Persulfidation of the Zinc Finger Protein ZRANB2 Modulates its RNA Binding and Alternative Splicing Function

Abstract

Zinc finger Ran-binding domain-containing protein 2 (ZRANB2) is an RNA-binding protein that plays a key role in alternative splicing. It contains two N-terminal RanBP2-type ZF domains in which four cysteine residues coordinate Zn(II) in a tetrahedral geometry to afford proper folding and function. Persulfidation, a post-translational modification in which cysteine thiols (-SH) are converted to persulfides (-SSH) by hydrogen sulfide (H₂S), has emerged as a means for regulating ZF activity. ZRANB2 is frequently identified as persulfidated in chemoselective proteomics screens, and here, we evaluate the direct modification of ZRANB2 by H₂S. Using a recombinantly expressed two-domain construct (ZRANB2-2D), we report that Zn(II)-bound ZRANB2-2D undergoes persulfidation when exposed to H₂S and oxygen with superoxide generated as an intermediate. This modification induces a loss of Zn(II)-dependent structure and abrogates binding to an RNA oligonucleotide from exon 3 of the transformer-2 protein homolog beta (TRA2B) RNA, a splicing target of ZRANB2, as well as to an optimized RNA oligonucleotide. Consistent with impaired RNA binding, cellular treatment with H₂S leads to decreased formation of a TRA2B splice product, suggesting a connection to persulfidation of ZRANB2 in cells. Notably, addition of a reductant restores ZRANB2-2D RNA-binding activity in vitro. These results position persulfidation as a rheostat for modulating ZF protein function, exemplified here by its role in regulating ZRANB2 RNA binding and splicing.

1. Introduction

Zinc Finger (ZF) proteins are common metalloproteins that use Zn(II) as a structural co-factor [1-3]. ZFs are primarily found in eukaryotes, where they regulate a myriad of functions, including gene regulation via transcriptional and post-transcriptional control and protein driven functions such as ubiquitination [4-6]. All ZF proteins contain domains with four cysteine (C) and/or histidine (H) residues. These residues serve as ligands that bind Zn(II) in a tetrahedral geometry leading to a folded protein. When folded, ZFs recognize and bind to specific DNA, RNA, or protein targets, to drive specific functions (e.g. transcriptional regulation) [2, 7, 8]. ZFs make up between 5-10% of all eukaryotic proteins and are often delineated into classes based upon their ligand set (number of cysteine versus histidine ligands) and the spacing between the ligands [3, 9-11]. ZFs adopt different secondary structures and modulate different functions, and to date at least 30 different classes of ZFs have been defined, sorted based upon these divergent properties [4].

ZFs were long considered to serve as just structural sites, because the Zn(II) center’s d¹⁰ electron count precludes any redox chemistry. However, there is emerging evidence that ZFs can be modified by exogenous molecules to regulate their functions [12-16]. This includes a small but growing number of reports of persulfidation of cysteine residues on ZFs by hydrogen sulfide (H₂S) [17-24].

H₂S is a gaseous molecule that for many years was known just for its toxicity. This view changed in the 1990s when H₂S was discovered to be present in rat brains where it functioned as a neuromodulator [25, 26]. Subsequent studies led to H₂S being identified in numerous biological processes including vasorelaxation, inflammation, and cardiovascular function [27, 28]. These collective discoveries led H₂S to be named the third gasotransmitter, after nitric oxide (NO) and carbon monoxide (CO) [29, 30]. As our understanding of H₂S as a gasotransmitter has increased, so have questions regarding the molecular-level drivers of these functions. H₂S is known to react with metalloproteins, such as heme and other iron-containing proteins affecting metabolism, and to participate in crosstalk with reactive oxygen species (ROS) and reactive nitrogen species (RNS) to alter function [29, 31, 32]. H₂S has also been shown to modify cysteine residues to persulfides (RSSH) [33]. Persulfidation (or sulfhydration) of cysteine residues has been called a post-translational modification, and there is growing evidence that persulfidation of cysteine residues can modulate protein function [34]. For example, persulfidation of cysteine residues in KEAP1/NRF2 and GAPDH has been shown to modulate their transcriptional and glycolytic activity, respectively [34]. The proteins that are modified by H₂S are not well understood nor are the mechanisms of persulfidation [35].

ZFs are one of the most common cysteine-rich proteins in eukaryotic cells, making them potential targets for persulfidation [36]. There are several examples, from cellular studies, of persulfidated ZFs. These include SP1, Parkin, androgen receptor (AR), SIRT1, SIRT3, and prolyl hydroxylase domain containing protein 2 (PHD2) [17-24]. The first evidence for persulfidation of an isolated ZF protein came from work by our laboratory in collaboration with the Filipovic group. We found that the ZF protein, tristetraprolin (TTP), which contains two CCCH domains, is persulfidated by H₂S via a reaction that requires O₂ [37]. We also observed superoxide and thiyl radical intermediates during the reaction, as well as the fully oxidized protein with loss of Zn(II) at the end of the reaction, leading us to propose a mechanism in which Zn(II) acts as a conduit for electron transfer (Scheme S1). This mechanism was supported by studies on TTP variants in which the ligand set was modified to CCCC, CCHH and CHHH as well as by a Zn(II)-coordination complex that mimics the Zn(II) center of a ZF [38]. Given the ubiquity of ZFs, we sought to determine if ZF persulfidation is a common PTM. We performed persulfide-specific proteomics on MEF cells and conducted a meta-analysis of all published persulfide specific proteomics data [36, 38]. From the analysis, we found that ZFs are commonly persulfidated in cells from a variety of species, and ZFs with different ligand sets (CCCC, CCCH and CCHH) can all be persulfidated [39-41].

One of the ZF proteins that was frequently identified in the persulfide specific proteomics data was the Ran-binding domain-containing protein 2 (ZRANB2). ZRANB2 is a tandem, CCCC-type ZF that belongs to the serine/arginine-rich (SR) protein family. The architecture of ZRANB2 includes a C-terminal arginine/serine-rich (RS) domain important for protein-protein interactions and two N-terminal RNA-binding ZF domains (Fig. 1) [42-44]. ZRANB2 is involved in the regulation of alternative splicing, and there are a few reports in which ZRANB2 has been shown to bind to specific mRNA transcripts, including TRA2B and cyclin B1 [42, 45].We and others have previously reported the isolation of a construct of ZRANB2 that contains the two CCCC ZF domains and shown that it selectively binds to ssRNA that contains a conserved sequence of AGGUAA [46, 47]. We have also reported that Zn(II) binding impacts the conformational dynamics of the first ZF and second ZF domains and the associated RNA binding [47]. Structures of the individual ZF domains of ZRANB2 have been reported: the ZFs form limited secondary structure upon Zn(II) binding, yet the loops and turns that are formed are critical for sequence-specific RNA binding, as apo-ZRANB2 does not bind to RNA [47].

Fig. 1:

(A) Architecture of full-length ZRANB2 depicting the N-terminal CCCC-type ZF domains and the C-terminal RS type domain. (B) NMR structures of each ZRANB2 domain, ZRANB2-ZF1 (left, PBD: 1N0Z) and ZRANB2-ZF2 (right, PBD: 2K1P). (C) Sequence alignment of the two ZF domains of ZRANB2 with cysteine residues highlighted in green.

Herein, we sought to understand how ZRANB2 is persulfidated and determine the effects on RNA binding and alternative splicing. The only cysteine residues in the ZRANB2 sequence are at the two ZF domains, thus we utilized a construct of ZRANB2 that contains just these two domains (ZRANB2-2D). We report that Zn(II)-bound ZRANB2-2D is persulfidated by H₂S in an O₂ dependent manner, via an in situ dimedone switch persulfide-labeling method monitored by UV-vis spectroscopy. We identify a superoxide intermediate, as measured by hydroethidine trapping monitored via fluorescence. We also show that the reaction with H₂S leads to loss of secondary structure and inhibition of RNA binding, and that this can be reversed. Finally, we report that elevated levels of H₂S in mammalian cells impact splicing, connecting persulfidation of ZRANB2 to its splicing function.

2. Materials and Methods

2.1. Materials and General Handling.

2.1.1. Materials.

Zinc chloride (ZnCl₂), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), trifluoracetic acid (TFA), acetonitrile (HPLC grade), cobalt chloride hexahydrate (CoCl₂•6H₂O), dithiothreitol (DTT), bovine serum albumin (BSA), sodium phosphate (Na₂HPO₄), potassium phosphate (KH₂PO₄), ampicillin sodium salt, phosphate buffered saline (PBS) tablets, 4-chloro-7-nitrobenzofurazan (NBF-Cl), 5,5-dimethylcyclohexane-1,3-dione (dimedone), reduced glutathione, LC-MS grade ammonium acetate, and Dulbecco’s phosphate-buffered saline (D-PBS) were purchased from Sigma-Aldrich. Ultrapure distilled water, S.O.C. medium, and hydroethidine (HE) were acquired from Invitrogen. Isopropyl β-D-1-thiogalactopyranoside (IPTG) was bought from RPI Research. Glutathione Sepharose 4B resin and thrombin were purchased from Cytiva Life Sciences. Tris base, sodium chloride (NaCl), and tris (2-carboxyethyl)phosphine hydrochloride (TCEP), LC-MS Optima grade water, acetonitrile, and formic acid were purchased from Thermo Fisher Scientific. Sodium sulfide anhydrous (Na₂S) was bought from Alfa Aesar. LB Broth was purchased from American Bio. Potassium chloride (KCl) was bought from EM Science. RPMI-1640 medium, fetal bovine serum (FBS) and penicillin-streptomycin were purchased from Gibco. β-mercaptoethanol was purchased from MP Biomedicals. PCR primers were obtained from Integrated DNA Technologies.

2.1.2. General Considerations.

Extra care was taken to ensure all reagents and buffers remained metal free throughout all experiments. Water was purified using a Milli-Q IQ 7000 water purification system and Q-POD dispenser equipped with a 0.22 μm filter. All buffers were prepared by combining the appropriate acid/base conjugate pairs according to the Henderson–Hasselbalch equation to achieve the desired pH, which was subsequently confirmed with a calibrated pH meter. Phosphate buffers were prepared using defined mixtures of mono- and dibasic sodium or potassium phosphate species. All buffers within the Coy anaerobic glovebox were stringently degassed by bubbling with argon followed by vacuum degassing. Caution should be taken when preparing H₂S from Na₂S, as H₂S is a toxic gas and should be handled according to institutional laboratory safety protocols. Na₂S was used as the source of total dissolved sulfide. Stock solutions were prepared immediately prior to use in degassed water and were handled in a Coy anaerobic box under light protected conditions. Aliquots of the freshly prepared stock solution were diluted into the reaction buffers immediately (either 1X PBS at pH 7.4, 20 mM Tris at pH 7.5, 20 mM potassium phosphate at pH 7.5, 50 mM sodium phosphate at pH 7.5, or 50 mM Tris at pH 8.0). Sulfide is in equilibrium between H₂S and HS⁻ (pK_a = 6.98), and under the buffered conditions utilized, HS⁻ is the predominant species (72% at pH 7.4, 77% at pH 7.5, 91% at pH 8), with S^2- negligible (pK_a > 12). The sulfide concentrations are reported as total sulfide from [Na₂S].

2.2. Preparation of ZRANB2-2D.

2.2.1. Cloning, Expression, and Purification of ZRANB2-2D.

ZRANB2-2D was cloned, overexpressed and purified as previously published [47]. Briefly, a plasmid that encodes for a construct of ZRANB2 that encompasses both zinc fingers (UnitProt entry O95218, residues 1-95) was cloned into a pGEX-2TK expression vector between cloning sites BamHI and EcoRI with a GST-tag. The plasmid was transformed into BL21 (DE3) competent cells then expressed in LB broth with ampicillin at 37 °C until reaching an OD₆₀₀ of 0.6-0.8. Cells were then induced with IPTG and grown for four more hours at 37 °C before being harvested. Cell pellets were resuspended in PBS buffer at pH 7.4 with a protease inhibitor tablet and DTT, then sonicated on ice. Lysed cells were centrifuged, and the supernatant was retained. The supernatant was added to Glutathione Sepharose 4B resin and purified by gravity column purification. GST-tagged ZRANB2-2D was eluted with reduced glutathione in PBS buffer at pH 8.0. Eluted protein was concentrated and desalted via a desalting column. The GST-tag was cleaved by incubating tagged protein with thrombin overnight at 20°C. The next day, TCEP was added to the solution then purified more by HPLC utilizing a Symmetry 300 C18 column with a water/acetonitrile gradient. ZRANB2-2D was eluted at 68% acetonitrile while GST was eluted at 48% acetonitrile as confirmed by SDS-PAGE gel. ZRANB2-2D was lyophilized in a SpeedVac and stored at −20 °C until further usage. Further handling of ZRANB2-2D was performed in an anaerobic Coy glovebox, unless otherwise noted.

2.2.2. Determination of ZRANB2-2D Molecular Mass by ESI-MS.

Apo-ZRANB2-2D at 20 μM was prepared in 10 mM ammonium acetate (LC-MS water). Accurate mass measurements were performed on an Agilent 6560 quadrupole time-of-flight mass spectrometer. Mass spectra were collected using direct injection at a flow rate of 10 μL/min over a 30 second scan period. The mass spectra were acquired in positive mode electrospray ionization operated from m/z 100-3200. The acquisition rate was set to 3 spectra/s. Source conditions were as follows: gas temperature at 300 °C, drying gas at 10 L/min, nebulizer set to 35 psi, sheath gas temperature at 300 °C, sheath gas flow rate at 11 L/min, vcap at 3500 V (positive mode), nozzle voltage set to 1500 V, fragmentor at 250 V, and oct 1 RF vpp at 750 V. Reference mass correction was applied using Agilent’s tune mix. Data was acquired using Agilent’s MassHunter Workstation (V B0.9) and processed using Agilent’s Qualitative Analysis (V B.10) and Microsoft Excel (Office 360). The molecular weight (MW) of ZRANB2-2D was as follows: calculated: 11569.4926 Da, observed: 11569.4134 Da.

2.3. Dimedone Switch Labeling of Persulfides.

Zn(II)-ZRANB2-2D at 10 μM was prepared in 20 mM Tris, 100 mM NaCl at pH 7.5 in quartz cuvettes under anaerobic conditions in a Coy anaerobic glovebox. Na₂S in H₂O was added (1:1) and mixed. The mixture was then removed from the glovebox, cap removed and oxygenated by shaking vigorously for several minutes. The solution was returned to the glovebox and 100 μM NBF-Cl (4-chloro-7-nitrobenzofurazan) was added, mixed, and the optical spectrum was recorded. Scans were performed every 1.5 minutes for 60 minutes with hand-mixing in between scans. Next, 200 μM dimedone (5,5-dimethylcyclohexane-1,3-dione) was added, mixed, and scanned immediately for up to 40 minutes every 1.5 min with hand-mixing. Changes at 350 nm and 422 nm were observed over time. A control experiment in which no Na₂S was added was performed, as well as one with apo-ZRANB2-2D + H₂S in the presence of O₂. The latter experiment led to visible precipitation, likely due to cysteine oxidation.

2.4. Hydroethidine Fluorescence to Measure Superoxide Formation.

Zn(II)-ZRANB2-2D was prepared in 50 mM sodium phosphate buffer at pH 7.5 that had been directly oxygenated with O₂ gas for 30 minutes before use. The fluorescence spectrum was measured using an ISS K2 spectrofluorometer configured in the L-format with excitation slit widths at 0.5 mm and emission slit widths at 2.0 mm. The excitation wavelength was set at 466 nm while the emission wavelength was scanned from 510 nm to 680 nm. These parameters are based upon a xanthine/xanthine oxidase control [38]. The experimental conditions were (1) 20 μM Zn(II)-ZRANB2-2D, (2) 20 μM Zn(II)-ZRANB2 -2D + 100 μM hydroethidine (HE), and (3) 20 μM Zn(II)-ZRANB2-2D + 100 μM HE + 2 mM Na₂S in H₂O. The fluorescence spectra were measured every 15 minutes up to 1 hour, followed by hourly measurements up to 3 hours with stirring occurring throughout.

2.5. Fluorescence Anisotropy (FA) of Zn(II)-ZRANB2-2D with RNA.

The binding of Zn(II)-ZRANB2-2D to RNA was measured via FA. An ISS K2 spectrofluorometer configured in a L-format with excitation and emission slit widths at 1.0 mm was used to measure binding affinities. The excitation wavelength (nm) was set at 495 nm and the emission wavelength was set at 517 nm. RNAs encoding for TRA2B (5’-CUCUGAAUCUAGGUAAGAAAG-[6FAM]-3’) and the double hexamer RNA (5’-[6FAM]-AGGUAAAAAAAAAAAGGUAA-3’) were purchased from Millipore Sigma. 5 nM of fluorescently labeled RNA was resuspended in 50 mM Tris, 100 mM KCl at pH 8.0 to which 0.1 mg/mL BSA was added. The following FA experiments were performed: (1) Zn(II)-ZRANB2-2D and (2) Zn(II)-ZRANB2-2D + 10 equivalents Na₂S (opened to oxygen for 24 hours) were each titrated into the RNA up to 1000 nM and the anisotropy was monitored. In addition, the Zn(II)-ZRANB2-2D:RNA complex was pre-formed (5 nM RNA, 400 nM Zn(II)-ZRANB2-2D) in aerated buffer, and Na₂S was titrated up to 2000 nM and the anisotropy was monitored. Raw anisotropy values were converted to fraction bound (the fraction of RNA bound to Zn(II)-ZRANB2-2D at a given RNA concentration) and fit with a 1:1 binding model as previously published [47].

2.6. Intrinsic Fluorescence Spectroscopy.

Zn(II)-ZRANB2-2D was prepared anaerobically in a 50 mM Tris, 100 mM KCl at pH 8.0 buffer at a final concentration of 1 μM. The fluorescence spectrum was obtained using an ISS K2 spectrofluorometer configured in an L-format with excitation and emission slit widths at 1.0 mm. The excitation wavelength was set to 280 nm, and the emission wavelength was scanned from 300 nm to 400 nm. 10-fold Na₂S in H₂O was then added aerobically and the fluorescence spectrum was monitored over time, with the sample remaining open to oxygen for up to 168 hours.

2.7. Circular Dichroism.

Circular dichroism for Zn(II)-ZRANB2-2D was measured using Jasco-1500 circular dichroism (CD) spectrophotometer using 1 mm Starna Cell Spectrosil Far UV Quartz cuvettes. Data were collected between 190-250 nm, using a scan rate of 100 nm/min and bandwidth of 1 nm at 25 °C. Each spectrum represents an average of three accumulations smoothed using a Savitzky-Golay filter. Samples measured were: 40 μM Zn(II)-ZRANB2-2D; 40 μM Zn(II)-ZRANB2-2D + 400 μM Na₂S in H₂O, and 40μM Zn(II)-ZRANB2-2D + 4 mM Na₂S in H₂O. All samples were made in 20 mM potassium phosphate buffer at pH 7.5 (blank), and the samples with Na₂S added were directly oxygenated with O₂ gas for 45 minutes before scanning.

2.8. Reversibility of Zn(II)-ZRANB2-2D Persulfidation via Spin Filter and FA.

Zn(II)-ZRANB2-2D (10 μM) was prepared as follows: (1) in 50 mM Tris, 100 mM KCl at pH 8.0 (anaerobic), (2) in 50 mM Tris, 100 mM KCl at pH 8.0 to which 50 μM Na₂S in H₂O was added (opened to oxygen for 24 hours), and (3) in 50 mM Tris, 100 mM KCl at pH 8.0 to which 50 μM Na₂S in H₂O was added (opened to oxygen for 24 hours), followed by 500 μM TCEP. For condition 3, the sample was applied to a 3 kDa MWCO spin filter (Amicon Ultra, 0.5 mL) with centrifugation at 14,000 × g for 30 min at 4 °C (Fisher Scientific fixed-angle rotor) to remove unreacted Na₂S and any unbound Zn(II). The protein (retained in the filtrate) was diluted with 50 mM Tris, 100 mM KCl at pH 8.0 to 500 μL, collected by inversion into a fresh tube, and eluted by centrifuging at 1000 × g for 2 min. The protein was then incubated with a 500 μM TCEP for 30 min at room temperature and applied to the MWCO spin-filter in the same manner to remove excess reductant. The protein was then brought into the Coy anaerobic box, and two equivalents of Zn(II) via ZnCl₂ were added. Each sample (1-3) was titrated with the double hexamer RNA (5’-[6FAM]-AGGUAAAAAAAAAAAGGUAA-3’), following the FA protocol described above.

2.9. Cell Studies.

2.9.1. Cell Culture and H₂S treatment.

THP-1 cells were purchased from ATCC and cultured in complete RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 50 μM β-mercaptoethanol (BME), and 1X penicillin–streptomycin. Cultures were maintained at 37°C in a humidified atmosphere with 5% CO₂. Cells were seeded at 500,000 cells/mL in RPMI-medium supplemented with 10% FBS and 1X penicillin–streptomycin (no BME) on the day of treatment. Thirty minutes after seeding, 10 mM Na₂S in PBS was added for a final concentration of 100 μM. Cells were harvested for RNA isolation at 0 and 15 minutes post-treatment. For harvesting, cells were centrifuged at 200 x g for 5 min, the supernatant was aspirated, and pellets were washed with 5 mL PBS followed by an additional 1 mL PBS wash. The 1 mL samples were centrifuged at 2000 x g for 1 min, the supernatant was removed, and the pellets were resuspended in RLT-lysis buffer from the Qiagen RNeasy Mini Kit and stored at −80 °C until processing. Three biological replicates were collected for each treatment condition.

2.9.2. RNA Isolation and RT-qPCR.

RNA was extracted using the Qiagen RNeasy Mini Kit following the manufacturer’s instructions. Samples were treated with Qiagen RNase-free DNase during RNA extraction and New England Biolabs DNase after RNA extraction. The concentration and purity of RNA for each sample was verified, and all samples demonstrated a 260/280 ratio ≥ 1.89, indicating high purity. RNA concentration was adjusted to ensure consistent concentration of all samples before reverse transcription. The adjusted RNA was then utilized to synthesize cDNA with the Applied Biosciences High-Capacity RT Kit as per the manufacturer’s instructions. Quantitative polymerase chain reaction (qPCR) of cDNA was performed using PowerUp SYBR Green Master Mix following the manufacturer’s recommended protocol. cDNA was amplified using highly specific primers for the reference gene, ubiquitin-c (UBC) and the target gene, the β3 isoform of TRA2B (Table 1). To ensure that the β3 isoform would be amplified specifically, the forward primer was designed to overlap exons 1 and 4 (which are joined after splicing) and the reverse primer, designed against exon 4, was obtained from literature [48]. Primers for UBC were designed based on the Primer Bank. Real-time qualitative PCR analysis was performed using an Applied Sciences QuantStudio-3 PCR System. All samples were run in at least technical triplicate. Expression levels of TRA2B β3 mRNA were determined using the comparative C_T (2^−ΔΔCT) method. Unpaired two-tailed t-tests were performed on fold change values to compare mRNA levels between the untreated and treated groups at each time point, with significance defined as ns (P > 0.05) and * (P ≤ 0.05).

Table 1:

Primers utilized for RT-qPCR.

Target Gene	Forward Primer (5’ → 3’)	Reverse Primer (5’ → 3’)
UBC	CTGGAAGATGGTCGTACCCTG (Primer Bank)	GGTCTTGCCAGTGAGTGTCT (Primer Bank)
TRA2B β3	AGCGGGCAAATCCTGATCCT [This work]	CGGCAATGGGACCATATTTA [48]

3. Results and Discussion

3.1. Reactivity of Zn(II)-ZRANB2-2D with H₂S.

We sought to examine the persulfidation of ZRANB2 because it is persulfidated in chemoselective proteomics data from both humans (unpublished) and mice [38]. The available sites for persulfidation are the two CCCC ZF domains. These domains adopt a compact structure with a series of loops when Zn(II) is bound. We have previously reported that ZFs with a tristetraprolin (TTP) type structure are persulfidated when reacted with H₂S with O₂ present, but whether this same chemistry occurs for ZRANB2, which has a different fold than TTP, is not known, nor is the effect of persulfidation on the protein’s function. For these studies, a protein construct called ZRANB2-2D which contains the two ZF domains was prepared recombinantly and purified. Persulfidation was measured by reacting Zn(II)-ZRANB2-2D with H₂S under aerobic conditions using a tag-switch approach to monitor persulfidation. In the tag-switch approach, 4-chloro-7-nitrobenzofurazan (NBF-Cl) is added to label all sulfur derived functional groups (thiols, persulfides, sulfenic acids) and the amino terminus followed by addition of dimedone which selectively ‘switches’ with the NBF-labeled persulfides. As shown in Fig. 2, optical spectroscopy is used as the readout: when NBF-Cl was added to Zn(II)-ZRANB2-2D in the presence of H₂S (from Na₂S) and O₂, the absorbance at 350 nm which is indicative of NBF-Cl decreased while a new absorbance band between 400-440 nm appeared indicative of NBF labeling the protein [49]. Addition of dimedone resulted in a decrease in the 422 nm peak over time indicating that dimedone was switching with the NBF-labeled persulfides and providing evidence for persulfidation of Zn(II)-ZRANB2-2D.

Fig. 2:

UV-visible spectra of Zn(II)-ZRANB2-2D reacted with Na₂S in H₂O in 20 mM Tris, 100 mM NaCl at pH 7.5. (A) Plot of spectra between 250-800 nm after exposure to oxygen and addition of NBF-Cl; spectra were obtained every 1.5 minutes until no further changes were observed. (B) Plot of spectra between 300 - 800 nm after addition of dimedone; spectra were obtained every 1.5 minutes until no further changes were observed. Three replicates of the experiment were performed.

We then performed experiments to determine if superoxide is generated during the reaction of Zn(II)-ZRANB2-2D with H₂S. Our work with Zn(II)-TTP/H₂S/O₂ had identified a superoxide intermediate, and we sought to determine if the same intermediate is observed for Zn(II)-ZRANB2-2D [37]. Zn(II)-ZRANB2-2D was reacted with H₂S in the presence of oxygen and hydroethidine (HE). HE exhibits a characteristic red fluorescent signal around 600 nm in the presence of superoxide [50-52]. This signal was observed, starting at 15 minutes after the addition of HE and increasing in intensity over the course of 3 hours for the reaction of Zn(II)-ZRANB2-2D with H₂S under aerobic conditions (Fig. 3), providing evidence for the formation of superoxide. These collective findings suggest that Zn(II)-ZRANB2 is persulfidated by H₂S in the same manner as TTP, despite having different secondary structures.

Fig. 3:

Fluorescence emission spectra of oxidized hydroethidine (HE) after the reaction of Zn(II)-ZRANB2-2D with Na₂S in H₂O (aerobic, t = 3h, in 50 mM sodium phosphate buffer at pH 7.5). Zn(II)-ZRANB2-2D with both HE and H₂S is in black and Zn(II)-ZRANB2-2D with only HE (no H₂S) is in orange. Buffer controls were also included, where buffer with HE and H₂S is in green and buffer with only HE (no H₂S) is in blue. Three replicates of the experiment were performed.

3.2. Zn(II)-ZRANB2-2D:RNA Binding is Abrogated upon Reaction with H₂S.

We then sought to understand how the reaction of H₂S with Zn(II)-ZRANB2-2D impacts its RNA binding function. ZRANB2 is a spliceosomal protein involved in alternative splicing where its zinc finger domains functions to bind RNA and its arginine/serine-rich region interacts with other proteins [42, 43, 45]. ZRANB2 has been shown to bind ssRNA and RNAs with an AGGUAA motif (called a hexamer) with high specificity [46]. Using fluorescence anisotropy (FA), we have reported that Zn(II)-ZRANB2-2D binds to both TRA2B pre-mRNA from its 3^rd exon and an optimized RNA target that contains two copies of ZRANB2’s preferred binding site (AGGUAA) separated by eight adenines (AGGUAA-A₈-AGGUAA) with a nM dissociation constant (K_d) [47]. We applied this experimental approach to determine how persulfidation of Zn(II)-ZRANB2-2D affects RNA binding. As shown in Fig. 4, when Zn(II)-ZRANB2-2D is titrated with either TRA2B RNA (red triangles) or the optimized (double hexamer) RNA target (blue squares), high affinity RNA binding is observed; however, when Zn(II)-ZRANB2-2D is reacted with H₂S under aerobic conditions and then titrated with either of these RNA probes, binding is abrogated. Similarly, apo-ZRANB2-2D (anaerobic) does not bind to TRA2B RNA [47]. These collective data indicate the reaction of H₂S with Zn(II)-ZRANB2-2D abrogates RNA binding.

Fig. 4:

Change in fluorescence anisotropy upon the addition of Zn(II)-ZRANB2-2D to fluorescently labeled RNA targets (TRA2B and double hexamer) before and after reaction with Na₂S in H₂O (aerobic) in 50 mM Tris, 100 mM KCl at pH 8.0. Zn(II)-ZRANB2-2D binding to TRA2B RNA is indicated as red triangles and persulfidated Zn(II)-ZRANB2-2D binding to TRA2B RNA is indicated as green diamonds. Zn(II)-ZRANB2-2D binding to the double hexamer RNA is indicated as blue squares and persulfidated Zn(II)-ZRANB2-2D binding to the double hexamer RNA is indicated as orange circles. Each point represents an average of at least three replicates ± standard error of the mean (SEM) as error bars.

We then performed studies to determine how persulfidation affects the structure of Zn(II)-ZRANB2-2D. Intrinsic fluorescence and circular dichroism (CD) were employed to monitor the effects of the H₂S chemistry on Zn(II)-ZRANB2-2D structure. Intrinsic fluorescence has long been used as a technique to monitor unfolding of proteins due to the natural fluorescence of aromatic residues (tryptophan, tyrosine, phenylalanine) [53, 54]. Although protein fluorescence can be complex, intrinsic fluorescence can provide a general readout of structure. The ZRANB2-2D construct contains 3 tryptophan residues, 1 tyrosine, and 3 phenylalanine residues, providing a spectroscopic handle to follow. Zn(II)-ZRANB2-2D exhibited a fluorescence emission spectrum between 300-400 nm upon excitation at 280 nm, that decreased upon addition of H₂S in O₂ indicating loss of structure (Fig. 5A). An analogous CD experiment was performed, and a similar loss of secondary structure was observed (Fig. 5B). Together, intrinsic fluorescence and CD data support a model in which the structure of Zn(II)-ZRANB2-2D is abrogated when modified by H₂S.

Fig. 5:

(A) Change in the intrinsic fluorescence spectrum as Zn(II)-ZRANB2-2D reacted aerobically with Na₂S in H₂O for up to 168 hours in 50 mM Tris, 100 mM KCl at pH 8.0. (B) Change in the circular dichroism spectrum of Zn(II)-ZRANB2-2D (black) when exposed to 10-fold Na₂S (red) and 100-fold Na₂S (blue) and direct oxygenation in 20 mM potassium phosphate at pH 7.5. Three replicates of each experiment were performed.

Finally, we carried out studies to determine whether RNA binding to Zn(II)-ZRANB2-2D affects the persulfidation of Zn(II)-ZRANB2-2D. Zn(II)-ZRANB2-2D was titrated with TRA2B RNA after which H₂S was titrated under aerobic conditions, and the fluorescence anisotropy was monitored. No change in fluorescence anisotropy was observed up to 2000 nM of H₂S added (Fig. S1). This result suggests that ZRANB2-2D is protected from reactivity when bound to RNA, which is a property we have observed for TTP [37].

3.3. H₂S-Mediated Persulfidation of ZRANB2 and Loss of RNA Binding is Reversible.

Having established that the reaction of Zn(II)-ZRANB2-2D with H₂S under aerobic conditions led to loss of RNA, we asked whether this loss of binding is reversible. Our approach involved addition of TCEP after Zn(II)-ZRANB2-2D has been reacted with H₂S, and comparing the RNA binding pre- and post- reduction using FA. For these studies, we utilized the optimized RNA target. We performed three FA experiments, as shown in Fig. 6. For the first experiment, Zn(II)-ZRANB2-2D was titrated with the double hexamer RNA and shown to bind with a high affinity (K_d = 25 nM) (Fig. 6B). For the second experiment, Zn(II)-ZRANB2-2D was treated with 5-fold excess H₂S under oxygen exposure for 24 hours, after which the solution was applied to a 3 kDa MWCO spin-filter to remove unreacted H₂S and any unbound Zn(II). FA was then performed, and we observed the expected abrogation of RNA binding, consistent with our findings above (Fig. 4 and 6B). We then applied the reductant, TCEP, to the persulfidated protein, applied the sample to a 3 kDa MWCO spin-filter to remove excess reductant, and added stoichiometric Zn(II). TCEP was chosen for its ability to selectively reduce cysteine modifications while maintaining stability and minimal Zn(II)-binding affinity under our experimental conditions (pH 8.0) [55, 56]. Following reduction and Zn(II)-reconstitution, the protein was then titrated with the optimized RNA target and followed by FA. As shown in Fig 6B, RNA binding was largely restored, suggesting that persulfidation of ZF proteins can be reversed.

Fig. 6:

(A) Cartoon diagram of approach to reverse persulfidation of ZRANB2-2D. ZRANB2-2D that had been exposed to 5-fold Na₂S in H₂O and left open to oxygen for 24 hours, oxidized ZRANB2-2D, was applied to a 3 kDa MWCO spin-filter to remove any unreacted Na₂S and unbound Zn(II). The filtered sample was incubated with TCEP and again spin-filtered a final time to remove the TCEP before reintroducing Zn(II) for titration into RNA. (B) Fluorescence anisotropy binding assays for ZRANB2-2D with the double hexamer RNA target to demonstrate the reversibility of persulfidation. Zn(II)-ZRANB2-2D is indicated as green squares, Zn(II)-ZRANB2-2D exposed to 5-fold Na₂S in H₂O is indicated as red circles, and Zn(II)-ZRANB2-2D exposed to Na₂S but reduced with TCEP is indicated as purple upside-down triangles. Each point represents an average of at least three replicates ± standard error of the mean (SEM) as error bars.

3.4. Splicing of ZRANB2’s pre-mRNA Target, TRA2B, is affected by H₂S.

ZRANB2 regulates alternative splicing, and experiments to determine the effects of persulfidation on alternative splicing in cells were performed. Alternative splicing is a cellular process in which multiple protein isoforms can be produced from the same pre-mRNA, due to the removal of different introns and exons that can result in a variety of mRNA transcripts [57, 58]. By generating multiple protein isoforms from a single mRNA, alternative splicing introduces broad phenotypic diversity and is considered a potent means for expanding the capacity of genes and regulating protein expression levels [59]. Alternative splicing is facilitated by the spliceosome, a complex composed of five small nuclear ribonucleoproteins (snRNPs) and more than 150 other splicing proteins, including ZRANB2 [57]. One of the best characterized pre-mRNA splicing targets of ZRANB2 is TRA2B, which encodes for the transformer-2 protein homolog beta (Tra2β) protein, another protein that is central to alternative splicing [42, 48]. ZRANB2 splices specifically the TRA2B mini-gene pre-mRNA, which is comprised of exons 1-4 (Fig. 7A). ZRANB2 preferentially binds to a splice site motif of AGGUAA, and splicing occurs between the guanines (AG|GUAA) to produce two TRA2B mRNA isoforms; the β1 isoform, where exon 2 is skipped, and the β3 isoform, where exons 2 and 3 are skipped (Fig. 7A) [42, 48].

Fig. 7:

ZRANB2-dependent splicing of the TRA2B mini-gene is influenced by H₂S. (A) Schematic of ZRANB2 splicing of the TRA2B mini-gene pre-mRNA (exons 1-4) (top) into the β1 (bottom left) and β3 (bottom right) isoforms. (B) mRNA fold change of the β3 isoform as measured by RT-qPCR in THP-1 cells treated with 100 μM Na₂S in PBS buffer (+) or untreated (−) cells. Bar size represents the average fold change of 3 biological replicates, and individual biological replicates are shown in black. Unpaired two-tailed t-tests were performed on fold change values to compare mRNA levels between treatment groups at each time point, with significance defined as ns (P > 0.05) and * (P ≤ 0.05).

Given that persulfidation of ZRANB2-2D abrogates binding of TRA2B in vitro, as measured by fluorescence anisotropy, and our knowledge that ZRANB2 is persulfidated in both human cells (THP-1, unpublished) and mice [38], we then examined whether TRA2B splicing is altered in cells exposed to elevated levels of H₂S. To test this, we used the β3 isoform as a reporter of ZRANB2-dependent splicing activity in THP-1 cells treated with 100 μM Na₂S for 0 and 15 minutes, focusing on short time points given the rapid kinetics of splicing [60]. Relative abundance of TRA2B β3 isoform mRNA was quantified by RT-qPCR (Fig. 7B). At baseline (cells harvested 0 minutes post-treatment), we observed a 1.2-fold decrease in β3 transcript levels in Na₂S-treated cells relative to untreated controls, an effect that was not statistically significant but may point to an immediate role of H₂S in affecting the normal splicing patterns of TRA2B. By 15 minutes, β3 transcript levels were reduced by 1.42-fold (p = 0.0158, n = 3, statistically significant). Although this change is modest, it is consistent with our in vitro findings that persulfidation of ZRANB2 inhibits RNA binding (Fig. 4) and suggests that H₂S can begin to alter TRA2B isoform production on short time scales. These data provide proof-of-concept study that H₂S-dependent persulfidation of ZRANB2 can influence splicing outcomes in a cellular context and set the stage for future, comprehensive cellular studies to evaluate the hypothesis that ZF persulfidation is as a regulatory switch to fine-tune pre-mRNA splicing.

4. Conclusions

ZFs are emerging as frequently persulfidated; however, the types of ZFs that can be persulfidated, the chemistry involved in the persulfidation reaction, and the functional effects remain open questions. In this work, we found that the tandem CCCC type ZF protein, ZRANB2 is persulfidated by H₂S in an O₂ dependent manner, with the same intermediates seen for the CCCH type ZF protein, TTP [37, 38]. These two ZFs have different secondary structures; however, our data supports the same mechanism for persulfidation for these two ZFs, suggesting a common mechanism for ZF persulfidation by H₂S. Different ZFs can adopt a variety of different structures, and it will be of interest to understand if ZFs with other types of secondary structure also are persulfidated in the same manner. Similarly, our finding that H₂S mediated persulfidation of ZRANB2 can be reversed by addition of a reductant revealed that persulfidation is a reversible event for this specific ZF. This is, to our knowledge, the first time that ZF persulfidation has been shown to be reversible, and it is of interest to understand if this reversibility is seen for other types of ZFs. Future work could also include identification of the sites of persulfidation and determination of the rates of persulfidation between different types of ZFs.

Our finding that ZRANB2 persulfidation leads to a loss of its TRA2B RNA binding function in vitro as well as our evidence that links H₂S levels to alternative splicing of TRA2B transcripts in cells, suggests that persulfidation of ZRANB2 may be a means to modulate splicing function. Future cell-based studies will focus identifying the drivers of the observed alternative splicing of TRA2B to determine if this modification is a direct consequence of ZRANB2 activity.

From these collective data, we propose that ZF persulfidation may function as a reversible mechanism to regulate nucleic acid binding, potentially serving to fine-tune transcription in response to dynamic conditions in the cell. Future work will focus on testing this hypothesis.

Appendix A. Supporting data.

The Supporting data to this article can be found online at xxxx.

Data availability

Data will be made available on request.