Alterations in mitochondrial DNA copy number and oxidative stress markers in blood and muscle tissues of mice following snake envenomation

Abstract

Snake envenomation represents a significant toxicological and public health concern, causing systemic effects mediated by oxidative stress and cellular injury. Mitochondria are especially susceptible to stress generated by venom, however the initial mitochondrial responses after envenomation are not fully understood. This study investigated time- and tissue-dependent changes in relative mitochondrial DNA (mtDNA) abundance and oxidative stress markers in mice exposed to neurotoxic and hematotoxic snake venoms. Neurotoxic venoms included Naja kaouthia (monocled cobra), Ophiophagus hannah (king cobra), Bungarus fasciatus (banded krait), and Bungarus candidus (Malayan krait), while hematotoxic venoms comprised Calloselasma rhodostoma (Malayan pit viper), Daboia siamensis (Siamese Russell’s viper), and Trimeresurus albolabris (white-lipped pit viper). Venoms were administered intramuscularly at empirically determined sublethal doses. Whole blood, tibialis anterior muscle tissue, and mononuclear cells (MNCs) were collected at 1, 6, and 24 hours post-exposure. Relative mtDNA copy number was quantified using SYBR-based real-time quantitative PCR targeting mtDNA-encoded genes (16S rRNA and ND1) normalized to a nuclear reference gene, with additional assessment of cytochrome b (Cytb) and cytochrome c oxidase subunit III (COXIII) as indicators of mitochondrial perturbation. Oxidative stress responses were evaluated by measuring malondialdehyde (MDA) and reduced glutathione (GSH) levels. Venom exposure induced distinct temporal and tissue-specific patterns of mtDNA-associated changes, accompanied by alterations in lipid peroxidation and antioxidant status. Whole blood consistently exhibited earlier and more robust responses than muscle tissue or MNCs. Although mtDNA-related parameters and oxidative stress markers are not specific to envenomation, their combined temporal profiles reflect venom-induced mitochondrial and redox stress. These findings support the potential utility of blood-based mtDNA and oxidative indicators as sensitive, venom-independent tools for evaluating systemic responses to snake envenomation.

Introduction

Accurate diagnosis and effective treatment of snakebite envenomation rely heavily on detecting snake venom and examining the host's immunological response. Enzyme-linked immunosorbent assays (ELISA) remain the most widely used method for venom detection and antibody quantification due to their simplicity, sensitivity, and specificity in both clinical and research settings. Molecular diagnostic approaches, including polymerase chain reaction (PCR), have also been applied to identify snake species from DNA recovered from skin swabs, saliva, or dried venom at bite sites. However, these approaches often require sufficient amounts of venom-derived material, which may not always be available. Routine first aid practices, such as washing or cleaning the wound, can further reduce the recoverable venom load. These limitations emphasize the need for diagnostic strategies that do not rely solely on the direct detection of venom [1, 2, 3, 4].

In parallel with serological and molecular approaches, quantitative PCR (qPCR) has emerged as a versatile analytical tool for examining cellular responses to toxic injury. Although qPCR is widely used for gene expression analysis, SYBR-based qPCR can also be applied to quantify DNA abundance within biological samples. This capability enables the measurement of mitochondrial DNA (mtDNA) copy number and mtDNA/nDNA ratios in blood and tissues, providing a sensitive readout of mitochondrial perturbation. Such applications expand the utility of qPCR beyond transcriptional profiling and offer a practical approach for detecting early mitochondrial responses to toxic exposures or animal envenomation [5, 6].

Mitochondrial DNA has gained increasing attention as a biological indicator because mitochondrial disturbances occur rapidly in response to cellular stress. Mitochondria play essential roles in energy metabolism, redox regulation, and cell survival, and their function is tightly coupled to oxidative homeostasis. Excessive production of reactive oxygen species (ROS) can influence mitochondrial turnover, biogenesis, and degradation, resulting in measurable alterations in mtDNA content. Consequently, mtDNA-associated parameters have become relevant biomarkers in toxicology and stress physiology research [7, 8].

Although mitochondrial alterations have been documented in various toxin-exposure models, parameters such as changes in mtDNA copy number, the relative abundance of specific mtDNA regions, and other putative indicators of mitochondrial dysfunction do not represent direct evidence of mtDNA damage [9]. Rather, these measurements reflect secondary mitochondrial responses to stress, altered bioenergetic demand, or shifts in mitochondrial turnover. Importantly, these mtDNA-associated changes may respond rapidly to venom-induced systemic disturbances. Their sensitivity to oxidative imbalance and tissue injury suggests that mtDNA-related parameters may serve as practical, venom-independent biomarkers for venom intoxication, particularly in situations where conventional venom detection is limited or not feasible [10, 11, 12, 13]. Despite growing interest in mitochondrial biomarkers, few studies have examined mtDNA-associated responses following snake envenomation, and most have focused on isolated mitochondrial proteins or transcripts within limited post-exposure windows. Research investigating early, tissue-specific alterations in mtDNA/nDNA ratios and oxidative stress markers following venom exposure remains limited [14].

Therefore, the objective of this study was to investigate temporal changes in mtDNA copy number together with oxidative stress markers, including malondialdehyde (MDA) and reduced glutathione (GSH), in whole blood, tibialis anterior muscle, and mononuclear cells (MNCs) within 24 hours following exposure to neurotoxic and hematotoxic snake venoms. By characterizing these early mitochondrial and redox responses, this study aims to evaluate the potential of mtDNA-related parameters as supportive indicators of venom-induced cellular stress and to provide insights that may enhance early assessment and therapeutic monitoring in snakebite envenomation.

Materials and Methods

Snake Venoms and Animals

Seven species of venomous snakes were used in this study. The neurotoxic group included Naja kaouthia (NK; monocled cobra), Ophiophagus hannah (OH; king cobra), Bungarus fasciatus (BF; banded krait), and Bungarus candidus (BC; Malayan krait). The hematotoxic group consisted of Calloselasma rhodostoma (CR; Malayan pit viper), Daboia siamensis (DRS; Siamese Russell’s viper), and Trimeresurus albolabris (TA; white-lipped pit viper). The venom samples were crude, lyophilized whole venom and obtained from the Snake Farm, Queen Saovabha Memorial Institute, Thai Red Cross Society, Bangkok, Thailand. No fractionation or purification of individual toxin components was performed. The material represents the standard preparation obtained directly from freshly milked venom that is immediately lyophilized for use in antivenom production in horses.

Male ICR mice weighing 18–20 g was supplied by the Laboratory Animal Center, Mahidol University. The animals were housed under controlled conditions at 25°C with free access to food and water. All experimental procedures involving animals were conducted in accordance with the International Animal Welfare Recommendations and were approved by the Queen Saovabha Memorial Institute Animal Care and Use Committee (QSMI-ACUC-06-2020).

Lethality of Snake Venoms

Lyophilized snake venom was dissolved in normal saline solution (NSS) and sterilized by filtration through a 0.22 μm Millipore membrane filter prior to use. The median lethal dose (LD₅₀) of the seven snake venoms was determined by intravenous (IV) injection into ICR male mice (18–20 g, 3 weeks old, n = 5 per dosage). The survival rate of the mice was monitored for 24 hours following injection. The LD₅₀ values were then calculated using the Probit analysis method, which estimates the dose required to produce a 50% mortality rate in the test animals.

Mouse Injection and Sample Preparation

The intramuscular (IM) challenge doses used in this study were derived from the intravenous (IV) LD₅₀ values determined experimentally in the present study (see Lethality of Snake Venoms). These IV LD₅₀ values were used as reference points to generate a range of candidate IM doses expressed as multiples of the lethal dose (starting at 2×LD₅₀ and increasing stepwise according to venom toxicity). Because venom toxicity differs substantially between IV and IM routes of administration, the appropriate IM dose for each venom was determined empirically. Each candidate dose was injected IM into the right hind limb of ICR male mice (50 μL per mouse; 18–20 g, 3 weeks old, n = 5 per dosage), and survival was monitored for 24 hours. A dose was considered acceptable for subsequent experiments if at least three of the five mice survived the 24-hour observation period. To minimize mortality associated with the high toxicity of certain venoms, the final IM doses were selected to ensure complete survival over the 24-hour experimental period while still producing measurable biological effects. This screening ensured that the final IM doses represented sublethal but biologically active exposures.

Using these empirically determined IM doses for each venom, groups of 30–40 ICR male mice (50 μL per mouse; 18–20 g, 3 weeks old) were then injected intramuscularly in the right hind limb. After all injections were completed, sample collection was carried out at the predetermined time points. Specifically, at 1, 6, and 24 hours post-injection, approximately 10 mice were euthanized at each time point, and samples were obtained. Blood was collected into EDTA tubes for further analyses, and the tibialis anterior muscle from the injected limb was dissected and stored at −20 °C until further processing. The negative control group consisted of mice receiving intramuscular injections of normal saline instead of venom. These saline-injected mice served as “untreated” controls and were euthanized at the corresponding time points to provide time-matched baseline values for all comparisons. A positive control group received 40 μg rotenone and was processed following the same schedule.

Mitochondrial DNA Extraction

Mitochondrial DNA (mtDNA) was extracted from whole blood (WB), tibialis anterior muscle tissue, and isolated mononuclear cells (MNCs) using the GeneJET Genomic DNA Purification Kit (Thermo Scientific, USA), according to the manufacturer’s protocol. The concentration and purity of the extracted DNA were determined spectrophotometrically by measuring the absorbance at 260 nm and 280 nm, and the A260/A280 ratio was used to assess DNA quality.

Primer Design

Different target genes were selected to evaluate the relative copy numbers of mitochondrial DNA (mtDNA) and nuclear DNA (nDNA). Within the mouse mitochondrial genome, 16S ribosomal RNA (16S rRNA) and NADH dehydrogenase subunit 1 (ND1), which are located in stable regions that are not prone to large deletions, were chosen as representative mtDNA genes. Hexokinase 2 (HK2), a nuclear-encoded gene, was selected as a reference for nDNA quantification. Comparing the expression levels of 16S rRNA and ND1 relative to HK2 allows the calculation of the mtDNA-to-nDNA copy number ratio. Additionally, cytochrome b (Cytb) and cytochrome c oxidase subunit III (COXIII) were included as mitochondrial markers, while beta-2-microglobulin (B2M) was used as an additional nuclear DNA reference gene (Table 1).

Table 1.

Primer sequences used for DNA amplification of mitochondrial DNA (mtDNA) and nuclear DNA (nDNA)

Gene	Type	Nucleotide (5’ – 3’)	Tm (°C)	References
16S rRNA- F	mtDNA	5’ CCGCAAGGGAAAGATGAAAGAC 3’	60	AB092593
16S rRNA - R		5’ TCGTTTGGTTTCGGGGTTTC 3’
ND1 - F	mtDNA	5’ CTAGCAGAAACAAACCGGGC 3’	60	AB092592
ND1 - R		5’ CCGGCTGCGTATTCTACGTT 3’
Cytb - F	mtDNA	5’ TGATGAAACTTTGGGTCCCTTC 3’	52	MZ353141
Cytb - R		5’ ATAAGCCTCGTCCGACATGAA 3’
COXIII - F	mtDNA	5’ GTCCCACTACTTAATACTTC 3’	52	AB092593
COXIII - R		5’ GGTGAAGTAAAGTCCTAGT 3’
HK2 - F	nDNA	5’ GCCAGCCTCTCCTGATTTTAGTGT 3’	60	Y11668
HK2 - R		5’ GGGAACACAAAAGACCTCTTCTGG 3’
B2M - F	nDNA	5’ ACAGTTCCACCCGCCTCACATT 3’	52	NM009735
B2M - R		5’ TAGAAAGACCAGTCCTTGCTGAAG 3’

Real-Time Quantitative PCR (qPCR)

The relative copy numbers of mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were assessed using SYBR Green real-time quantitative PCR (qPCR) on a BioRad CFX96 Touch™ Real-Time PCR system. Amplification was performed with iTaq Universal SYBR Green Supermix (BioRad, CA, USA) according to the manufacturer’s instructions. DNA (20 ng/μL) was added to the reaction mixture, which also contained iTaq Universal SYBR Green Supermix, 10 pmol of each primer, and nuclease-free water. The thermal cycling conditions were as follows: initial denaturation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 10 seconds and 52°C for 30 seconds. A melting curve analysis was subsequently performed to verify product specificity. These involved heating the samples to 95°C for 10 seconds, followed by incremental increases of 0.5°C from 65°C to 95°C, with 5-second holds at each step.

To quantify mtDNA levels, mtDNA/nDNA ratios were calculated using two independent primer sets. The first set targeted 16S rRNA and ND1 for mtDNA, normalized to the nuclear reference gene HK2. These loci were selected because 16S rRNA and ND1 are part of the stable fraction of the mouse mitochondrial genome that is not prone to common deletions, making them reliable indicators of global mtDNA content. The second primer set quantified mitochondrial genes cytochrome b (Cytb) and cytochrome c oxidase subunit III (COXIII), normalized to beta-2-microglobulin (B2M) as the nuclear control. Including a second mtDNA/nDNA pair served to validate the results across distinct mitochondrial regions and reduce primer-dependent variability, thereby increasing the robustness of mtDNA quantification. Using two independent mtDNA loci minimizes locus-specific or primer-specific bias, and calculating mtDNA/nDNA ratios provides a sensitive measure of relative changes in mitochondrial DNA, serving as putative indicators of mitochondrial perturbation induced by snake venom.

Relative mtDNA copy number in whole blood, mononuclear cells (MNCs), and tibialis anterior muscle tissue was determined using the ΔΔCt method. The muscle was specifically selected because it is located in the right hind limb, the site of intramuscular venom administration, thus representing the most biologically relevant tissue for assessing early, localized mitochondrial responses to venom exposure. Measuring mtDNA directly at the injection site enables detection of acute, locally confined mitochondrial perturbations that may not be captured in systemic samples.

Activity of Lipid Peroxidation (MDA)

Malondialdehyde (MDA), an end product of lipid peroxidation, was measured in plasma and in tibialis anterior muscle tissue as a late biomarker of oxidative stress and cellular damage. For plasma, 100 μL of sample was mixed with 2 mL of a freshly prepared solution containing 0.37% thiobarbituric acid (TBA) in 0.25 N HCl and 15% trichloroacetic acid (TCA) in 0.25 N HCl (1:1), then boiled at 90°C for 10 minutes. After cooling to room temperature, the mixture was centrifuged at 12,000 rpm for 10 minutes, and the absorbance of the supernatant was measured at 532 nm. For tissue samples, approximately 0.1 g of muscle tissue was homogenized in Tris buffer (pH 7.4) containing 180 mM KCl, 10 mM EDTA, and 0.02% Butylated hydroxytoluene (BHT). The homogenate was centrifuged at 10,000 rpm for 10 minutes, and 100 μL of the resulting supernatant was processed using the same TBA/TCA method as described for plasma. Absorbance was measured at 532 nm to determine MDA levels in tissue samples [15].

Determination of Reduced Glutathione (GSH)

The levels of reduced glutathione (GSH) were measured using a colorimetric assay based on the DTNB (Ellman’s reagent) method, modified from Tipple and Rogers (2012) [16]. For plasma samples, 100 μL of mouse plasma was mixed with an equal volume of 20% trichloroacetic acid (TCA) containing 1 mM EDTA to precipitate proteins. For muscle tissue samples, approximately 0.1 g of tibialis anterior muscle was homogenized directly in an equal volume of 20% TCA containing 1 mM EDTA to ensure immediate protein precipitation and stabilization of reduced glutathione. All samples were incubated at room temperature for 5 minutes and centrifuged at 2,000 rpm for 10 minutes. Subsequently, 200 μL of each resulting supernatant was transferred to a fresh tube containing 1.8 mL of 0.1 mM 5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB) prepared in 0.1 M phosphate-buffered saline (PBS) with 1% sodium citrate. The absorbance was measured at 412 nm to quantify GSH levels.

Statistical Analysis

All experiments were performed using independent biological samples, with quantitative PCR measurements carried out in technical triplicates for each sample. Data are presented as mean ± standard deviation (SD). Differences among treatments, including snake venom types and time points, were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s honestly significant difference (HSD) post hoc test. Differences were considered statistically significant at P < 0.05.

Results

Snake venom lethality

The median lethal dose (LD₅₀), which represents the amount of venom required to kill 50% of a test population, varies considerably among different snake species. The LD₅₀ values obtained in mice (18–20 g body weight) are as follows: NK – 4.28 μg/mouse, OH – 36.76 μg/mouse, BF – 54.63 μg/mouse, BC – 1.22 μg/mouse, CR – 42.12 μg/mouse, DRS – 2.32 μg/mouse, TA – 5.60 μg/mouse, and rotenone – 7.00 μg/mouse.

Mouse injection

To obtain sublethal but biologically active exposure levels, intramuscular venom doses were selected based on the intravenous (IV) LD₅₀ values determined in the present study. The finalized IM doses, 1.3×LD₅₀ (NK), 1.5×LD₅₀ (OH), 2×LD₅₀ (BF), 1.5×LD₅₀ (BC), 5×LD₅₀ (CR), 7×LD₅₀ (DRS), 5×LD₅₀ (TA), and 5×LD₅₀ rotenone, supported complete survival over the 24-hour observation period while eliciting measurable biological responses. Mice injected with normal saline served as negative controls and showed no pathological signs throughout the experiment. All venom-treated groups exhibited 100% survival, with no severe manifestations such as respiratory distress, paralysis, or limb immobility. Only mild, transient behavioral changes were observed in some mice receiving CR, DRS, or TA, resolving within 1–2 hours. The absence of mortality or progressive clinical decline confirmed that these doses were suitable for detecting early molecular and biochemical changes without confounding systemic toxicity. These established doses therefore provided a consistent foundation for assessing venom-induced alterations in oxidative stress and mtDNA-related parameters in blood and tibialis anterior muscle across the 1-, 6-, and 24-hour time points.

Real-Time Quantitative PCR (qPCR)

Relative mitochondrial DNA (mtDNA) abundance was evaluated by quantifying the mtDNA-encoded genes 16S rRNA and ND1 normalized to the nuclear reference gene HK2 in whole blood (WB), tibialis anterior muscle tissue, and mononuclear cells (MNCs) following exposure to neurotoxic and hematotoxic snake venoms. These mtDNA/nDNA ratios were used as indicators of relative mtDNA copy number across tissues and time points.

In mice exposed to neurotoxic venoms, relative mtDNA levels in WB increased significantly at early time points (1–6 hours), as reflected by elevated 16S rRNA and ND1 signals compared with untreated controls. In contrast, muscle tissue exhibited a delayed increase in mtDNA abundance that became more apparent at 24 hours post-exposure. MNCs showed a distinct pattern, characterized by a reduction in relative mtDNA levels throughout the observation period. Following exposure to hematotoxic venoms, a pronounced increase in relative mtDNA abundance was observed in muscle tissue during the early phase (1–6 hours), exceeding the changes detected in WB at later time points (6–24 hours), particularly after CR and DRS envenomation. Similar to neurotoxic venoms, MNCs displayed decreased relative mtDNA levels after hematotoxic venom exposure loci (Fig 1 and Fig 2).

Figure 1.

Relative fold change of the 16S rRNA gene normalized to HK2 in WB, tissue, and MNCs from mice exposed to neurotoxic (A) and hematotoxic (B) snake venoms. Data are presented as mean ± SD (n = 10 per group per time point). Within each sample type, values at 1, 6, and 24 hours were compared with the 0-hour control. ^*P < 0.05 indicates statistical significance.

Figure 2.

Relative fold change of the ND1 gene normalized to HK2 in WB, tissue, and MNCs from mice exposed to neurotoxic (A) and hematotoxic (B) snake venoms. Data are presented as mean ± SD (n = 10 per group per time point). Within each sample type, values at 1, 6, and 24 hours were compared with the 0-hour control. ^*P < 0.05 indicates statistical significance.

Importantly, the temporal and tissue-specific patterns observed for 16S rRNA were consistently reproduced using ND1, supporting the robustness of mtDNA copy number assessment across independent mitochondrial. In addition to mtDNA copy number analysis, changes in the relative abundance of Cytb and COXIII were examined as supplementary indicators of mitochondrial perturbation following venom exposure. Increased Cytb and COXIII signals were detected in WB, muscle tissue, and MNCs after exposure to both neurotoxic and hematotoxic venoms. In WB and muscle tissue, elevations in Cytb and COXIII were evident within the 24-hour observation period and showed a gradual increase over time, whereas MNCs exhibited a delayed response, with more pronounced increases observed at 24 hours. Although alterations in Cytb and COXIII do not constitute direct evidence of mtDNA damage, their concurrent changes alongside shift in mtDNA copy number support the presence of venom-induced mitochondrial stress (Fig 3 and Fig 4). Notably, WB consistently demonstrated earlier and more pronounced mtDNA-associated responses compared with muscle tissue and MNCs, suggesting that WB may represent a practical and accessible matrix for monitoring venom-related mitochondrial perturbations.

Figure 3.

Relative fold change of the Cytb gene normalized to B2M in WB, tissue, and MNCs from mice exposed to neurotoxic (A) and hematotoxic (B) snake venoms. Data are presented as mean ± SD (n = 10 per group per time point). Within each sample type, values at 1, 6, and 24 hours were compared with the 0-hour control. ^*P < 0.05 indicates statistical significance.

Figure 4.

Relative fold change of the COXIII gene normalized to B2M in WB, tissue, and MNCs from mice exposed to neurotoxic (A) and hematotoxic (B) snake venoms. Data are presented as mean ± SD (n = 10 per group per time point). Within each sample type, values at 1, 6, and 24 hours were compared with the 0-hour control. ^*P < 0.05 indicates statistical significance.

Activity of Lipid Peroxidation (MDA)

Levels of malondialdehyde (MDA), a marker of lipid peroxidation, were measured in plasma and tibialis anterior muscle tissue following exposure to neurotoxic (Fig 5A) and hematotoxic (Fig 5B) snake venoms. In mice exposed to neurotoxic venoms, MDA levels were consistently higher in plasma than in muscle tissue, with concentrations increasing during the early phase (1–6 hours) and gradually declining thereafter.

Figure 5.

Activity of lipid peroxidation, measured as malondialdehyde (MDA), in plasma and tibialis anterior muscle tissue following exposure to neurotoxic (A) and hematotoxic (B) snake venoms. Data are presented as mean ± SD (n = 10 mice per group per time point). Within each sample type, values at 1, 6, and 24 hours were compared with the 0-hour control. ^*P < 0.05 indicates statistical significance.

In contrast, exposure to hematotoxic venoms resulted in a different temporal pattern. Significantly elevated MDA levels were observed in plasma at 24 hours post-exposure, whereas muscle tissue exhibited peak MDA levels at 6 hours. An exception was observed with Siamese Russell’s viper venom, in which MDA levels increased as early as 1 hour in both plasma and muscle tissue before gradually decreasing over time.

Determination of Reduced Glutathione (GSH)

Reduced glutathione (GSH) levels were assessed in plasma and tibialis anterior muscle tissue following exposure to neurotoxic (Fig 6A) and hematotoxic (Fig 6B) snake venoms. Mice exposed to both venom groups exhibited higher GSH levels in plasma compared with muscle tissue across the observation period. Peak plasma GSH levels were generally observed between 6 and 24 hours after envenomation, whereas changes in muscle tissue were less pronounced. These indicate a time-dependent alteration in systemic antioxidant status following snake venom exposure.

Figure 6.

Levels of reduced glutathione (GSH) in plasma and tibialis anterior muscle tissue following exposure to neurotoxic (A) and hematotoxic (B) snake venoms. Data are presented as mean ± SD (n = 10 mice per group per time point). Within each sample type, values at 1, 6, and 24 hours were compared with the 0-hour control. ^*P < 0.05 indicates statistical significance.

Discussion

In this study, we evaluated early mitochondrial and oxidative responses to snake venom exposure by examing changes in mitochondrial DNA (mtDNA) copy number, the relative abundance of specific mtDNA regions, and oxidative stress markers across different biological matrices. To ensure robust assessment of mtDNA alterations, two independent mtDNA/nDNA marker sets were employed, 16S rRNA and ND1 normalized to HK2, and Cytb and COXIII normalized to B2M. Using multiple mtDNA loci together with stable nuclear reference genes represents best practice in mtDNA quantification and minimizes locus-specific variability or primer-related artifacts [7]. In the mouse mitochondrial genome, 16S rRNA and ND1 correspond to regions considered part of a relatively stable fraction that is less prone to large-scale deletions, supporting their suitability for estimating overall mtDNA abundance. Consistent directional changes observed across these independent marker sets increase confidence that the detected alterations reflect genuine mitochondrial responses to venom exposure rather than technical noise.

Distinct tissue- and time-dependent patterns were observed following envenomation. Neurotoxic venoms produced early increases in relative mtDNA levels in whole blood, whereas hematotoxic venoms had greater early effects in muscle. Mononuclear cells showed reductions in relative mtDNA abundance. These patterns are consistent with evidence that mtDNA copy number fluctuates dynamically in response to acute oxidative challenges and stress-associated signaling pathways [17, 18].

Changes in mtDNA copy number or regional abundance do not constitute direct evidence of mitochondrial dysfunction but instead represent secondary responses to stress, altered bioenergetic demand, or shifts in mitochondrial turnover [19, 20]. To support this interpretation, oxidative stress markers were evaluated in parallel. Malondialdehyde (MDA) increased in a venom- and tissue-dependent manner, while reduced glutathione (GSH) rose predominantly in plasma, indicating activation of systemic antioxidant defenses. The concordance between mtDNA alterations and redox imbalance supports the presence of venom-induced mitochondrial stress [21, 22, 23].

Although mtDNA copy number, MDA, and GSH are not highly specific biomarkers of envenomation, their diagnostic relevance emerges when interpreted within the temporal and biological context of venom-induced pathophysiology. When considered together, changes in mtDNA copy number, shifts in the relative abundance of specific mtDNA regions, and alterations in MDA/GSH levels yield a mechanistically informed profile of venom-induced cellular stress, providing a richer signal than any single parameter alone. This concept aligns with evidence that combined mtDNA and oxidative indices enhance interpretation of stress responses across toxicological and clinical settings [24, 25].

Several limitations require careful consideration. Direct indicators of mitochondrial dysfunction, such as mtDNA oxidation, mutation profiling, or assays of respiratory chain activity, were not included. Likewise, although changes in Cytb and COXIII support mitochondrial involvement, they cannot independently confirm functional impairment. Future work should integrate functional mitochondrial assays and examine contributions of specific venom components to mtDNA alterations. Nevertheless, the concordant dynamics of mtDNA copy number and redox markers across multiple sample types highlight the potential of these measures as supportive indicators of systemic responses to snake venom, particularly when conventional venom detection is limited or inconclusive.

Conclusions

This study demonstrates that snake venom exposure induces early, tissue-specific alterations in mtDNA copy number, the relative abundance of mtDNA regions, and oxidative stress markers in mice. Although these parameters do not provide direct evidence of mitochondrial damage, their coordinated temporal changes reflect venom-induced mitochondrial and redox stress. Combining mtDNA-related measures with MDA and GSH yields a biologically informed, venom-independent approach for monitoring systemic responses to envenomation. Whole blood emerged as a practical and sensitive matrix for detecting early mitochondrial perturbations. Together, these findings support the potential utility of mtDNA-associated and oxidative stress indicators as supportive biomarkers for early evaluation and monitoring of snakebite envenomation.