [PubMed] [Google Scholar]
60. Shaw E, Talwadekar M, Rashida Z, Mohan N, Acharya A, Khatri S, Laxman S and Kolthur‐Seetharam U (2020) Anabolic SIRT4 exerts retrograde control over TORC1 signalling by glutamine sparing in the mitochondria. Mol Cell Biol 40, e00212‐19. [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Park JM, Lee DH and Kim DH (2023) Redefining the role of AMPK in autophagy and the energy stress response. Nat Commun 14, 2994. [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Kim DH (2024) Contrasting views on the role of AMPK in autophagy. Bioessays 46, e2300211. [DOI] [PMC free article] [PubMed] [Google Scholar]
63. Schlicker C, Gertz M, Papatheodorou P, Kachholz B, Becker CF and Steegborn C (2008) Substrates and regulation mechanisms for the human mitochondrial sirtuins Sirt3 and Sirt5. J Mol Biol 382, 790–801. [DOI] [PubMed] [Google Scholar]
64. Zhang T, Liu J, Shen S, Tong Q, Ma X and Lin L (2020) SIRT3 promotes lipophagy and chaperon‐mediated autophagy to protect hepatocytes against lipotoxicity. Cell Death Differ 27, 329–344. [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Zhang T, Liu J, Tong Q and Lin L (2020) SIRT3 acts as a positive autophagy regulator to promote lipid mobilization in adipocytes via activating AMPK. Int J Mol Sci 21, 372. [DOI] [PMC free article] [PubMed] [Google Scholar]
66. Polletta L, Vernucci E, Carnevale I, Arcangeli T, Rotili D, Palmerio S, Steegborn C, Nowak T, Schutkowski M, Pellegrini L et al. (2015) SIRT5 regulation of ammonia‐induced autophagy and mitophagy. Autophagy 11, 253–270. [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Barreca F, Aventaggiato M, Vitiello L, Sansone L, Russo MA, Mai A, Valente S and Tafani M (2023) SIRT5 activation and inorganic phosphate binding reduce cancer cell vitality by modulating autophagy/mitophagy and ROS. Antioxidants (Basel) 12, 1635. [DOI] [PMC free article] [PubMed] [Google Scholar]
68. Naseer A, Toppo P, Akbar M and Nazir A (2025) RNAi of mitochondrial sirtuin, sir‐2.2 reduces alpha‐synuclein clearance and impairs energy homeostasis in C. elegans . Dis Model Mech doi: 10.1242/dmm.052197 [DOI] [PMC free article] [PubMed] [Google Scholar]
69. Dodson M, Darley‐Usmar V and Zhang J (2013) Cellular metabolic and autophagic pathways: traffic control by redox signaling. Free Radic Biol Med 63, 207–221. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. CoCl₂ treatment induces a pseudo‐hypoxic response in wild‐type HEK293 cells.

Fig. S2. Generation and characterization of HEK293 cell lines stably expressing C‐terminal eGFP fusion or myc‐Flag tagged versions of SIRT4 or SIRT4(H161Y).

Fig. S3. Inhibitory impact of SIRT4(H161Y) on autophagic flux upon CoCl₂‐induced pseudohypoxia.

Fig. S4. SIRT4(H161Y) inhibits autophagic flux upon CCCP/oligomycin‐mediated mitochondrial stress or Rapamycin treatment.

Fig. S6. Impact of tubacin or MYLS22 treatment on the inhibited autophagic flux of CCCP/oligomycin‐treated HEK293‐SIRT4(H161Y) cells.

Fig. S7. Impact of tubacin or MYLS22 treatment on the inhibited autophagic flux of rapamycin‐treated HEK293‐SIRT4(H161Y) cells.

Fig. S8. ShRNA‐mediated downregulation of SIRT4 expression does not translate into a decreased LC3B‐II response upon CoCl₂ treatment.

FEB4-16-870-s002.pdf^{(1.8MB, pdf)}

Table S1. Primary antibodies used in this study.

FEB4-16-870-s001.docx^{(20.6KB, docx)}

Data Availability Statement

The data that support the findings of this study are available in Figs 1, 2, 3, 4, 5, 6, 7 and the Supporting Information of this article.

[feb470164-bib-0001] 1. Zhang J (2013) Autophagy and mitophagy in cellular damage control. Redox Biol 1, 19–23. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0002] 2. Zimmermann M and Reichert AS (2017) How to get rid of mitochondria: crosstalk and regulation of multiple mitophagy pathways. Biol Chem 399, 29–45. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0003] 3. Panwar V, Singh A, Bhatt M, Tonk RK, Azizov S, Raza AS, Sengupta S, Kumar D and Garg M (2023) Multifaceted role of mTOR (mammalian target of rapamycin) signaling pathway in human health and disease. Signal Transduct Target Ther 8, 375. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0004] 4. Munoz‐Sanchez J and Chanez‐Cardenas ME (2019) The use of cobalt chloride as a chemical hypoxia model. J Appl Toxicol 39, 556–570. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0005] 5. Georgakopoulos ND, Wells G and Campanella M (2017) The pharmacological regulation of cellular mitophagy. Nat Chem Biol 13, 136–146. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0006] 6. Lee K and Yun J (2022) Mitophagy stimulation as a novel strategy for the treatment of mitochondrial diseases. J Gene Med 19, 49–56. [Google Scholar]

[feb470164-bib-0007] 7. Zachari M and Ganley IG (2017) The mammalian ULK1 complex and autophagy initiation. Essays Biochem 61, 585–596. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0008] 8. Raufi AG, Liguori NR, Carlsen L, Parker C, Hernandez Borrero L, Zhang S, Tian X, Louie A, Zhou L, Seyhan AA et al. (2021) Therapeutic targeting of autophagy in pancreatic ductal adenocarcinoma. Front Pharmacol 12, 751568. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0009] 9. Caponio D, Veverova K, Zhang SQ, Shi L, Wong G, Vyhnalek M and Fang EF (2022) Compromised autophagy and mitophagy in brain ageing and Alzheimer's diseases. Aging Brain 2, 100056. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0010] 10. Mizushima N and Yoshimori T (2007) How to interpret LC3 immunoblotting. Autophagy 3, 542–545. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0011] 11. Alers S, Loffler AS, Wesselborg S and Stork B (2012) The incredible ULKs. Cell Commun Signal 10, 7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0012] 12. Kim J, Kundu M, Viollet B and Guan KL (2011) AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 13, 132–141. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0013] 13. Mendes KL, Lelis DF and Santos SHS (2017) Nuclear sirtuins and inflammatory signaling pathways. Cytokine Growth Factor Rev 38, 98–105. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0014] 14. Mostoslavsky R, Chua KF, Lombard DB, Pang WW, Fischer MR, Gellon L, Liu P, Mostoslavsky G, Franco S, Murphy MM et al. (2006) Genomic instability and aging‐like phenotype in the absence of mammalian SIRT6. Cell 124, 315–329. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0015] 15. Jaiswal A, Xudong Z, Zhenyu J and Saretzki G (2021) Mitochondrial sirtuins in stem cells and cancer. FEBS J 289, 3393–3415. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0016] 16. Ji Z, Liu GH and Qu J (2022) Mitochondrial sirtuins, metabolism, and aging. J Genet Genomics 49, 287–298. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0017] 17. Lang A, Anand R, Altinoluk‐Hambuchen S, Ezzahoini H, Stefanski A, Iram A, Bergmann L, Urbach J, Bohler P, Hansel J et al. (2017) SIRT4 interacts with OPA1 and regulates mitochondrial quality control and mitophagy. Aging (Albany NY) 9, 2163–2189. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0018] 18. Lang A, Grether‐Beck S, Singh M, Kuck F, Jakob S, Kefalas A, Altinoluk‐Hambuchen S, Graffmann N, Schneider M, Lindecke A et al. (2016) MicroRNA‐15b regulates mitochondrial ROS production and the senescence‐associated secretory phenotype through sirtuin 4/SIRT4. Aging (Albany NY) 8, 534–559. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0019] 19. MacVicar TD and Lane JD (2014) Impaired OMA1‐dependent cleavage of OPA1 and reduced DRP1 fission activity combine to prevent mitophagy in cells that are dependent on oxidative phosphorylation. J Cell Sci 127, 2313–2325. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0020] 20. Fu L, Dong Q, He J, Wang X, Xing J, Wang E, Qiu X and Li Q (2016) SIRT4 inhibits malignancy progression of NSCLCs, through mitochondrial dynamics mediated by the ERK‐Drp1 pathway. Oncogene 36, 2724–2736. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0021] 21. Bergmann L, Lang A, Bross C, Altinoluk‐Hambuchen S, Fey I, Overbeck N, Stefanski A, Wiek C, Kefalas A, Verhulsdonk P et al. (2020) Subcellular localization and mitotic interactome analyses identify SIRT4 as a centrosomally localized and microtubule associated protein. Cells 9, 1950. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0022] 22. Mathias RA, Greco TM, Oberstein A, Budayeva HG, Chakrabarti R, Rowland EA, Kang Y, Shenk T and Cristea IM (2014) Sirtuin 4 is a lipoamidase regulating pyruvate dehydrogenase complex activity. Cell 159, 1615–1625. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0023] 23. Chang P, Li H, Hu H, Li Y and Wang T (2021) The role of HDAC6 in autophagy and NLRP3 inflammasome. Front Immunol 12, 763831. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0024] 24. Shi L, Song Z, Li C, Deng F, Xia Y, Huang J, Wu X and Zhu J (2022) HDAC6 inhibition alleviates ischemia‐ and cisplatin‐induced acute kidney injury by promoting autophagy. Cells 11, 3951. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0025] 25. Hampel N, Georgy J, Mehrabipour M, Lang A, Lehmkuhl I, Scheller J, Ahmadian MR, Floss DM and Piekorz RP (2023) CoCl₂‐triggered pseudohypoxic stress induces proteasomal degradation of SIRT4 via polyubiquitination of lysines K78 and K299. FEBS Open Bio 13, 2187–2199. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0026] 26. Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, Kodama A, Ishihara T, Mizushima T and Mizushima N (2016) An autophagic flux probe that releases an internal control. Mol Cell 64, 835–849. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0027] 27. Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, Sideris DP, Fogel AI and Youle RJ (2015) The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524, 309–314. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0028] 28. Drews L, Zimmermann M, Westhoff P, Brilhaus D, Poss RE, Bergmann L, Wiek C, Brenneisen P, Piekorz RP, Mettler‐Altmann T et al. (2020) Ammonia inhibits energy metabolism in astrocytes in a rapid and glutamate dehydrogenase 2‐dependent manner. Dis Model Mech 13, dmm047134. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0029] 29. Williams JA, Zhao K, Jin S and Ding WX (2017) New methods for monitoring mitochondrial biogenesis and mitophagy in vitro and in vivo. Exp Biol Med (Maywood) 242, 781–787. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0030] 30. Schmittgen TD and Livak KJ (2008) Analyzing real‐time PCR data by the comparative C(T) method. Nat Protoc 3, 1101–1108. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0031] 31. Guedes‐Dias P, de Proenca J, Soares TR, Leitao‐Rocha A, Pinho BR, Duchen MR and Oliveira JM (2015) HDAC6 inhibition induces mitochondrial fusion, autophagic flux and reduces diffuse mutant huntingtin in striatal neurons. Biochim Biophys Acta 1852, 2484–2493. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0032] 32. Liang T, Qi C, Lai Y, Xie J, Wang H, Zhang L, Lin T, Jv M, Li J, Wang Y et al. (2020) HDAC6‐mediated alpha‐tubulin deacetylation suppresses autophagy and enhances motility of podocytes in diabetic nephropathy. J Cell Mol Med 24, 11558–11572. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0033] 33. Shen Z, Ji K, Cai Z, Huang C, He X, Xu H and Chen G (2021) Inhibition of HDAC6 by Tubastatin A reduces chondrocyte oxidative stress in chondrocytes and ameliorates mouse osteoarthritis by activating autophagy. Aging (Albany NY) 13, 9820–9837. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0034] 34. Agrawal A, Clayton EL, Cavazos CL, Clayton BA and Rodney GG (2025) Histone deacetylase 6 inhibition promotes microtubule acetylation and facilitates autophagosome‐lysosome fusion in dystrophin‐deficient mdx mice. Acta Physiol (Oxf) 241, e14243. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0035] 35. Gilkerson R, De La Torre P and St Vallier S (2021) Mitochondrial OMA1 and OPA1 as gatekeepers of organellar structure/function and cellular stress response. Front Cell Dev Biol 9, 626117. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0036] 36. Noguchi M, Kohno S, Pellattiero A, Machida Y, Shibata K, Shintani N, Kohno T, Gotoh N, Takahashi C, Hirao A et al. (2023) Inhibition of the mitochondria‐shaping protein Opa1 restores sensitivity to gefitinib in a lung adenocarcinomaresistant cell line. Cell Death Dis 14, 241. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0037] 37. Mauvezin C, Nagy P, Juhasz G and Neufeld TP (2015) Autophagosome‐lysosome fusion is independent of V‐ATPase‐mediated acidification. Nat Commun 6, 7007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0038] 38. Mauvezin C and Neufeld TP (2015) Bafilomycin A1 disrupts autophagic flux by inhibiting both V‐ATPase‐dependent acidification and Ca‐P60A/SERCA‐dependent autophagosome‐lysosome fusion. Autophagy 11, 1437–1438. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0039] 39. Zhou J, Sinha RA, Lesmana R, Yau WWY and Yen PM (2018) Pharmacological inhibition of lysosomal activity as a method for monitoring thyroid hormone‐induced autophagic flux in mammalian cells in vitro. In Thyroid Hormone Nuclear Receptor: Methods and Protocols. Vol. 1801 (Plateroti M and Samarut J, eds), pp. 111–122. Springer, New York, NY. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0040] 40. Zhang J (2015) Teaching the basics of autophagy and mitophagy to redox biologists–mechanisms and experimental approaches. Redox Biol 4, 242–259. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0041] 41. Wang H, Liu Y, Wang D, Xu Y, Dong R, Yang Y, Lv Q, Chen X and Zhang Z (2019) The upstream pathway of mTOR‐mediated autophagy in liver diseases. Cells 8, 1597. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0042] 42. Li J, Zhan H, Ren Y, Feng M, Wang Q, Jiao Q, Wang Y, Liu X, Zhang S, Du L et al. (2022) Sirtuin 4 activates autophagy and inhibits tumorigenesis by upregulating the p53 signaling pathway. Cell Death Differ 30, 313–326. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0043] 43. Qin M, Xie Z, Cao T, Wang Z, Zhang X, Wang F, Wei W, Jin M, Ma J, Zeng L et al. (2022) Autophagy in rat muller glial cells is modulated by the Sirtuin 4/AMPK/mTOR pathway and induces apoptosis under oxidative stress. Cells 11, 2645. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0044] 44. Wang YS, Du L, Liang X, Meng P, Bi L, Wang Y, Wang C and Tang B (2019) Sirtuin 4 depletion promotes hepatocellular carcinoma tumorigenesis through regulating adenosine‐monophosphate–activated protein kinase alpha/mammalian target of rapamycin axis in mice. Hepatology 69, 1614–1631. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0045] 45. Shang L, Chen S, Du F, Li S, Zhao L and Wang X (2011) Nutrient starvation elicits an acute autophagic response mediated by Ulk1 dephosphorylation and its subsequent dissociation from AMPK. Proc Natl Acad Sci USA 108, 4788–4793. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0046] 46. Passaro E, Papulino C, Chianese U, Toraldo A, Congi R, Del Gaudio N, Nicoletti MM, Benedetti R and Altucci L (2021) HDAC6 inhibition extinguishes autophagy in cancer: recent insights. Cancers (Basel) 13, 6280. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0047] 47. Lechado Terradas A, Zittlau KI, Macek B, Fraiberg M, Elazar Z and Kahle PJ (2021) Regulation of mitochondrial cargo‐selective autophagy by posttranslational modifications. J Biol Chem 297, 101339. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0048] 48. Liu M, Wang Z, Ren M, Yang X, Liu B, Qi H, Yu M, Song S, Chen S, Liu L et al. (2019) SIRT4 regulates PTEN stability through IDE in response to cellular stresses. FASEB J 33, 5535–5547. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0049] 49. Baeken MW (2024) Sirtuins and their influence on autophagy. J Cell Biochem 125, e30377. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0050] 50. Ramadani‐Muja J, Gottschalk B, Pfeil K, Burgstaller S, Rauter T, Bischof H, Waldeck‐Weiermair M, Bugger H, Graier WF and Malli R (2019) Visualization of Sirtuin 4 distribution between mitochondria and the nucleus, based on bimolecular fluorescence self‐complementation. Cells 8, 1583. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0051] 51. Baeken MW, Schwarz M, Kern A, Moosmann B, Hajieva P and Behl C (2021) The selective degradation of sirtuins via macroautophagy in the MPP(+) model of Parkinson's disease is promoted by conserved oxidation sites. Cell Death Discov 7, 286. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0052] 52. Wang Y, Yue J, Xiao M, Lu X and Chin YE (2022) SIRT4‐catalyzed deacetylation of Axin1 modulates the Wnt/beta‐catenin signaling pathway. Front Oncol 12, 872444. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0053] 53. Yang S, Xu W, Liu C, Jin J, Li X, Jiang Y, Zhang L, Meng X, Zhan J and Zhang H (2022) LATS1 K751 acetylation blocks activation of hippo signalling and switches LATS1 from a tumor suppressor to an oncoprotein. Sci China Life Sci 65, 129–141. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0054] 54. Mehrabipour M, Nakhaei‐Rad S, Dvorsky R, Lang A, Verhulsdonk P, Ahmadian MR and Piekorz RP (2024) SIRT4 as a novel interactor and candidate suppressor of C‐RAF kinase in MAPK signaling. Life Sci Alliance 7, e202302507. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0055] 55. Yang G, Xiang J, Yang X, Liu X, Li Y, Li L, Kang L, Liang Z and Yang S (2024) Nuclear translocation of SIRT4 mediates deacetylation of U2AF2 to modulate renal fibrosis through alternative splicing‐mediated upregulation of CCN2. Elife 13, RP98524. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0056] 56. Huang H, Ouyang Q, Mei K, Liu T, Sun Q, Liu W and Liu R (2023) Acetylation of SCFD1 regulates SNARE complex formation and autophagosome‐lysosome fusion. Autophagy 19, 189–203. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0057] 57. Herzig S and Shaw RJ (2018) AMPK: guardian of metabolism and mitochondrial homeostasis. Nat Rev Mol Cell Biol 19, 121–135. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0058] 58. Villar VH, Merhi F, Djavaheri‐Mergny M and Duran RV (2015) Glutaminolysis and autophagy in cancer. Autophagy 11, 1198–1208. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0059] 59. Haigis MC, Mostoslavsky R, Haigis KM, Fahie K, Christodoulou DC, Murphy AJ, Valenzuela DM, Yancopoulos GD, Karow M, Blander G et al. (2006) SIRT4 inhibits glutamate dehydrogenase and opposes the effects of calorie restriction in pancreatic beta cells. Cell 126, 941–954. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0060] 60. Shaw E, Talwadekar M, Rashida Z, Mohan N, Acharya A, Khatri S, Laxman S and Kolthur‐Seetharam U (2020) Anabolic SIRT4 exerts retrograde control over TORC1 signalling by glutamine sparing in the mitochondria. Mol Cell Biol 40, e00212‐19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0061] 61. Park JM, Lee DH and Kim DH (2023) Redefining the role of AMPK in autophagy and the energy stress response. Nat Commun 14, 2994. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0062] 62. Kim DH (2024) Contrasting views on the role of AMPK in autophagy. Bioessays 46, e2300211. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0063] 63. Schlicker C, Gertz M, Papatheodorou P, Kachholz B, Becker CF and Steegborn C (2008) Substrates and regulation mechanisms for the human mitochondrial sirtuins Sirt3 and Sirt5. J Mol Biol 382, 790–801. [DOI] [PubMed] [Google Scholar]

[feb470164-bib-0064] 64. Zhang T, Liu J, Shen S, Tong Q, Ma X and Lin L (2020) SIRT3 promotes lipophagy and chaperon‐mediated autophagy to protect hepatocytes against lipotoxicity. Cell Death Differ 27, 329–344. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0065] 65. Zhang T, Liu J, Tong Q and Lin L (2020) SIRT3 acts as a positive autophagy regulator to promote lipid mobilization in adipocytes via activating AMPK. Int J Mol Sci 21, 372. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0066] 66. Polletta L, Vernucci E, Carnevale I, Arcangeli T, Rotili D, Palmerio S, Steegborn C, Nowak T, Schutkowski M, Pellegrini L et al. (2015) SIRT5 regulation of ammonia‐induced autophagy and mitophagy. Autophagy 11, 253–270. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0067] 67. Barreca F, Aventaggiato M, Vitiello L, Sansone L, Russo MA, Mai A, Valente S and Tafani M (2023) SIRT5 activation and inorganic phosphate binding reduce cancer cell vitality by modulating autophagy/mitophagy and ROS. Antioxidants (Basel) 12, 1635. [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0068] 68. Naseer A, Toppo P, Akbar M and Nazir A (2025) RNAi of mitochondrial sirtuin, sir‐2.2 reduces alpha‐synuclein clearance and impairs energy homeostasis in C. elegans . Dis Model Mech doi: 10.1242/dmm.052197 [DOI] [PMC free article] [PubMed] [Google Scholar]

[feb470164-bib-0069] 69. Dodson M, Darley‐Usmar V and Zhang J (2013) Cellular metabolic and autophagic pathways: traffic control by redox signaling. Free Radic Biol Med 63, 207–221. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

SIRT4 positively regulates autophagy via ULK1, but independently of HDAC6 and OPA1

Isabell Lehmkuhl

Khawar Amin

Lydia Gabriel

Nils Hampel

Afshin Iram

Julia Hesse

Constanze Wiek

Jasmin Thuy Vy Nguyen

Helmut Hanenberg

Jürgen Scheller

M Reza Ahmadian

Björn Stork

Doreen M Floss

Roland P Piekorz

Abstract

Abbreviations

Materials and methods

Reagents and antibodies

Cell culture

Treatment of HEK293 cell lines with mitophagy or autophagy inducers and selected inhibitors

Preparation of total cell lysates and immunoblot analysis

Flow cytometry‐based methods

Measurement of autophagic flux using the GFP‐LC3‐RFP‐LC3ΔG probe

Measurement of mitophagy using the pH‐sensitive and mitochondrially (mt) targeted mt‐mKEIMA probe

Cellular analysis of mitochondrial mass using the MitoMark Green I probe

ShRNA‐mediated depletion of SIRT4

Real‐time PCR/qPCR analysis

Statistical analysis

Results

The enzymatically inactive SIRT4 mutant SIRT4(H161Y) inhibits stress‐induced LC3B‐II generation, autophagic flux, and mitophagy

Fig. 1.

SIRT4(H161Y)‐mediated inhibition of CoCl2‐induced LC3B‐II increase and autophagic flux is not linked to increased HDAC6 levels and decreased acetylated α‐tubulin (acK40)

Fig. 2.

Fig. 3.

Lack of CoCl2‐induced LC3B‐II increase and autophagic flux in SIRT4(H161Y) expressing cells is not based on increased OPA1‐L stabilization and altered mitochondrial dynamics

Fig. 4.

Fig. 5.

BafA1‐mediated inhibition of autophagosome–lysosome fusion fails to restore LC3B‐II levels in CoCl2‐treated SIRT4(H161Y) expressing cells

Fig. 6.

SIRT4(H161Y) promotes phosphorylation of ULK‐1 at Ser758 and Ser638 that are linked to negative regulation of early autophagy

Fig. 7.

Discussion

Conclusions

Fig. 8.

Conflict of interest

Author contributions

Supporting information

Acknowledgements

Data accessibility

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

SIRT4(H161Y)‐mediated inhibition of CoCl₂‐induced LC3B‐II increase and autophagic flux is not linked to increased HDAC6 levels and decreased acetylated α‐tubulin (acK40)

Lack of CoCl₂‐induced LC3B‐II increase and autophagic flux in SIRT4(H161Y) expressing cells is not based on increased OPA1‐L stabilization and altered mitochondrial dynamics

BafA₁‐mediated inhibition of autophagosome–lysosome fusion fails to restore LC3B‐II levels in CoCl₂‐treated SIRT4(H161Y) expressing cells