Abstract
Pancreatic cancer (PC) is life-threatening with unfavorable outcomes. RBM15, an m6A methylation modulator, is a potential biomarker for cancers. This study delved into the mechanism of RBM15-mediated m6A modification in PC. RBM15, LINC01320, miR-1287-5p, and FBXO11 levels in PC tissues and cells were examined. Cell proliferation, invasion, and migration were determined. The enrichment of m6A on LINC01320 and LINC01320 stability were detected. Joint experiments were designed to analyze the role of LINC01320 or FBXO11 in PC cell growth. The tumor xenograft in nude mice was established, and the effect of RBM15 on PC cell proliferation was verified in vivo. RBM15, LINC01320, and FBXO11 were significantly increased in PC, while miR-1287-5p was decreased. RBM15 downregulation reduced PC cell proliferation, invasion, and migration. In mechanism, RBM15-mediated m6A modification increased LINC01320 stability and its expression, thus upregulating FBXO11 transcription by competitively binding to miR-1287-5p. Overexpression of LINC01320 or FBXO11 abated the inhibition of RBM15 downregulation on PC cells. RBM15 knockdown inhibited tumor size and weight and reduced the positive rate of Ki67 through LINC01320/miR-1287-5p/FBXO11 axis. Overall, RBM15-mediated m6A modification increases LINC01320 stability and promotes its expression and FBXO11 transcription by competitive binding to miR-1287-5p, ultimately promoting PC cell growth.
Keywords: Pancreatic cancer, RBM15, LINC01320, miR-1287-5p, FBXO11
INTRODUCTION
Pancreatic cancer (PC) is a life-threatening condition with unfavorable outcomes and rising incidence (McGuigan et al., 2018). The risks of PC increase with age, and other factors such as genetic factors, environmental and occupational causes, and modifiable exposures including smoking, drinking, high body mass index, and diabetes mellitus play a contributory role (Klein, 2021). Given that PC has no early symptoms and can rapidly invade surrounding tissues and organs (Zhao and Liu, 2020), approximately 90% of PC patients are diagnosed at an advanced stage after the tumors have migrated beyond the pancreas and more than 50% of patients have systemic metastases (Wood et al., 2022). Although multiple therapeutic strategies are available, patients with metastatic PC have unsatisfying prognosis, with a median survival of 12 months after chemotherapy and 20-28 months after resection and adjuvant therapy (Loveday et al., 2019). Therefore, the establishment of precision medicine for PC is an urgent need.
RNA-binding motif (RBM) proteins represent a class of important intracellular proteins implicated in several post-transcriptional regulation processes including RNA splicing, transport, translation, localization, and N6-methyladenosine (m6A) modification (Li et al., 2021b). m6A is the most abundant internal mRNA modification and is involved in RNA transcription, degradation, and translation in the development of multiple cancers (Wang and Tang, 2023; Zhang et al., 2023). Recent evidence has shown that the m6A modification is crucial in the pathogenesis and progression of PC, with regulation in cell survival, proliferation, metastasis, and drug resistance (Chen et al., 2022). Several members of the RBM family have emerged as critical regulators of cancer progression, which positions RBPs as promising targets for novel anti-cancer therapies (Pereira et al., 2017). RBM15, as an m6A methylation modulator, is deemed a potential prognostic biomarker in pancreatic adenocarcinoma (Zhao et al., 2022). Plus, RBM15 plays a critical role in PC cell behaviors (Dong et al., 2023). However, the concrete mechanism of RBM15-mediated m6A methylation in PC is rarely studied.
Long intergenic non-coding RNAs (LincRNAs) are autonomously transcribed non-coding RNAs with >200 nucleotides that share characteristics with other transcripts of the long non-coding RNAs (lncRNAs) (Ransohoff et al., 2018). Several studies show the involvement of lncRNAs in PC progression (Huang et al., 2023; Lu et al., 2023). As reported, LINC01320 exhibits high expression in PC and supports the growth and migration of PC cells (Meng et al., 2021). Additionally, the m6A-mediated LINC01320 overexpression contributes to the proliferation and invasion of gastric cancer cells (Hu and Ji, 2021). Unfortunately, the effects of m6A modification of LINC01320 on PC and whether RBM15 affects LINC01320 m6A modification remain elusive. LncRNAs alter gene expression by titrating microRNAs (miRNAs), small non-coding RNAs with a length of 22 nucleotides and post-transcriptional regulatory effects by binding to specific sites on their target transcripts, through the competing endogenous RNA (ceRNA) mechanism, which is widely discussed in cancers (Chan and Tay, 2018; de Rooij et al., 2022; Yan et al., 2021). The function of miRNAs in cancer is also widely studied (Beni et al., 2022). miR-1287-5p is weakly expressed in PC and is most likely sponged by circular RNA 0075829 (Zhang et al., 2020a). F-box protein 11 (FBXO11), the predicted target gene of miR-1287-5p, shows the opposite expression pattern to miR-1287-5p in PC (Xue et al., 2022). However, the interactions among LINC01320, miR-1287-5p, and FBXO11 and their effects on PC are still unknown. To fill the gap, the present study investigates the function of RBM15 on PC cells and its downstream molecular mechanism, hoping to offer new theoretical references for PC therapy.
MATERIALS AND METHODS
Tissue collection
Sixty patients (40-75 years old) with PC treated in Shengjing Hospital of China Medical University from 2019 to 2023 were collected. Tumor tissues and adjacent tissues (3 cm away from the tumor) were obtained intraoperatively and transferred in liquid nitrogen to the laboratory for testing. All patients were diagnosed for the first time and had not received targeted antitumor therapy, nor other tumor combinations. The study was approved by Shengjing Hospital of China Medical University Medical Ethics Committee (approval number: 2022PS971K) and conducted according to the Declaration of Helsinki. All patients signed informed consent. Animal studies were approved by Shengjing Hospital of China Medical University Ethics Committee (approval number: 2022PS982K), and all animal use, care, and experimental procedures followed the Guide for Care and Use of Laboratory Animals (National Research Council (US), 2011).
Cell culture
PC cell lines Panc 03.27 (CRL-2549; RRID:CVCL_1635), SW1990 (CRL-2172; RRID:CVCL_1723), BxPc3 (CRL-1687; RRID:CVCL_XX78), and MIA PaCa-2 (CRM-CRL-1420; RRID:CVCL_0428) and normal immortalized human pancreatic epithelial cell line HPDE6C7 (CRL-4023; RRID:CVCL_0P38) purchased from ATCC were cultured in DMEM (Sigma-Aldrich, St. Louis, MO, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and 1% penicillin and streptomycin (Gibco, Grand Island, NY, USA) in an incubator (ThermoFisher, Waltham, MA, USA) at 37°C and 5% CO2.
Cell treatment
RBM15 small interfering RNA (siRNA) (si-RBM15#1, 2, 3) and negative control (NC) scrambling siRNA for RBM15 (si-NC) were obtained from RiboBio (Guangzhou, China). LINC01320 (Accession number NR_126404) pcDNA3.1 (LINC01320), FBXO11 (Accession number NM_001190274) pcDNA3.1 (FBXO11), and control empty vector pcDNA3.1 NC were purchased from GenePharma Biotechnology (Shanghai, China). SW1990 and BxPC-3 cells were cultured to 60% confluence in 6-well plates and then transfected with siRNAs or plasmids using Lipofectamine 3000 (Invitrogen, CA, USA). Cells were collected after 48 h for transfection efficiency assay and subsequent experimental analyses. The shRNA sequences are shown in Table 1.
Table 1.
Sequences for silencing vectors
| Name | Sequence |
|---|---|
| si-RBM15#1 | SS Sequence: GAGGAUGAUCAGCGAGCUAAC |
| AS Sequence: UAGCUCGCUGAUCAUCCUCGG | |
| si-RBM15#2 | SS Sequence: GGACAAGUCCAGCAGUCGAGG |
| AS Sequence: UCGACUGCUGGACUUGUCCAG | |
| si-RBM15#3 | SS Sequence: GCCUGUUUCAUGAGUUCAAAC |
| AS Sequence: UUGAACUCAUGAAACAGGCCG | |
| si-NC | SS Sequence: CCAGCAGGAGGAUGAUGAGUU |
| AS Sequence: CGCUGGCUGGAUUGAGAGGAG | |
| sh-RBM15 | SS Sequence: CGGTGATGTAAGTGTGAAA |
| AS Sequence: TTTCACACTTACATCACCG | |
| sh-NC | SS Sequence: GTGACGTGTATGTGAAAGA |
| AS Sequence: CCGTTTCAATCATTCACAC |
Cell counting kit-8 (CCK-8) assay
CCK-8 assay (Beyotime, Shanghai, China) was used to determine SW1990 and BxPC-3 cell proliferation. Transfected cells were resuspended, adjusted to 1×104 cells, and then seeded on 96-well plates at 3000 cells/well. After incubation for different times (0, 24, 48, and 72 h), cells were treated with 10 μL CCK-8 reagent for 2 h. The absorbance of each well (450 nm) was measured on an enzyme marker (ThermoFisher). The experiment was conducted three times.
Colony formation assay
SW1990 and BxPC-3 cells were counted and cultured in 6-well plates (600 per well) in a medium containing 10% FBS. After 2 weeks, cell supernatants were removed and proliferating colonies were fixed with paraformaldehyde (Sigma-Aldrich) and stained with 0.5% crystalline violet (Sigma-Aldrich). The ability of cell clone formation was indicated by counting colonies (one colony containing more than 50 cells). The experiment was conducted three times.
Transwell assay
Transwell chambers (8 μm in diameter; Corning Glass Works, Corning, NY, USA) were used to detect cell migration and invasion, where the apical chamber in the invasion assay was pre-coated with Matrigel (BD Biosciences, Shanghai, China). SW1990 and BxPC-3 cells (2×104 cells/mL in serum-free medium) were cultured in the apical chamber. DMEM containing 10% FBS was added to the basolateral chamber. After 24 h of incubation at 37°C, cells migrating or invading the lower membranes were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet for 20 min. Images were taken under an inverted microscope (Olympus Optical, Tokyo, Japan). The experiment was conducted three times.
Bioinformatics analysis
GEPIA database (http://gepia.cancer-pku.cn/detail.php) (Tang et al., 2017) and the OncoLnc database (http://www.oncolnc.org) predicted RBM15 expression in PC and its association with prognosis. IncLocator database (http://www.csbio.sjtu.edu.cn/bioinf/lncLocator/?tdsourcetag=s_pcqq_aiomsg) (Cao et al., 2018) predicted subcellular localization of LINC01320. DIANA database (https://diana.e-ce.uth.gr/lncbasev3) (Karagkouni et al., 2020) and RNA22 database (https://cm.jefferson.edu/rna22/Precomputed/?) (Miranda et al., 2006) predicted miRNAs downstream of LINC01320. Starbase database (https://starbase.sysu.edu.cn/panCancer.php) (Li et al., 2014), Targetscan database (http://www.targetscan.org/vert_71) (Agarwal et al., 2015), miRDB database (http://mirdb.org/index.html) (Chen and Wang, 2020), and RNA22 database, miRWalk database (http://mirwalk.umm.uni-heidelberg.de) (Sticht et al., 2018) predicted the mRNA downstream of miR-1287-5p.
m6A quantitation
Total RNA was extracted by TRIzol reagent (Invitrogen). Tissue and cellular levels of m6A were detected using the m6A RNA methylation quantification kit (ab185912, Abcam, USA). And 200 ng of RNA was added to the wells, followed by the addition of capture and detection antibodies. The m6A levels were measured by absorbance at 450 nm. The experiment was conducted three times.
Methylated RNA immunoprecipitation (MeRIP)
MeRIP was performed using the MeRIP kit (Merck Millipore). Total RNA from SW1990 and BxPC-3 cells was isolated and incubated overnight at 4°C with anti-m6A antibody (ab208577, Abcam) or anti-IgG (ab170190, Abcam) with protein A/G magnetic beads in an IP buffer. Then, RNA was incubated with antibody-coated magnetic beads in the IP buffer. After ethanol precipitation, the immunoprecipitated m6A RNA was analyzed by RT-qPCR with IgG as the control. The experiment was conducted three times.
RNA stability
SW1990 and BxPC-3 cells were cultured in 24-well plates, treated with actinomycin D (2 μg/mL; Sigma), and RNA was extracted at different times (0, 3, 6, and 12 h) for RT-qPCR to test the stability of LINC01320. The experiment was conducted three times.
Fractionation of nuclear and cytoplasmic RNA
Cytoplasmic and nuclear LINC01320 levels were assessed using PARIS™ kits (ThermoFisher). Briefly, SW1990 and BxPC-3 cells were suspended in 200 μL of cryogenic cell separation buffer (ThermoFisher) and then centrifuged at 500 g for 4 min. Cytoplasmic fractions and nuclear pellets were carefully separated and lysed. RNA was isolated and LINC01320 expression was detected by RT-qPCR with U6 (for the nuclear) and GAPDH (for the cytoplasm) as references. The experiment was conducted three times.
RNA immunoprecipitation (RIP)
The Magna RIP kit (MILLIALE, Billerica, MA) was employed as per the kit instructions. SW1990 and BxPC-3 cells were lysed in RIP lysate and incubated in cell lysate. RIP buffer containing magnetic beads was combined with anti-AGO2 antibody (ab186733, Abcam) or anti-RBM15 antibody (ab70549, Abcam) and incubated at 4°C for 4 h with IgG (ab170190, Abcam) as negative control. Co-immunoprecipitated RNA was extracted for RT-qPCR. The experiment was conducted three times.
Dual-luciferase assay
The LINC01320 sequence containing the miR-1287-5p binding site was cloned into the luciferase reporter vector (WT-LINC01320), and then a site-directed mutation of the miR-1287-5p binding site in the LINC01320 sequence was inserted into the luciferase reporter vector (MUT-LINC01320) according to the manufacturer’s (RiboBio, Guangzhou, China) protocol. WT-FBXO11 and MUT-FBXO11 were obtained from FBXO11 3’UTR region sequence containing miR-1287-5p binding site and FBXO11 3’UTR region sequence with site-directed mutation. These vectors were cotransfected with miR-1287-5p mimic or NC (RiboBio) into SW1990 and BxPC-3 cells using Lipofectamine 3000. After 48 h, the luciferase activity was measured using the Dual-Glo Luciferase Assay System (Promega) and a fluorometer. The experiment was conducted three times.
Tumor xenograft in nude mice
Nude mice (BALB/c; male, 4-5 weeks old, 18-20 g) purchased from Viton River (SYXK (Zhe) 2019-0003) were kept in a pathogen-free environment. To observe cell proliferation, SW1990 cells (4×106/200 μL/each) were injected subcutaneously in the left groin of nude mice (stably expressed cell lines were prepared: the RBM15 shRNA sequence (sh-RBM15) and control shRNA (sh-NC) (Table 1) were cloned into a lentiviral vector, and cells were infected and screened for stable expression with puromycin). After 8 days, tumor volume was measured every 3 days (tumor volume=0.5×width 2×length). And 29 days later all nude mice were executed (150 mg/kg pentobarbital sodium intraperitoneally) and tumor specimens were removed and measured.
Immunohistochemistry
Tumors were excised, weighed, paraffin-embedded, cut into 5 μm, dewaxed, and rehydrated, and the antigen was extracted with citrate buffer for 10 min, followed by incubation in 3% hydrogen peroxide for 15 min and in goat serum (Solarbio, China) for 15 min. Then sections were incubated with Ki67 (ab15580, Abcam) overnight at 4°C, followed by incubation with secondary antibody (ab205718, Abcam) for 60 min at 37°C. Next, they were treated with DAB (ThermoFisher) for 10 min, counterstained with hematoxylin-eosin for 3 min, dehydrated in ethanol, and observed under a microscope (Olympus).
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total RNA was isolated from tissues and cells using TRIzol reagent (Invitrogen). Next, cDNA was synthesized using an RT kit (Invitrogen). SYBR Green PCR Kit (Takara) and ABI 7500 PCR (ABI) were used for amplification, and the reaction system and reaction conditions were configured according to the manufacturer’s instructions. Gene expression calculations were performed using the 2-ΔΔCt method (Livak and Schmittgen, 2001) with GAPDH and U6 (Zhang et al., 2020a) as the reference genes. Primers are shown in Table 2.
Table 2.
Primer sequences for RT-qPCR
| Gene | Sequence (5’-3’) |
|---|---|
| RBM15 | F: GCCTTCCCACCTTGTGAGTT |
| R: TCAACCAGTTTTGCACGGAC | |
| LINC01320 | F: AGGGATCCTGCAGGTTGGTG |
| R: TGGCATGGTGCAGTAGGAACT | |
| FBXO11 | F: ATCATGGACGTGATGTTGGTGTG |
| R: CCACTGTAGGGTTAGCATAGGC | |
| GAPDH | F: GTCTCCTCTGACTTCAACAGCG |
| R: ACCACCCTGTTGCTGTAGCCAA | |
| miR-1287-5p | F: AGCTGGATCAGTGGTTCGAG |
| R: GTCGTGGAGTCGGCAATTCAG | |
| U6 | F: F: AACGCTTCACGAATTTGCGT |
| R: GTGACGTTTGGGTCAGGTGC |
Western blot
Total proteins were extracted from tissues and cells using RIPA buffer (Keygen Biotech, Nanjing, Jiangsu, China) and protein concentrations were determined using a BCA kit (Beyotime, Shanghai, China). Equal amounts of proteins were loaded on SDS-PAGE and transferred to PVDF membranes (Millipore). The membranes were closed with 5% bovine serum albumin (Beyotime) and then incubated with the following antibodies: primary antibody RBM15 (1:2000, ab70549, Abcam), FBXO11 (1:1000, ab181801, Abcam) and GAPDH (1:2500, ab9485, Abcam) overnight at 4°C. The membranes were then incubated with secondary antibody (1:2000, ab6721, Abcam) for 1 h at room temperature. Enhanced chemiluminescence kit (Bio-Rad, Hercules, CA, USA) detected target proteins on the membrane. The relative expression was calculated as the ratio of the band gray value of the target protein to that of GAPDH.
Statistical analysis
Experimental data were analyzed and plotted using SPSS 21.0 (IBM Corp., Armonk, NY, USA) and GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). First, the normality and chi-square tests were performed to test for conformity to the normal distribution and chi-square. Pairwise comparisons were analyzed using the t test and comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons test. In all statistical references, a value of p<0.05 was indicative of statistical significance, and p<0.01 was regarded as extremely statistically significant.
RESULTS
RBM15 is highly-expressed in PC
Downregulation of RBM15 inhibits PC cell proliferation (Zhao et al., 2022), but the exact mechanism is unclear. The GEPIA database predicted that RBM15 was highly expressed in PC (p<0.05, Fig. 1A). The OncoLnc database predicted that PC patients with higher RBM15 expression had poorer prognosis (p<0.05, Fig. 1B). RBM15 expression was much higher in cancer tissues than in adjacent tissues (p<0.01, Fig. 1C, 1D). We also obtained the same trend at the cellular level that RBM15 was higher in PC cells than in HPDE6C7 cells (p<0.01, Fig. 1E, 1F). In addition, we collected the clinicopathological characteristics of PC patients, and we divided 60 patients into the RBM15 high expression group and the RBM15 low expression group with the median of RBM15 expression in cancer tissue (Xie et al., 2019) as the critical threshold to analyze the correlation between RBM15 expression and clinical characteristics of patients. As shown in Table 3, the expression of RBM15 is related to tumor size, TNM stage, and lymph node metastasis (p<0.05).
Fig. 1.
RBM15 is highly expressed in PC tissues and cells. (A) GEPIA database prediction of RBM15 expression in PC. (B) OncoLnc database prediction of the correlation between RBM15 and PC prognosis. (C, D) RT-qPCR and Western blot (representative bands) to detect RBM15 expression in tissues (N=60, with adjacent tissue as negative control). (E, F) RT-qPCR and Western blot (representative bands) to detect RBM15 expression in cells (with HPDE6C7 cells as negative control). Three biological replicates were performed, and data were expressed as mean ± standard deviation; t-test was used to compare data between two groups in panels (C, D); one-way ANOVA was used for data comparisons between multiple groups in panels (E, F), followed by Tukey’s post hoc test. (E, F) **p<0.01 vs. HPDE6C7 cells; others: *p<0.05, **p<0.01.
Table 3.
The correlation between RBM15 expression and clinicopathological factors in PC patients
| Clinicopathological factors | Number (n = 60) |
Low expression (n = 30) |
High expression (n = 30) |
p value | |
|---|---|---|---|---|---|
| Age (years) | ≤60 | 27 | 13 | 14 | 0.795 |
| >60 | 33 | 17 | 16 | ||
| Gender | Female | 26 | 14 | 12 | 0.602 |
| Male | 34 | 16 | 18 | ||
| Tumor size (cm) | ≤2 | 26 | 17 | 9 | 0.037 |
| >2 | 34 | 13 | 21 | ||
| TNM stage | I+II | 24 | 16 | 8 | 0.035 |
| III+IV | 36 | 14 | 22 | ||
| Lymph node metastasis | Negative | 29 | 19 | 10 | 0.020 |
| Positive | 31 | 11 | 20 | ||
| Distant metastasis | Negative | 29 | 18 | 11 | 0.071 |
| Positive | 31 | 12 | 19 | ||
| Differentiation | Well/middle | 33 | 20 | 13 | 0.069 |
| Poor | 27 | 10 | 17 |
RBM15 downregulation inhibits PC cell growth
To explore the role of RBM15 in PC cells, we selected SW1990 cells with relatively high RBM15 expression and BxPC-3 cells with low RBM15 expression for RBM15 knockdown treatment, and selected si-RBM15#3 with better transfection efficiency for subsequent assays (p<0.01, Fig. 2A, 2B). The results revealed that the proliferation ability of cells in the si-RBM15 group was diminished (p<0.01, Fig. 2C, 2D) and the number of colonies was reduced (p<0.01, Fig. 2E). In addition, RBM15 knockdown significantly inhibited the invasion and migration of SW1990 and BxPC-3 cells (p<0.01, Fig. 2F). Shortly, RBM15 knockdown inhibits PC cell growth.
Fig. 2.
RBM15 knockdown inhibits proliferation, invasion, and migration of PC cells. RBM15 siRNAs (si-RBM15#1,2,3) were transfected into SW1990 and BxPC-3 cells, with si-NC as a control. (A) RT-qPCR to detect the mRNA level of RBM15; si-RBM15#3 with better transfection efficiency was selected for subsequent detection. (B) Western blot to detect the protein expression of RBM15 in cells. (C, D) CCK-8 assay to detect cell proliferation. (E) Clone formation assay to detect cell proliferation. (F) Transwell assay to detect cell invasion and migration. Three biological replicate assays were performed in cells, and data were expressed as mean ± standard deviation. Two-way ANOVA was used to compare data between multiple groups, followed by Tukey’s post hoc test. (A) **p<0.01 vs. si-NC; others: **p<0.01.
RBM15-mediated m6A modification upregulates LINC01320 expression in PC by stabilizing LINC01320
We found that m6A levels were significantly increased in cancer tissues (p<0.01, Fig. 3A). Meanwhile, m6A levels were also increased in PC cells (p<0.01, Fig. 3B). However, m6A levels were decreased after RBM15 knockdown (p<0.01, Fig. 3C). m6A modification is present on LINC01320 and LINC01320 is highly expressed in PC (Hu and Ji, 2021; Meng et al., 2021). We speculate that RBM15 may affect LINC01320 expression through m6A modification. Firstly, the RIP results showed significantly enriched RBM15 on LINC01320 (p<0.01, Fig. 3D). MeRIP assay showed higher m6A enrichment on LINC01320 than IgG (p<0.01, Fig. 3E), indicating that RBM15 was involved in m6A modification of LINC01320. Moreover, knockdown of RBM15 reduced m6A enrichment on LINC01320 (p<0.01, Fig. 3E). In addition, knockdown of RBM15 decreased LINC01320 RNA stability (p<0.01, Fig. 3F). Compared with adjacent tissues, the expression of LINC01320 was significantly increased in cancer tissues (p<0.01, Fig. 3G). LINC01320 was highly expressed in PC cells compared with HPDE6C7 cells (p<0.01, Fig. 3H). After knockdown of RBM15, the expression of LINC01320 in PC cells was decreased (p<0.01, Fig. 3I). Moreover, RBM15 mRNA level was positively correlated with LINC01320 expression in cancer tissues (p<0.01, Fig. 3J). Taken together, RBM15 upregulates LINC01320 expression in PC by increasing LINC01320 stability through m6A modification.
Fig. 3.
RBM15 increases LINC01320 stability by m6A modification and upregulates LINC01320 expression in PC. (A) m6A quantitative analysis to detect m6A levels in tissues (N=60, with the adjacent tissue as negative control). (B) m6A quantitative analysis to detect m6A levels in cells (with HPDE6C7 cells as negative control). (C) m6A quantitative analysis to detect m6A levels in cells (with si-NC as negative control). (D) RIP analysis of RBM15 enrichment on LINC01320 (with IgG as negative control). (E) MeRIP analysis of m6A enrichment on LINC01320 (with IgG as negative control for m6A, with si-NC as negative control for si-RBM15). (F) RNA stability assay to analyze the stability of LINC01320 (with si-NC as negative control). (G) RT-qPCR to detect LINC01320 expression in tissues (N= 60, with adjacent tissue as negative control). (H) RT-qPCR to detect LINC01320 expression in cells (with HPDE6C7 cells as negative control). (I) RT-qPCR to detect LINC01320 expression in cells (with si-NC as negative control). (J) The correlation between RBM15 mRNA level and LINC01320 expression in cancer tissues (N=60) was analyzed by Pearson correlation. Three biological replicate assays were performed in cells, and data were expressed as mean ± standard deviation; t-test was used for data comparisons in panels (A) and (G); one-way ANOVA was used for data comparisons between multiple groups in panels (B) and (H), and two-way ANOVA was used for data comparisons between multiple groups in panels (C-F) and (I), followed by Tukey’s post hoc test. (H) **p<0.01 vs. HPDE6C7 cells; others: **p<0.01.
LINC01320 upregulates FBXO11 transcription by competitively binding to miR-1287-5p
To explore the downstream mechanism of LINC01320, we predicted through IncLocator database and found that LINC01320 was mainly localized in the cytoplasm (Fig. 4A), and our experimental results also showed that LINC01320 was localized in the cytoplasm of PC cells (p<0.01, Fig. 4B), suggesting that LINC01320 may act through ceRNA mechanism. We then predicted the miRNAs downstream of LINC01320 by DIANA database and RNA22 database (Fig. 4C), in which miR-1287-5p expression was reduced in PC (Zhang et al., 2020a). The target genes downstream of miR-1287-5p were predicted by Starbase, Targetscan, miRDB, RNA22, and miRWalk (Fig. 4D), in which FBXO11 expression was increased in PC (Xue et al., 2022). Therefore, we speculated the existence of ceRNA between LINC01320-miR-1287-5p-FBXO11. First, RIP results showed that AGO2 could be pulled down to LINC01320 and miR-1287-5p (p<0.01, Fig. 4E). According to the site in Fig. 4F, we designed dual-luciferase assay, and the results showed that there was a target binding between LINC01320 and miR-1287-5p (p<0.01, Fig. 4G). Similarly, the target binding between miR-1287-5p and FBXO11 was also verified (p<0.01, Fig. 4F, 4G). Next, we found that the expression of miR-1287-5p was decreased and the mRNA level of FBXO11 was increased in PC tissues (p<0.01, Fig. 4H, 4I). Compared with HPDE6C7 cells, the expression of miR-1287-5p was decreased and the mRNA level of FBXO11 was increased in PC cells (p<0.01, Fig. 4J, 4K). In addition, knockdown of RBM15 significantly elevated the expression of miR-1287-5p but diminished the mRNA level of FBXO11 in PC cells (p<0.01, Fig. 4L). Moreover, RBM15 mRNA level and LINC01320 expression were negatively correlated with miR-1287-5p expression in cancer tissues, but positively correlated with FBXO11 mRNA level; miR-1287-5p expression was negatively correlated with FBXO11 mRNA level (p<0.01, Fig. 4M). Shortly, LINC01320 upregulated FBXO11 transcription by competitively binding to miR-1287-5p.
Fig. 4.
LINC01320 upregulates the transcriptional level of FBXO11 by competitively binding to miR-1287-5p. (A) IncLocator database prediction of the subcellular localization of LINC01320. (B) Fractionation of nuclear and cytoplasmic RNA to detect the subcellular localization of LINC01320 (U6 as a reference for the nuclear and GAPDH as a reference for the cytoplasm). (C) Database prediction of the downstream factors of LINC01320 and intersection. (D) Database prediction of the downstream factors of miR-1287-5p and intersection. (E) RIP analysis of the binding between LINC01320 and miR-1287-5p (with IgG as negative control). (F) The binding site between LINC01320 and miR-1287-5p, and the binding site between miR-1287-5p and FBXO11. (G) Dual-luciferase analysis of the binding LINC01320 to miR-1287-5p and the binding of miR-1287-5p to FBXO11 (with NC as the control). (H, I) RT-qPCR to detect the expression of miR-1287-5p and FBXO11 in tissues (N=60, with adjacent tissues as negative control). (J, K) RT-qPCR to detect the expression of miR-1287-5p and FBXO11 in cells (with HPDE6C7 cells as negative control). (L) RT-qPCR to detect the expression of miR-1287-5p and FBXO11 in cells (with si-NC as negative control). (M) The correlation between various factors in cancer tissues (N=60) was analyzed by Person correlation. Three biological replicates were performed in cells, and data were expressed as mean ± standard deviation; t-test was used for data comparisons between two groups in panels (H, I); one-way ANOVA was used for data comparisons between multiple groups in panels (J, K), and two-way ANOVA was used for data comparisons between multiple groups in panels (B), (E), (G), and (L), followed by Tukey’s post hoc test. (I, K) **p<0.01 vs. HPDE6C7 cells; others: *p<0.05, **p<0.01.
Overexpression of LINC01320 partially nullifies the inhibition of RBM15 downregulation on PC cells
We verified the effect of LINC01320 in PC cells by upregulating its level in SW1990 cells (p<0.01, Fig. 5A). Overexpression of LINC01320 was followed by decreased expression of miR-1287-5p and increased mRNA levels of FBXO11 (p<0.01, Fig. 5B, 5C). Upregulation of LINC01320 notably promoted the proliferation of SW1990 cells (p<0.05, Fig. 5D) and increased the colonies (p<0.05, Fig. 5E), as well as increased cell invasion and migration (p<0.05, Fig. 5F). Overall, overexpression of LINC01320 partially nullifies the inhibitory effect of RBM15 knockdown on PC cells via the miR-1287-5p/FBXO11 axis.
Fig. 5.
Overexpression of LINC01320 partially nullifies the inhibitory effect of RBM15 knockdown on PC cells. LINC01320 pcDNA3.1 vector (LINC01320) was transfected into SW1990 cells, with the transfected NC as a negative control, and si-NC was used as a negative control for si-RBM15. (A) RT-qPCR to detect the expression of LINC01320. (B, C) RT-qPCR to detect the expression of miR-1287-5p and FBXO11 in cells. (D) CCK-8 assay to detect cell proliferation. (E) clone formation assay to detect cell proliferation. (F) Transwell assays to detect cell invasion and migration. Three biological replicates were performed in cells, and data were expressed as mean ± standard deviation; t-test was used for data comparisons between two groups in panel (A); one-way ANOVA was used for data comparisons between multiple groups in panels (B, C) and (E, F), and two-way ANOVA was used for data comparisons between multiple groups in panel (D), followed by Tukey’s post hoc test. *p<0.05, **p<0.01.
Overexpression of FBXO11 partially nullifies the inhibition of RBM15 downregulation on PC cells
To verify the effect of FBXO11 on PC cells, we upregulated the intracellular FBXO11 mRNA level by transfecting FBXO11 (p<0.01, Fig. 6A) and co-treated with si-RBM15, and found that the protein level of FBXO11 was also increased (p<0.01, Fig. 6B). Upregulation of FBXO11 notably promoted the proliferation of SW1990 cells (p<0.05, Fig. 6C, 6D) and enhanced invasion and migration (p<0.05, Fig. 6E). Altogether, overexpression of FBXO11 partially abates the inhibitory effect of RBM15 knockdown on PC cells.
Fig. 6.
Overexpression of FBXO11 partially abates the inhibitory effect of RBM15 knockdown on PC cells. FBXO11 pcDNA3.1 vector (FBXO11) was transfected into SW1990 cells, with the transfected NC as a negative control, and si-NC was used as a negative control for si-RBM15. (A) RT-qPCR to detect the mRNA level of FBXO11, cells were co-treated with si-RBM15. (B) Western blot to detect the protein expression of FBXO11. (C) CCK-8 assay to detect cell proliferation. (D) Clone formation assay to detect cell proliferation. (E) Transwell assay to detect cell invasion and migration. Three biological replicate assays were performed, and data were expressed as mean ± standard deviation. t-test was used for data comparisons between two groups in panel (A); one-way ANOVA was used for data comparisons between multiple groups in panels (B) and (D, E), and two-way ANOVA was used for data comparison between multiple groups in panel (C), followed by Tukey’s post hoc test. ns p>0.05, *p<0.05, **p<0.01.
RBM15 downregulation inhibits PC progression via the LINC01320/miR-1287-5p/FBXO11 axis
The transplantation tumor results showed that RBM15 knockdown led to decreases in tumor volume (p<0.01, Fig. 7A) and weight (p<0.01, Fig. 7A, 7B). After downregulation of RBM15, the Ki67 positivity in tumor tissues was decreased (p<0.01, Fig. 7C). Compared with the sh-NC group, m6A level (p<0.01, Fig. 7D) and RBM15 expression (p<0.01, Fig. 7E, 7F) were decreased in tumor tissues of the sh-RBM15 group; LINC01320 (p<0.01, Fig. 7G) and FBXO11 (p<0.01, Fig. 7F, 7H) were decreased; miR-1287-5p was increased (p<0.01, Fig. 7I). Taken together, RBM15-mediated m6A modification increases LINC01320 expression, which in turn promotes PC growth in vivo via the miR-1287-5p/FBXO11 axis.
Fig. 7.
Knockdown of RBM15 inhibits PC development in vivo via the LINC01320/miR-1287-5p/FBXO11 axis. A nude mouse transplantation tumor model was established with sh-RBM15-infected SW1990 cells, with SW1990 cells infected with sh-NC as negative control. (A) Volume of tumors. (B) Photos of tumors stripped after euthanasia of nude mice on day 29, and weight of tumors. (C) Immunohistochemical detection of Ki67-positive rate in tumor tissues. (D) m6A quantitative analysis of m6A levels in tissues. (E) RT-qPCR to detect the mRNA level of RBM15. (F) Western blot to detect protein expression of RBM15 and FBXO11. (G-I) RT-qPCR to detect the expression of LINC01320, FBXO11, and miR-1287-5p in tumor tissues. N=6, three biological replicates were performed, and data were expressed as mean ± standard deviation; data comparisons between two groups in panels (B-E) and (G-I) were conducted by t test, and two-way ANOVA was used to compare data between multiple groups in panels (A) and (F), followed by Tukey’s post hoc test. **p<0.01.
DISCUSSION
It’s estimated that the incidence of and mortality from PC will continue to rise over the coming years, whereas breakthroughs in early detection and treatment are still lacking (Andersson et al., 2022). The abnormal expression levels of m6A regulators and m6A-modified genes play essential roles in PC progression (Hu et al., 2022). RBM15 is an m6A modulator that is differentially expressed in 18 cancer types, and the higher its expression, the higher the degree of tumor stem cells (Li et al., 2021a). Furthermore, RBM15 has a close association with pancreatic adenocarcinoma at a late stage (Zhang et al., 2022). The current study revealed that RBM15 is highly expressed in PC cells. In our study, the mechanism of RBM15 in PC cells has been demonstrated for the first time. In brief, RBM15-mediated m6A modification increases LINC01320 stability and upregulates LINC01320, which competitively binds to miR-1287-5p and thus increases FBXO11 transcription, finally contributing to PC cell growth (Fig. 8).
Fig. 8.
RBM15-mediated m6A modification is involved in the proliferation, invasion and migration of PC cells. RBM15-mediated m6A modification can increase the stability of LINC01320 and promote its expression, thus up-regulating FBXO11 transcription by competitive binding to miR-1287-5p, and ultimately promoting the proliferation, invasion and migration of PC cells.
RBM15 mRNA is abnormally expressed in human pancreatic adenocarcinoma and downregulation of RBM15 plays an inhibitory role in PC cell proliferation (Zhao et al., 2022). Consistently, our results demonstrated the same high expression of RBM15 in PC tissues and cells. What’s more, our results evinced that the abilities of PC cells to proliferate, invade, migrate, and colony formation were weakened after silencing RBM15, and downregulation of RBM15 reduced the volume and weight of tumors in nude mice, which provided support to the previous finding that RBM15 reinforces the proliferative, migratory and invasive abilities of PC cell lines (Dong et al., 2023).
RBM15 is a key regulatory factor of m6A modification (Wang et al., 2021). In PC cells in vitro and tumor tissues in vivo, the augmented m6A levels were reduced after silencing RBM15. The RBM15-WTAP interaction is possibly important in the methylation of lncRNA in macrophage M1 (Li et al., 2022). LINC01320 shows high expression in PC and its m6A modification can be regulated by METTL14, one of the writers of m6A methyltransferase like RBM15, which induces LINC01320 upregulation in gastric cancer (Hu and Ji, 2021; Meng et al., 2021; Zhou et al., 2021). Our results presented RBM15 enrichment in LINC01320, and RBM15 participated in the m6A methylation of LINC01320. Past research confirms that UBA6-AS1-RBM15-mediated m6A modification of UBA6 mRNA increases the stability of UBA6 mRNA, and RBM15 knockdown abolishes the UBA6-AS1-mediated UBA6 upregulation and reverses the stability of UBA6 mRNA (Wang and Chen, 2022). Our results indicated that silencing RBM15 reduced m6A enrichment, the RNA stability of LINC01320, and its expression in PC cells. Presumptively, RBM15 upregulates LINC01320 in PC by increasing LINC01320 stability via m6A modification. Furthermore, our results showed increased PC cell growth after LINC01320 overexpression, which was consistent with the previous finding elucidating the suppressive action of LINC01320 knockout on PC cell growth (Meng et al., 2021).
There is evidence for ceRNA in some species and contexts and including various RNA species such as lincRNAs (Karreth and Pandolfi, 2013). The ceRNA hypothesis is that specific RNAs impair miRNA activity through sequestration, therefore upregulating miRNA target gene expression, and lncRNAs are extensively reported as functional ceRNAs (Qi et al., 2015). Our results first ascertained that LINC01320 might function as a ceRNA. Existing evidence suggests that LINC01320 binds to miR-495-5p in gastric cancer (Hu and Ji, 2021). Through prediction on databases, among the downstream miRNAs of LINC01320, miR-1287-5p is weakly expressed in PC (Zhang et al., 2020a). FBXO11, the predicted target of miR-1287-5p, is closely associated with poor PC survival (Mann et al., 2012). The binding of LINC01320 to miR-1287-5p and the targeted binding of miR-1287-5p to FBXO11 were validated. Moreover, miR-1287-5p downregulation and FBXO11 mRNA upregulation were observed in PC, and LINC01320 overexpression led to a decrease in miR-1287-5p expression and an increment in FBXO11 mRNA expression. LINC01436 stimulates proliferation and metastasis of gastric cancer cells by regulating miR-585 and FBOX11 (Zhang et al., 2020b). Collectively, LINC01320 increases FBXO11 transcription levels by competitively binding to miR-1287-5p. Furthermore, RBM15 knockdown upregulated miR-1287-5p and decreased LINC01320 expression and FBXO11 mRNA expression, while FBXO11 overexpression invalidated the effect of silencing RBM15 on suppressing PC cells, which paralleled the previous finding that FBXO11 induces PC progression and FBXO11 depletion inhibits malignant biological behaviors of PC cells (Xue et al., 2022).
In summary, RBM15-mediated m6A modification increases the stability and expression of LINC01320, which competitively binds to miR-1287-5p to upregulate FBXO11 transcription, and thus potentiates PC cell growth.
Still, there are several limitations to consider. First, the clinical sample size is small and may not be universally representative. Second, our study focused on one single mechanism. The expression and function of other miRNAs downstream of LINC01320 haven’t been explored. Also, the effects of many other mRNAs of miR-1287-5p require to be further explored, and to test whether RBM15 directly regulates miR-1287-5p is also one of our future research plans. Our study is still in the preliminary validation stage for a ceRNA mechanism between LINC01320 and FBXO11 for miR-1287-5p. More experiments are needed to comprehensively support this ceRNA mechanism. Third, the rescue experiment for miR-1287-5p is not included in the present study. Fourth, the functional mechanism was only verified at the cellular level, and the effects of RBM15 on PC cell proliferation were investigated by in vivo assays only. Next, the protein expression of FBXO11 was not monitored. Last but not least, the expression and functional mechanism of RBM15 need to be validated at clinical and animal levels. Hence, the focus of future research shall include the downstream mechanisms and functions of RBM15/FBOX11, the protein expression of FBXO11, and the in vivo verification of the obtained results, all of which are beneficial to offering new theoretical reference for PC management.
In the future, we will collect more clinical samples and tested more related factors to improve the reliability and accuracy of clinical detection, hoping that RBM15 and other factors can become auxiliary diagnostic tools in gene detection and provide a new theoretical basis for the subsequent development of targeted drugs. We will also verify our mechanism in multiple cell lines.
ACKNOWLEDGMENTS
Not applicable.
Footnotes
CONFLICT OF INTEREST
The authors have no relevant financial or non-financial interests to disclose.
REFERENCES
- Agarwal V., Bell G. W., Nam J. W., Bartel D. P. Predicting effective microRNA target sites in mammalian mRNAs. Elife. 2015;4:e05005. doi: 10.7554/eLife.05005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Andersson R., Haglund C., Seppanen H., Ansari D. Pancreatic cancer - the past, the present, and the future. Scand. J. Gastroenterol. 2022;57:1169–1177. doi: 10.1080/00365521.2022.2067786. [DOI] [PubMed] [Google Scholar]
- Beni F. A., Kazemi M., Dianat-Moghadam H., Behjati M. MicroRNAs regulating Wnt signaling pathway in colorectal cancer: biological implications and clinical potentials. Funct. Integr. Genomics. 2022;22:1073–1088. doi: 10.1007/s10142-022-00908-x. [DOI] [PubMed] [Google Scholar]
- Cao Z., Pan X., Yang Y., Huang Y., Shen H. B. ThelncLocator: a subcellular localization predictor for long non-coding RNAs based on a stacked ensemble classifier. Bioinformatics. 2018;34:2185–2194. doi: 10.1093/bioinformatics/bty085. [DOI] [PubMed] [Google Scholar]
- Chan J. J., Tay Y. Noncoding RNA:RNA regulatory networks in cancer. Int. J. Mol. Sci. 2018;19:1310. doi: 10.3390/ijms19051310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen S., Ren H., Zhang X., Chang L., Wang Z., Wu H., Zhang J., Ren J., Zhou L. Research advances of N6-methyladenosine in diagnosis and therapy of pancreatic cancer. J. Clin. Lab. Anal. 2022;36:e24611. doi: 10.1002/jcla.24611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen Y., Wang X. miRDB: an online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020;48:D127–D131. doi: 10.1093/nar/gkz757. [DOI] [PMC free article] [PubMed] [Google Scholar]
- de Rooij L. A., Mastebroek D. J., Ten Voorde N., van der Wall E., van Diest P. J., Moelans C. B. The microRNA lifecycle in health and cancer. Cancers (Basel) 2022;14:5748. doi: 10.3390/cancers14235748. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dong H., Zhang H., Mao X., Liu S., Xu W., Zhang Y. RBM15 promates the proliferation, migration and invasion of pancreatic cancer cell lines. Cancers (Basel) 2023;15:1084. doi: 10.3390/cancers15041084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu N., Ji H. N6-methyladenosine (m6A)-mediated up-regulation of long noncoding RNA LINC01320 promotes the proliferation, migration, and invasion of gastric cancer via miR495-5p/RAB19 axis. Bioengineered. 2021;12:4081–4091. doi: 10.1080/21655979.2021.1953210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu X., Lei X., Guo J., Fu W., Sun W., Lu Q., Su W., Xu Q., Tu K. The emerging role of RNA N6-methyladenosine modification in pancreatic cancer. Front. Oncol. 2022;12:927640. doi: 10.3389/fonc.2022.927640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang H., Wei Y., Yao H., Chen M., Sun J. Construction of a pancreatic cancer prediction model for oxidative stress-related lncRNA. Funct. Integr. Genomics. 2023;23:118. doi: 10.1007/s10142-023-01048-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Karagkouni D., Paraskevopoulou M. D., Tastsoglou S., Skoufos G., Karavangeli A., Pierros V., Zacharopoulou E., Hatzigeorgiou A. G. DIANA-LncBase v3: indexing experimentally supported miRNA targets on non-coding transcripts. Nucleic Acids Res. 2020;48:D101–D110. doi: 10.1093/nar/gkz1036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Karreth F. A., Pandolfi P. P. ceRNA cross-talk in cancer: when ce-bling rivalries go awry. Cancer Discov. 2013;3:1113–1121. doi: 10.1158/2159-8290.CD-13-0202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klein A. P. Pancreatic cancer epidemiology: understanding the role of lifestyle and inherited risk factors. Nat. Rev. Gastroenterol. Hepatol. 2021;18:493–502. doi: 10.1038/s41575-021-00457-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li C., Su F., Liang Z., Zhang L., Liu F., Fan W., Li Z. Macrophage M1 regulatory diabetic nephropathy is mediated by m6A methylation modification of lncRNA expression. Mol. Immunol. 2022;144:16–25. doi: 10.1016/j.molimm.2022.02.008. [DOI] [PubMed] [Google Scholar]
- Li J. H., Liu S., Zhou H., Qu L. H., Yang J. H. starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res. 2014;42:D92–D97. doi: 10.1093/nar/gkt1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li R., Yin Y. H., Ji X. L., Liu X., Li J. P., Qu Y. Q. Pan-cancer prognostic, immunity, stemness, and anticancer drug sensitivity characterization of N6-methyladenosine RNA modification regulators in human cancers. Front. Mol. Biosci. 2021a;8:644620. doi: 10.3389/fmolb.2021.644620. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Z., Guo Q., Zhang J., Fu Z., Wang Y., Wang T., Tang J. The RNA-binding motif protein family in cancer: friend or foe? Front. Oncol. 2021b;11:757135. doi: 10.3389/fonc.2021.757135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Livak K. J., Schmittgen T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- Loveday B. P. T., Lipton L., Thomson B. N. Pancreatic cancer: an update on diagnosis and management. Aust. J. Gen. Pract. 2019;48:826–831. doi: 10.31128/AJGP-06-19-4957. [DOI] [PubMed] [Google Scholar]
- Lu J., Tan J., Yu X. A prognostic model based on tumor microenvironment-related lncRNAs predicts therapy response in pancreatic cancer. Funct. Integr. Genomics. 2023;23:32. doi: 10.1007/s10142-023-00964-x. [DOI] [PubMed] [Google Scholar]
- Mann K. M., Ward J. M., Yew C. C., Kovochich A., Dawson D. W., Black M. A., Brett B. T., Sheetz T. E., Dupuy A. J. Australian Pancreatic Cancer Genome Initiative, author; Chang, D. K., Biankin, A. V., Waddell, N., Kassahn, K. S., Grimmond, S. M., Rust, A. G., Adams, D. J., Jenkins, N. A., Copeland, N. G., author Sleeping Beauty mutagenesis reveals cooperating mutations and pathways in pancreatic adenocarcinoma. Proc. Natl. Acad. Sci. U. S. A. 2012;109:5934–5941. doi: 10.1073/pnas.1202490109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McGuigan A., Kelly P., Turkington R. C., Jones C., Coleman H. G., McCain R. S. Pancreatic cancer: a review of clinical diagnosis, epidemiology, treatment and outcomes. World J. Gastroenterol. 2018;24:4846–4861. doi: 10.3748/wjg.v24.i43.4846. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meng H., Guo K., Zhang Y. Effects of lncRNA LINC01320 on proliferation and migration of pancreatic cancer cells through targeted regulation of miR-324-3p. J. Healthc. Eng. 2021;2021:4125432. doi: 10.1155/2021/4125432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miranda K. C., Huynh T., Tay Y., Ang Y. S., Tam W. L., Thomson A. M., Lim B., Rigoutsos I. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell. 2006;126:1203–1217. doi: 10.1016/j.cell.2006.07.031. [DOI] [PubMed] [Google Scholar]
- National Research Council (US) (2011) Guide for the Care and Use of Laboratory Animals. 8th ed. Washington (DC). doi: 10.17226/12910. 10.17226/12910 [DOI]
- Pereira B., Billaud M., Almeida R. RNA-binding proteins in cancer: old players and new actors. Trends Cancer. 2017;3:506–528. doi: 10.1016/j.trecan.2017.05.003. [DOI] [PubMed] [Google Scholar]
- Qi X., Zhang D. H., Wu N., Xiao J. H., Wang X., Ma W. ceRNA in cancer: possible functions and clinical implications. J. Med. Genet. 2015;52:710–718. doi: 10.1136/jmedgenet-2015-103334. [DOI] [PubMed] [Google Scholar]
- Ransohoff J. D., Wei Y., Khavari P. A. The functions and unique features of long intergenic non-coding RNA. Nat. Rev. Mol. Cell Biol. 2018;19:143–157. doi: 10.1038/nrm.2017.104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sticht C., De La Torre C., Parveen A., Gretz N. miRWalk: an online resource for prediction of microRNA binding sites. PLoS One. 2018;13:e0206239. doi: 10.1371/journal.pone.0206239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tang Z., Li C., Kang B., Gao G., Li C., Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017;45:W98–W102. doi: 10.1093/nar/gkx247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang L., Tang Y. N6-methyladenosine (m6A) in cancer stem cell: from molecular mechanisms to therapeutic implications. Biomed. Pharmacother. 2023;163:114846. doi: 10.1016/j.biopha.2023.114846. [DOI] [PubMed] [Google Scholar]
- Wang X., Tian L., Li Y., Wang J., Yan B., Yang L., Li Q., Zhao R., Liu M., Wang P., Sun Y. RBM15 facilitates laryngeal squamous cell carcinoma progression by regulating TMBIM6 stability through IGF2BP3 dependent. J. Exp. Clin. Cancer Res. 2021;40:80. doi: 10.1186/s13046-021-01871-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y., Chen Z. Long noncoding RNA UBA6-AS1 inhibits the malignancy of ovarian cancer cells via suppressing the decay of UBA6 mRNA. Bioengineered. 2022;13:178–189. doi: 10.1080/21655979.2021.2011640. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Wood L. D., Canto M. I., Jaffee E. M., Simeone D. M. Pancreatic cancer: pathogenesis, screening, diagnosis, and treatment. Gastroenterology. 2022;163:386–402.e1. doi: 10.1053/j.gastro.2022.03.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xie M., Ma T., Xue J., Ma H., Sun M., Zhang Z., Liu M., Liu Y., Ju S., Wang Z., De W. The long intergenic non-protein coding RNA 707 promotes proliferation and metastasis of gastric cancer by interacting with mRNA stabilizing protein HuR. Cancer Lett. 2019;443:67–79. doi: 10.1016/j.canlet.2018.11.032. [DOI] [PubMed] [Google Scholar]
- Xue J., Chen S., Ge D., Yuan X. Ultrasound-targeted microbubble destruction-mediated silencing of FBXO11 suppresses development of pancreatic cancer. Hum. Cell. 2022;35:1174–1191. doi: 10.1007/s13577-022-00700-w. [DOI] [PubMed] [Google Scholar]
- Yan L. R., Ding H. X., Shen S. X., Lu X. D., Yuan Y., Xu Q. Pepsinogen C expression-related lncRNA/circRNA/mRNA profile and its co-mediated ceRNA network in gastric cancer. Funct. Integr. Genomics. 2021;21:605–618. doi: 10.1007/s10142-021-00803-x. [DOI] [PubMed] [Google Scholar]
- Zhang L., Liu C., Zhang X., Wang C., Liu D. Breast cancer prognosis and immunological characteristics are predicted using the m6A/m5C/m1A/m7G-related long noncoding RNA signature. Funct. Integr. Genomics. 2023;23:117. doi: 10.1007/s10142-023-01026-y. [DOI] [PubMed] [Google Scholar]
- Zhang T., Sheng P., Jiang Y. m6A regulators are differently expressed and correlated with immune response of pancreatic adenocarcinoma. J. Cancer Res. Clin. Oncol. 2022;149:2805–2822. doi: 10.1007/s00432-022-04150-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang X., Xue C., Cui X., Zhou Z., Fu Y., Yin X., Wu S., Gong Y., Liu Y., Zhu C., Qin X. Circ_0075829 facilitates the progression of pancreatic carcinoma by sponging miR-1287-5p and activating LAMTOR3 signalling. J. Cell. Mol. Med. 2020a;24:14596–14607. doi: 10.1111/jcmm.16089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y., Yang G., He X., Chen S., Zhang F., Fang X. LINC01436, regulating miR-585 and FBXO11, is an oncogenic lncRNA in the progression of gastric cancer. Cell Biol. Int. 2020b;44:882–893. doi: 10.1002/cbin.11287. [DOI] [PubMed] [Google Scholar]
- Zhao Z., Ju Q., Ji J., Li Y., Zhao Y. N6-methyladenosine methylation regulator RBM15 is a potential prognostic biomarker and promotes cell proliferation in pancreatic adenocarcinoma. Front. Mol. Biosci. 2022;9:842833. doi: 10.3389/fmolb.2022.842833. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao Z., Liu W. Pancreatic cancer: a review of risk factors, diagnosis, and treatment. Technol. Cancer Res. Treat. 2020;19:1533033820962117. doi: 10.1177/1533033820962117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou H., Yin K., Zhang Y., Tian J., Wang S. The RNA m6A writer METTL14 in cancers: roles, structures, and applications. Biochim. Biophys. Acta Rev. Cancer. 2021;1876:188609. doi: 10.1016/j.bbcan.2021.188609. [DOI] [PubMed] [Google Scholar]








