Muc1 drives tendon regeneration by activating an endothelial-to-tenocyte PDGFA signaling axis via extracellular vesicles

Yan Xue; Jie Sun; Xu Hao Ji; Rong Wang; Jia Yu Shi; Qian Qian Yang; You Lang Zhou; Jun Tan

doi:10.1016/j.mtbio.2026.103158

. 2026 Apr 30;38:103158. doi: 10.1016/j.mtbio.2026.103158

Muc1 drives tendon regeneration by activating an endothelial-to-tenocyte PDGFA signaling axis via extracellular vesicles

Yan Xue ^a,¹, Jie Sun ^a,¹, Xu Hao Ji ^a,¹, Rong Wang ^b, Jia Yu Shi ^a, Qian Qian Yang ^a,^⁎, You Lang Zhou ^a,^⁎⁎, Jun Tan ^a,^⁎⁎⁎

PMCID: PMC13158404 PMID: 42125260

Abstract

Tendon injuries pose significant clinical challenges because tendon tissue has limited intrinsic healing capacity, often resulting in poor functional recovery. In exploring novel therapeutic strategies, we found that Mucin 1 (Muc1), a key regulator of tissue repair, is transiently upregulated during the early stages of tendon injury. We therefore hypothesized that sustained activation of this naturally transient signal would promote tendon repair. To validate this hypothesis, we developed a nanoparticle-based gene delivery system to achieve sustained Muc1 expression in a rat model of tendon injury. This targeted intervention significantly improved tendon healing, primarily by creating a pro-regenerative microenvironment. Mechanistically, we demonstrated that Muc1 activation stimulates endothelial cells to secrete platelet-derived growth factor A (PDGFA), which promotes tendon cell proliferation, particularly when packaged within extracellular vesicles. Collectively, those findings support Muc1 as a potent therapeutic target. The nanoparticle-mediated Muc1 gene delivery strategy offers a highly promising regenerative approach for tendon injury treatment with direct translational potential.

Keywords: Tendon injury, Muc1, Exosomes, PDGFA, Nanoparticle, Gene delivery

Graphical abstract

1. Introduction

Hand function and integrity are critical for both occupational performance and activities of daily living. Acute injuries involving the hand or fingers represent a major clinical burden. In the United States alone, more than 4.8 million emergency department visits annually are attributed to acute hand or finger trauma, accounting for approximately 4% of all emergency visits [1]. Among these, tendon injuries, particularly flexor tendon injuries, constitute a substantial proportion [2]. Given the complex anatomical and functional role of flexor tendons, inadequate treatment often results in severe postoperative complications, including adhesion formation, persistent pain, impaired mobility, and in some cases, permanent disability [3]. Despite advancements in surgical repair techniques, tendons inherently possess a limited capacity for intrinsic healing. Tendon regeneration is characterized by a prolonged and inefficient process, encompassing sequential phases of inflammation, tenocyte proliferation, and extracellular matrix remodeling [4,5]. In contrast to highly vascularized tissues, tendons depend on a sparse microvascular network that is readily compromised after injury. Accordingly, promoting neovascularization may improve the functional outcomes of tendon healing. Newly formed blood vessels serve as critical conduits for cellular trafficking and molecular signaling. Endothelial cells release chemotactic and growth factors, such as vascular endothelial growth factor (VEGF) [6], monocyte chemoattractant protein-1 (MCP-1/CCL2), and PDGFA, thereby promoting the recruitment of reparative cells, including macrophages and mesenchymal stem cells (MSCs), to the site of injury [7]. Furthermore, vascular remodeling plays a crucial role in the dynamic regulation of extracellular matrix (ECM) homeostasis. For instance, in response to various signaling molecules, pericytes and fibroblasts become activated, leading to the synthesis and remodeling of collagen.

Angiogenesis is a highly complex, multistep biological process that is tightly regulated by numerous molecular and cellular factors [8]. Among these factors, endothelial cells serve as the primary mediators of vascular repair and regeneration under ischemic or injury conditions [9]. In this context, increasing attention has been directed toward Mucin 1 (Muc1, also known as CD227) [10]. Muc1 is a high-molecular-weight (>400 kDa) type I transmembrane glycoprotein that is predominantly expressed on the apical surface of epithelial cells and extends into the glycocalyx. It can also be induced in activated endothelial cells. Muc1 has been reported to modulate endothelial secretion of factors such as CCL2, Dynll1, and Tmed5, thereby enhancing vascular permeability and sprouting capacity. Additionally, these factors recruit pericytes and smooth muscle cells to envelop nascent vessels, thereby enhancing vascular stability and maturation. Such vascular wall remodeling is essential for maintaining the long-term homeostasis of newly formed vessels. Extracellular vesicles, particularly exosomes, are integral mediators of paracrine communication between endothelial and stromal cells. Previous studies have shown that Muc1 can be incorporated into exosomes via the lipid raft-dependent pathway, facilitating crosstalk with pro-angiogenic signaling and upregulating PDGFA expression and secretion [11,12]. Collectively, these findings suggest that Muc1 plays a multifaceted regulatory role in angiogenesis by modulating molecular signaling, intercellular communication, and exosome-mediated paracrine mechanisms. This integrative control identifies Muc1 as a crucial regulator of vascular remodeling and a promising therapeutic target for tissue repair and regeneration.

In this study, we investigated the role of Muc1 in flexor digitorum longus (FDL) tendon repair. Our investigation comprised four main components: (1) In vivo evaluation: As depicted in Scheme 1, pEGFP-Muc1 was locally microinjected into a Sprague–Dawley (SD) rat model of FDL tendon injury. Tendon healing was subsequently monitored to evaluate whether exogenous Muc1 upregulation could facilitate functional recovery. This investigation aimed to determine the overall therapeutic efficacy of Muc1 in promoting tendon repair. (2) In vitro functional assays were conducted to investigate the effects of pEGFP-Muc1 on tenocytes and endothelial cells both independently and within a tenocyte-endothelial cell co-culture system. Conditioned medium obtained from pEGFP-Muc1-transfected endothelial cells was applied to tenocytes to determine whether Muc1 exerts its effects directly on tenocytes or indirectly via paracrine signaling mediated by endothelial cells. (3) Mechanistic investigation: Proteomic analysis of conditioned media from endothelial cells transfected with pEGFP-Muc1 or pEGFP-N1 revealed significant upregulation of PDGFA in the pEGFP-Muc1 group. Additionally, mRNA sequencing of both tenocytes and endothelial cells post-transfection revealed substantial alterations in gene expression associated with angiogenesis, inflammatory regulation, and extracellular matrix (ECM) remodeling. Together, these findings provide mechanistic insight into the mode of action of Muc1. (4) Exosome validation experiments were conducted in which exosomes were isolated from the conditioned media of endothelial cells transfected with pEGFP-Muc1 and subsequently applied to tenocytes. Functional assays indicated significant alterations in tenocyte proliferation, migration, and matrix synthesis, suggesting that exosomes serve as critical mediators through which Muc1 influences peritendinous repair. Our study identified Muc1 as a pivotal mediator of vascular remodeling and microenvironment optimization during tendon healing, highlighting its potential as a therapeutic target to enhance tendon repair.

Scheme 1 — Schematic diagram of the nanosphere/plasmid mixture preparation process and the mechanism of promoting tendon proliferation after co-culture of endothelial cells and tenocytes.

2. Material and methods

2.1. Design and synthesis of the Muc1 overexpression plasmid

The Muc1 overexpression plasmid (pEGFP-Muc1) was generated by cloning the full-length coding sequence of Muc1 (GenBank accession number NM_001398538) into the pEGFP-N1 vector. The empty pEGFP-N1 vector was used as a negative control. Following ligation, the recombinant plasmid was transformed into DH5α competent Escherichia coli. Positive clones were screened by colony PCR and validated by Sanger sequencing to confirm correct insertion and orientation of the Muc1 sequence. Verified clones were expanded in DH5α, and plasmids were purified using an EndoFree Plasmid Maxi Kit (Qiagen, Germany) according to the manufacturer's instructions. Plasmid concentration and purity were measured using a NanoDrop spectrophotometer, and samples with an A260/A280 ratio consistently of 1.8–2.0 were used for subsequent experiments. Purified plasmids were stored at −20 °C.

2.2. Preparation of PLGA nanoparticles and plasmid/nanoparticle complexes

PLGA nanoparticles were prepared using a double-emulsion method. Briefly, 200 mg of polylactic acid-glycolic acid (PLGA) (A), 2 mL of dichloromethane (DCM) (B), and 6 mL of 7% (w/v) poly (vinyl alcohol) (PVA) (C). The process of the preparation involved the dissolution of A in B, the slow addition of C, and the subsequent emulsification with an ultrasonic apparatus (Bendling Elektronik, Berlin, Germany) to yield the primary emulsion. Then, 100 mL of 1% (w/v) PVA solution was added to the primary emulsion and emulsified again by ultrasonication to form a double emulsion. The obtained emulsion was homogeneously stirred at room temperature for 24 h, and then centrifuged at 13,000 rpm for 5 min to obtain PLGA nanoparticles. PEI was then added to the PLGA nanoparticles and mixed for 15 min. Finally, the overexpressed Muc1 plasmid was added and left at room temperature for at least 20 min to form plasmid/nanoparticle complexes, which were added to cell culture plates for processing.

2.3. Ethics statement

SD rats (220∼250 g, 8 weeks old, male) were obtained from the Laboratory Animal Center of Nantong University (No: S20200506-012). The experiments were conducted in accordance with animal welfare ethical regulations and approved by the Institutional Animal Care and Use Committee of Nantong University. Animals were housed under standard laboratory conditions with free access to food and water.

2.4. Simulated tendon injury in animals

A total of 36 SD rats (72 tendons) were included in the vivo study. All tendons were surgically injured and randomly assigned to three groups (12 rats and 24 tendons per group): (1) only suture after injury; (2) pEGFP-N1 group, receiving 2.5 μg of pEGFP-N1 mixed with 2.5 μL of nanoparticles; and (3) pEGFP-Muc1 group, receiving 2.5 μg of Muc1 overexpression plasmid complexed with 2.5 μL of nanoparticles. The screening of dosage can be found in the supplementary materials. Half of tendons were harvested at 10 days after surgery, and the remaining half were harvested at 20 days postoperatively. At each time point, tissues from three rats in each group were collected for histological analysis, whereas the remaining nine rats were subjected to gliding function and biomechanical testing. The animal anesthesia method was intraperitoneal injection of 2% sodium pentobarbital 3 mL/kg. To minimize intraoperative bleeding, 0.05 mL/palm of 0.5% lidocaine hydrochloride containing 1% epinephrine was locally injected into the palm. Intraoperatively, the flexor tendon was surgically transected in the transverse plane and then sutured using 5-0 PROLENE sutures (Catalog Number: W8556; Ethicon, Inc. Somerville, USA) with two strands modified Kessler's method and a circle repair like mentioned above [13]. The plasmid/nanoparticle complexes were then injected into the tendon through the suture site using a microsyringe. Completing the operation, the skin is routinely sutured using 3-0 nylon flow sutures (Horcon.cn All Rights Reserved, Shanghai, China).

2.5. Gliding function and biomechanical testing

At the designated time points, animals were euthanized and tendon healing was evaluated by gliding function and biomechanical testing. Gliding function was assessed by measuring the flexion angle under different loading conditions at 10 and 20 days after surgical repair. To ensure the objectivity of mobility, the specimen was detached from the surrounding tissue, and the measuring weight was fixed to the skeletal muscle connected to the Achilles tendon with a leather thread. Tested with dedicated machine (Model 4411; Instron Corp., Norwood, MA, USA). To ensure reliable results, the repaired tendon was completely dissected from the adherent subcutaneous tissue, the whole healed tendon was selected, and the upper and lower ends were fixed on the mechanical clamps, the lower clamp remained stationary, and the average speed of the upper clamp moved linearly at a speed of 25 mm/min. Load–displacement data were recorded using the accompanying software (Series IX; Instron), and the maximum tensile strength was determined at the point of ultimate failure.

2.6. Tissue sectioning

After gliding function assay, three tendon specimens from each group were collected for histological staining. Following removal of the surrounding tissues, the specimens were fixed in 4% paraformaldehyde at room temperature for 48 h. Two tissues were transversely dissected, and one tissues was dissected longitudinally and dehydrated then wrapped into wax blocks. Cut the sample using a paraffin microtome to obtain sections of about 5 μm thickness, which are then immersed in a deparaffinization solution.

2.7. Morphological observation, staining and analysis

Prepared tissue sections were subjected to hematoxylin and eosin (H&E) staining. The sections were incubated in hematoxylin staining solution (Cat. No. G1005; Servicebio, Wuhan, China) for 3 min and then rinsed thoroughly with tap water. Differentiation was performed using hematoxylin differentiation solution for 5 s, followed by washing with tap water. The slides were subsequently treated with hematoxylin bluing reagent for 5 s and rinsed again. A graded ethanol dehydration was performed using 85% ethanol for 5 min, followed by 95% ethanol for another 5 min. The sections were then stained with alcohol-soluble eosin solution for 5 min and dehydrated with absolute ethanol for 5 min. Finally, the slides were cleared twice in xylene for 5 min each time and mounted with neutral resin for microscopic observation. To directly observe the peritendinous tissue adhesion, collagen fiber arrangement, and the extent of vascular proliferation, tissue sections were imaged using a high-performance optical microscope (Leica DMR 3000; Leica Microsystems, Bensheim, Germany). Similarly, tissue sections were processed with Masson's trichrome staining (Gat. No. G1340; Solarbio, Beijing, China), and the collagen content within each visual field was quantified using ImageJ. Periodic acid Schiff staining (PAS,Gat. No. C0142S; Beyotime, Shanghai, China) was mainly employed to visualize the vascular basement membrane, capillary walls, and glycoprotein and mucopolysaccharide components within the connective tissue under light microscopy.

2.8. Cell extraction and culture

Two cell types were used in this study: rat tenocytess and rat vascular endothelial cells. Tenocytes were derived from SD rats’ flexor tendon, and the vascular endothelial cells (RBMECs) were purchased by the BNCC company (Suzhou, Jiangsu, China). For tenocyte isolation, healthy 6-week-old rats were euthanized, sterilized with 75% alcohol after euthanasia and waited for disinfection, then the rats were placed on a ventilated clean table, separated and cut the tendons with high-temperature sterilized scissors and forceps, and 6 medium dishes were prepared, an appropriate amount of sterile PBS, 100 mg/mL streptomycin and 100 U/mL penicillin mixture were put into the dishes, the tissue pieces were minced into chyme in the dish, washed more than 6 times, and then 5 mg/mL collagenase I liquid was put into the dish for digestion for 2 h. Finally, the tissue block was filtered out with a 70 μM filter, and the remaining liquid was centrifuged at 1200 rpm for 5 min, and then cultured for subsequent use.

2.9. Transfection efficiency of PLGA nanoparticle complexes

Before transfection, tenocytes and endothelial cells were inoculated in 24-well plates in equal numbers and then transfected when cell confluence reached approximately 70%. Fresh plasmid/nanoparticle containing medium (1mL/well) was used to replace the original medium. After incubation for 8 h in the cell culture incubator, green fluorescence was observed by fluorescence microscope. In addition, the transfection efficiency was detected by flow cytometry (Attune NxT, invitrogen).

2.10. Cell counting Kit-8

Cell Counting Kit-8 (CCK-8) method (Vazyme, Nanjing, Jiangsu, China) was used to detect the difference of cell viability of endothelial cells and tenocytes with different transfection. The two kinds of cells were evenly inoculated in 96-well plates, and when the cell density reached about 70%, the transfection treatment was performed. After incubation for 48 h, 90 μL of cell culture medium and 10 μL of 10 × CCK-8 solution was added to each well under a dark environment. The plates were then incubated in a cell culture incubator for 2 h. The plates were then incubated for 2 h in a cell culture incubator. Subsequently, the absorbance at 450 nm was measured using SpectraMax M5 (MDC, Sunnyvale, CA, USA).

2.11. 5-Ethynyl-20-deoxyuridine assay

Cell proliferation was evaluated using a 5-ethynyl-2′-deoxyuridine (EdU) assay kit (RiboBio, Guangzhou, China) according to the manufacturer's instructions. Cells were seeded in 96-well plates and transfected as described for the CCK-8 assay. Briefly, cells were incubated with 100 μL of 5-ethyl-20-deoxyuridine for 2 h at 37°, and then washed three times with PBS, fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton X-100.100 μL of Apollo staining dye was added to each well for 30 min at room temperature, followed by nuclear staining with Hoechst solution for 30 min. Images were acquired using a fluorescence microscope (LeicaDMR3000; Leica Microsystem, Bensheim, Germany) and the proportion of EdU-positive cells was quantified using ImageJ.

2.12. Wound healing assay

Cells were digested and seeded into 6-well plates. When the cells grew stably to 80% of the field of view, the tip of a sterilized pipette gun was used to make transverse scratches in the well plates, and the cell fragments were rinsed with PBS and then observed and photographed under the microscope as 0 h. We continued to observe and retain images after 24 h, 48 h. Fiji imageJ software was used to convert the images into data for analysis.

2.13. Cell cycle analysis

Tenocytes and endothelial cells were transfected for 48 h, harvested by trypsinization, centrifuged, and resuspended in 50 μL PBS. Cells were then fixed by adding 900 μL of pre-cooled 70% ethanol dropwise while gently vortexing. The treated cells were stored at −20 °C for 3 days. When time was up, the cells were removed and centrifuged, the supernatant was discarded, the cells were washed three times with PBS and then stained with PI stain for 20 min, the supernatant was centrifuged and discarded, and the cells were resuspended with 400 μL of PBS, and then finally detected by a flow cytometer (Attune NxT, Invitrogen).

2.14. Tube formation assay

Matrigel (KeyGenBioTECH, Nanjing, Jiangsu, China) was taken from the −80 °C refrigerator one day in advance and put it in the 4 °C refrigerator overnight. First, the Matrigel was mixed and diluted with the basal medium at a ratio of 1:1, and 40 μL of the mixture was taken and dropped in the center of the 24-well plate and drawn in a circle with a wall to make it spread out and placed in the incubator at 1 h to wait for solidification. The digested endothelial cells were counted by resuspension with DMEM containing 10% FBS and each well was inoculated with approximately 5 × 10⁵ endothelial cells. The cells were incubated in an incubator at 37 °C with 5% CO₂. Photographs were taken at 2 h, 4 h, 6 h, 8 h, and 12 h at three different angles selected under the high magnification field of view. Finally, the images were processed and analyzed with Fiji imageJ software.

2.15. Co-culture in vitro

Tenocytes were uniformly seeded into 24-well plates, followed by incubation with the conditioned medium obtained from pre-treated endothelial cells to establish an indirect co-culture system. The incubation procedure was repeated daily for 48 h. Subsequently, the proliferation-related activities of the co-cultured tenocytes were assessed through CCK-8, EdU, and scratch wound assays.

2.16. Exosome culture, isolation and inhibition workflow

Endothelial cell lines were evenly seeded in large culture dishes and treated with pEGFP-N1 and pEGFP-Muc1, respectively. After 12 h, the medium was replaced with serum-free cell culture medium, followed by another 24 h of incubation. The cell supernatant was then collected and centrifuged at 500 g for 5 min. The resulting supernatant was further centrifuged at 3000 g for 10 min, and the process was repeated at 10,000 g for 30 min. Subsequently, an exosome extraction reagent (Yeasen Biotechnology (Shanghai) Co., Ltd) was added to the supernatant, and the mixture was incubated overnight at 4 °C on a shaker. The mixture was centrifuged again the next day for 1 h, and the resulting exosome pellet was resuspended in 100 μL sterile PBS for subsequent experiments. To inhibit exosome production, endothelial cells were treated with GW4869 (BeyoExo™, Beyotime, Shanghai, China) at a final concentration of 10 μM for at least 24 h before supernatant collection.

2.17. The transcriptome sequencing and mass spectrometry

Total RNA was extracted from endothelial cells transfected with either the empty vector pEGFP-N1 or the Muc1 overexpressing plasmid pEGFP-Muc1, as well as from tenocytes co-cultured with pEGFP-N1 or pEGFP-Muc1 transfected endothelial cells, using Trizol reagent (Life Technologies Ltd, Paisley, UK). After passing quality control, the samples were subjected to transcriptome sequencing on the Illumina HiSeq 2500 platform to obtain mRNA expression profiles. Differentially expressed genes resulting from Muc1 overexpression were identified using the criteria of an absolute log2 fold change ≥0.5 and a p-value <0.05.

Serum-free conditioned media from endothelial cells were collected after 48 h and sequentially centrifuged (500 g/5 min, 3000 g/10 min, 10,000 g/30 min) to remove debris. After thawing, samples were lysed in 8M urea buffer with protease inhibitors, sonicated, and centrifuged (15,000 g/10 min) for protein quantification (BCA). Two digestion approaches were employed: (1) TCA precipitation (20% TCA, acetone washes, TEAB resuspension) and (2) FASP using centrifugal filters, both including protein reduction (5 mM DTT/56 °C/30 min), alkylation (15 mM IAA/15 min/dark), and trypsin digestion (1:50, 37 °C/overnight + 1:100/4 h for FASP). Resulting peptides were acidified (10% TFA), desalted (Strata X), quantified (Pierce), vacuum-dried, and TMT-labeled (100 mM HEPES/1h/RT). After hydroxylamine quenching, samples were fractionated by high-pH HPLC (Agilent 300Extend C18, 54-min 6-32% acetonitrile gradient into 16 fractions). LC-MS/MS was performed using either DDA (Easy-nLC 1200/Q Exactive HF-X, 40-min, 7-80% gradient, TOP-20 HCD) or DIA (Vanquish Neo-Astral, 380-980 m/z MS1). Data was processed in MaxQuant (DDA) or DIA-NN (DIA) against the UniProt database, applying tryptic cleavage rules (≤2 missed cleavages), fixed carbamidomethylation, variable modifications (oxidation, acetylation), and a 1% FDR. Bioinformatics analysis included GO annotation, KEGG pathway mapping, DEP cluster analysis (Z-score transformed -log10 p-values), and PPI network construction (STRING, confidence >0.7, visNetwork). The proteomic workflow was validated by Cosmos Wisdom (Zhejiang, China).

2.18. Western blot

We performed this experiment on cells and tissues. To prepare cell and tissue lysates, we added protein lysis buffer containing RIPA and PMSF to the samples on ice and subsequently scraped the cells with a small spatula or ground the tissues well in a grinder. After steps such as centrifugation to remove the supernatant, the final protein lysate was mixed with 5-fold upwelling buffer and boiled for 5 min. The protein lysate was then transferred to an SDS/PAGE gel (12%) and separated at 120 V. After separation, the gel was transferred onto a polyvinylidene fluoride (PVDF) membranes at 4 °C, 350 mA for 45 min. The membrane was then closed with a high-efficiency sealing solution for 20 min, and the membrane was incubated with a specific primary antibody (mouse anti-GAPDH antibody (Proteintech, Rosemont, IL, USA), mouse anti-β-actin antibody (Proteintech), and rat anti-Muc1 antibody (Abcepta Biotech Ltd.) and some other antibodies. Incubation was performed overnight at 4 °C. Finally, membranes were incubated for 2 h at room temperature using a secondary antibody (anti-rabbit/mouse IgG coupled to IRDye800 (1:10,000, Rockland, Gilbertsville, PA, USA)). Membranes were visualized and quantified using an Odyssey infrared imaging system (LI-COR, Lincoln, NE, USA).

2.19. Real-time qPCR

Total RNA from rat tenocytes stimulated by overexpression of Muc1 plasmid was extracted with Trizol reagent (Invitrogen, California, America). Complementary DNA was synthesized according to the protocol of PrimeScript RT kit (Vazyme, Nanjing, Jiangsu, China). Real-time quantitative polymerase chain reaction (qPCR) was used to detect the expression of Muc1 gene. The reaction system was performed according to the protocol of Vazyme. The primer sequences used were as follows.

β-actin-F: CCGTAAAGACCTCTATGCCAACA;
β-actin-R: GCTAGGAGCCAGGGCAGTAATC;
Muc1-F: CACTCACGGACGCTATGTGC;
Muc1-R: GTTGGCCGAAGTGGTTGC;
PDGFA-F: GAAGCCATTCCCGCAGTT;
PDGFA-R: CTTGAGGGCTGGCACTTGA.

2.20. Design and synthesis of PDGFA siRNAs

To target the PDGFA gene, we designed and synthesized three double-stranded siRNAs using the gene sequence of PDGFA. Zhongmei Ruikang Nucleic Acid Technology (Nantong, China.) assisted us with the synthesis process. The PDGFA siRNAs sequences are provided in Table 1.

Table 1.

Oligonucleotide sequences of three designed siRNAs targeting PDGFA.

siRNA strands	Oligo sequence
r-PDGFA-si1	sense (5′-3′)	CGACUCUUGGAGAUAGACUCC
r-PDGFA-si1	antisense (5′-3′)	AGUCUAUCUCCAAGAGUCGCU
r-PDGFA-si2	sense (5′-3′)	GACGGUCAUUUACGAGAUATT
r-PDGFA-si2	antisense (5′-3′)	UAUCUCGUAAAUGACCGUCTT
r-PDGFA-si3	sense (5′-3′)	GGAAGAAGCCAAAAUUGAAAG
r-PDGFA-si3	antisense (5′-3′)	UUCAAUUUUGGCUUCUUCCUG

Open in a new tab

siRNA, small interfering RNA; PDGFA, platelet-derived growth factor subunit A

2.21. Immunohistochemistry experimental methods

The tissues were embedded in paraffin and serially sectioned using a microtome to a thickness of 5 μm. After standard pretreatment such as deparaffinization, rehydration and antigen retrieval, sections were subjected to immunohistochemical staining. The specific procedures are as follows: After the sections are treated with blocking solution, the Col III antibody are incubated at 4 °C, the dilution ratio is 1:200, and the incubation is overnight. The next day, sections were incubated for 2 h at 37 °C with secondary antibodies from the respective species. Immunoresponse signals were developed using 3,3′-diaminobenzidine (DAB) chromogenic kit. The nuclei were subsequently counterstained with hematoxylin. After staining, the slides were dehydrated, transparent and finally sealed with neutral gum. The staining results were observed using a light microscope and images were collected.

2.22. Statistical analysis

Descriptive statistics were presented as the mean values ± the standard deviation (means ± SD). Data were analyzed using Graphpad Prism 10 software. Independent samples t-test was used for comparison between two groups and one-way analysis of variance (ANOVA) was used to determine statistical significance for comparison between multiple groups. Experimental data were considered statistically significant when P < 0.05.

3. Results and discussion

3.1. Overexpression of Muc1 contributes to tendon healing

The repair of tendon injury is a highly complex and precisely regulated biological process that typically involves several sequential phases, including the inflammatory response, cell proliferation and migration, ECM deposition, and subsequent tissue remodeling [14]. Each phase is orchestrated by distinct cell populations and signaling molecules, whose intricate interactions play a decisive role in determining the final outcome of tendon healing. To effectively regulate the post-injury microenvironment, it is essential to understand the dynamic pattern of natural tendon healing and apply targeted interventions at critical stages to promote tissue regeneration and functional recovery. In our preliminary experiments, we examined and quantitatively analyzed the expression of Muc1 at different time points during tendon healing using tissue sections (Supplementary Fig. 1A and B). The results revealed a significant temporal fluctuation in Muc1 expression: Muc1 staining intensity dropped sharply by day 10 after injury and was further diminished at day 20 compared with uninjured tendons (Fig. 1A). To further explore the relationship between angiogenesis and tissue repair, we simultaneously evaluated the expression levels of the vascular markers CD31 and VEGF-A (Fig. 1B and C). Immunofluorescence staining and quantitative image analysis were performed, and the corresponding statistical histograms were generated (Fig. 1D). The results showed that CD31 expression remained elevated at day 20 post-injury, suggesting that angiogenic activity persisted at this stage, whereas VEGF-A expression peaked at day 10 and subsequently declined, indicating that angiogenic signaling was activated during the early phase and gradually stabilized thereafter. Proteins were extracted from the rat tendon stumps, and Western blot analysis revealed a significant decrease in Muc1 expression at day 20, providing an experimental basis for the design of subsequent animal experiments (Fig. 1E and F). Taken together, these findings demonstrate the temporal expression patterns of Muc1 and angiogenesis-related markers during tendon repair, suggesting that they may act in concert at different stages of the healing process, thereby providing a basis for further mechanistic investigations. Based on these findings, we hypothesized that maintaining an appropriate level of Muc1 expression during the early phase of tendon injury may positively influence the repair process. To validate this hypothesis, we introduced a pEGFP-Muc1/nanosphere sustained-release system at the onset of injury, aiming to restore and maintain stable local Muc1 levels around the injured tendon. Finally, tissue samples were collected at days 10 and 20 post-injury to assess the effects of this intervention on healing outcomes.

Fig. 1 — **The expression of Muc1, CD31, and VEGF-A at different time points after tendon injury.** (A-C)Immunofluorescence images of Muc1, CD31, and VEGF-A at different time points after tendon injury; (D) Quantitative analysis of A-C (n = 3); (E) Protein expression of Muc1 at 20 d after tendon injury; (F) Quantitative analysis of E (n = 3). ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

3.1.1. Construction of a sustained-release gene delivery platform and in vivo model

To investigate the role of vascular remodeling in tendon healing and to verify the therapeutic potential of Muc1, we first conducted in vivo experiments and simultaneously developed and characterized a nanoparticle-based delivery system in vitro. Specifically, the pEGFP-Muc1 plasmid was encapsulated into PLGA nanoparticles for transfection of isolated tenocytes. PCR analysis confirmed that pEGFP-Muc1 successfully mediated the overexpression of Muc1. For material characterization, SEM was employed to observe the morphology and dispersion of PLGA nanoparticles, pEGFP-N1/nanoparticle complexes, and pEGFP-Muc1/nanoparticle complexes (Fig. 2A). In addition, DLS was used to determine the particle size distribution (Fig. 2B). The results showed that the average particle size of PLGA nanoparticles was 184.10 ± 0.73 nm, whereas the pEGFP-N1/nanoparticle and pEGFP-Muc1/nanoparticle complexes exhibited average particle sizes of 208.00 ± 0.96 nm and 213.83 ± 2.45 nm, respectively. Zeta potential measurements indicated that the unmodified nanoparticles carried a positive charge of approximately 25.11 mV, which increased to 32.77 mV after loading with pEGFP-Muc1. Furthermore, a 20-day plasmid release assay demonstrated that both complexes exhibited a typical sustained-release profile: an initial burst release within the first 2 days, followed by a gradual slowdown, and a plateau phase beginning after around 10 days. Overall, the N1 group showed a slightly higher cumulative release ratio than the Muc1 group, but both displayed similar release trends, with final release rates approaching 80% (Fig. 2C). These results indicate that PLGA nanoparticles enable continuous and controllable plasmid release, providing a stable carrier platform for subsequent gene delivery. In addition, a gel retardation assay was performed to evaluate the plasmid loading efficiency of the nanoparticles (Fig. 2D). Collectively, these findings confirm the successful formation of stable complexes and reveal significant alterations in colloidal stability and interfacial properties, establishing a solid physicochemical basis for efficient gene delivery.

Fig. 2 — **Characterization of PLGA nanoparticles and transfection efficiency of Muc1 plasmid in vitro and in vivo.** (A)Transmission Electron Microscopy images of PLGA nanoparticles; (B) Particle size and zeta potential measurements of empty PLGA nanoparticles, N1 plasmid-loaded PLGA nanoparticles, and Muc1 plasmid-loaded PLGA nanoparticles; (C) Release efficiency of N1 plasmid-loaded PLGA nanoparticles and Muc1 plasmid-loaded PLGA nanoparticles; (D) Optimization of PLGA nanoparticle to plasmid ratio; (E) Transfection efficiency of N1 plasmid-loaded PLGA nanoparticles and Muc1 plasmid-loaded PLGA nanoparticles in tenocytes; (F) Transfection efficiency of N1 plasmid-loaded PLGA nanoparticles and Muc1 plasmid-loaded PLGA nanoparticles in endothelial cells; (G) In vivo transfection efficacy of Muc1 plasmid-loaded PLGA nanoparticles at different time points after tendon injury, as demonstrated by immunofluorescence staining.

To further verify the transfection efficiency, the plasmids were mixed with the nanoparticles and incubated for 15 min before being used to transfect tenocytes and endothelial cells. Under a fluorescence microscope, cells transfected with the pEGFP-Muc1/nanoparticle complexes exhibited distinct green GFP fluorescence. Flow cytometry analysis quantitatively showed that the transfection efficiency in tenocytes was 22.75%, while that in endothelial cells was higher, reaching 48.61% (Fig. 2E and F). In animal tissues, the colocalization of the green GFP signal with the red Muc1 immunofluorescence signal further confirmed effective in vivo transfection and expression (Fig. 2G). Collectively, these results demonstrate that the pEGFP-Muc1/PLGA nanoparticle delivery system achieved efficient gene delivery and expression both in vitro and in vivo, thereby establishing a reliable platform for subsequent studies and therapeutic evaluation of Muc1-mediated vascular remodeling and tendon repair.

The experimental duration was set at 20 days. In the animal model, the flexor tendon of rats was transected and repaired using a modified Kessler suture technique along with the superficial tendon bundle and associated muscle attachments. Thereafter, pEGFP-Muc1/PLGA nanoparticles were injected into four quadrants surrounding the tendon defect using a microinjection technique. On postoperative days 10 and 20, tendon tissues and adjacent muscles were collected for range of motion (ROM) assessment (Fig. 3A). After dissecting the rat's palm to observe internal healing conditions (Fig. 3B), biomechanical testing was performed. Functional results showed significant improvement in the intervention group: on day 10, when the applied load increased from 0 N to 20 N, the ROM values of the untreated control group (50.25° ± 4.27°) and the pEGFP-N1/PLGA nanoparticle group (48.17° ± 8.54°) were both significantly lower than that of the pEGFP-Muc1/PLGA nanoparticle group (54.92° ± 6.46°). By day 20, the ankle joint mobility in the Muc1 intervention group (51.20° ± 4.09°) remained superior to that of the control group (48.33° ± 5.53°) and the N1 group (44.5° ± 4.00°) (Fig. 3C). As described above, tendon repair is initiated immediately after injury, with the first week characterized by an acute inflammatory response. Vascular disruption at the injury site leads to bleeding and hematoma formation, which subsequently triggers the release of inflammatory mediators, including cytokines and chemokines. During the proliferative phase, approximately 1–3 weeks, fibroblasts migrate into the damaged area, proliferate, and secrete ECM components such as type I and III collagen, fibronectin, and other structural proteins [15]. This results in the formation of provisional granulation tissue. Simultaneously, neovascularization provides the injured tendon with oxygen and nutrients essential for supporting the repair process [16].

Fig. 3 — **Therapeutic effects of Muc1 plasmid-loaded PLGA nanoparticles on tendon injury in rats.** (A) Typical images of flexion angle of tendons in different groups at 0, 5, 10, 15, 20 g at day 10 and 20; (B) Typical images of the repaired tendons in different groups at day 10 and 20. (C) The analysis of flexion angle change of repaired tendons in different groups at day 10 and 20 (n = 12); (D) Maximum load of tendons in different groups at day 10 and 20 (n = 9); (E) H&E staining of tendon tissues in different groups at day 10 and 20; (F–G) Protein expression levels of MMP-2, MMP-9, and TIMP-1 at day 10 and their quantitative analysis (n = 3); (H–I) Protein expression levels of MMP-2, MMP-9, and TIMP-1 at day 20 and their quantitative analysis (n = 3). ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

To directly assess tissue-level differences in adhesion severity, inflammatory response, and collagen fiber organization, we performed layer-by-layer dissection and documented the healing morphology. As shown in Fig. 3B, by day 10 post-injury, the Muc1 group exhibited denser subcutaneous tissue and reduced swelling compared with the control and N1 groups. Furthermore, the intermediate fibrous layers displayed more orderly alignment, indicating better structural recovery. The innermost tissue adjacent to the flexor tendon also showed a closer in color to normal tissue. The overall tendon healing appeared superior in the Muc1-treated group. By day 20, all three groups displayed relatively comparable subcutaneous healing without apparent scarring. Nevertheless, the peritendinous tissue in the Muc1 group remained clearer, with less adhesion and more tightly aligned fibers. Comparisons between day 10 and day 20 revealed that Muc1 treatment notably enhanced tissue elasticity and resilience. To better observe the degree of peritendinous adhesion in each group, immunohistochemical staining for type III collagen was performed to more intuitively evaluate peritendinous adhesion. The results showed that, at all time points, the content of type III collagen in the experimental group was lower than that in the other two groups (Supplementary Fig. 3A). At the mechanistic level, the unique transmembrane structure of Muc1 confers multiple biological functions. Its glycosylated extracellular domain effectively blocks the recognition of pathogens and damage-associated molecular patterns (DAMPs) [17], thereby reducing exogenous and endogenous danger signals to host cells. Meanwhile, its intracellular tail suppresses the overactivation of inflammatory signaling pathways (such as TLR/MyD88/NF-κB) through negative feedback, consequently decreasing the release of pro-inflammatory cytokines (e.g., TNF-α, IL-6, IL-8) [18]. Moreover, studies have demonstrated that Muc1 inhibits ASC oligomerization, thereby preventing caspase-1-dependent maturation of IL-1β. Collectively, Muc1 most likely reduces inflammatory cell infiltration and limits the formation of fibrotic adhesions through these effects, thereby optimizing the inflammatory response and creating a more favorable environment for subsequent tissue repair. These histological findings are consistent with the range of motion (ROM) evaluation, further supporting that the Muc1 group exhibited better joint mobility during the later stages of repair. For a more intuitive evaluation of the surgical outcome, tendon end-to-end reconnection was classified and summarized (Table 2).

Table 2.

The elastic modulus of tendons and the number of tendons about the gapping.

Group	Gapping grade^a (0/1/2)	Elastic modulus (N/mm)
10DAY
Control	(4/4/1)	7.1 ± 1.7
N1	(4/3/2)	9.3 ± 4.7
Muc1	(5/2/2)	12.9 ± 5.7
20DAY
Control	(4/3/2)	26.9 ± 7.6
N1	(6/2/1)	28.4 ± 7.5
Muc1	(4/3/2)	38.2 ± 3.8

Open in a new tab

The gapping of healing tendon was classified as three grades: 0, no gapping; 1, the distance of gapping was 0–2 mm; and 2, the distance of gapping more than 2 mm.

To further investigate functional integrity, we conducted maximum load-to-failure testing across groups. On day 10, no significant difference was observed between the control and N1 groups; however, the maximum tensile strength of the Muc1 group was significantly higher than that of the control group (p = 0.022). By day 20, the maximum tensile strengths for the control, N1, and Muc1 groups were 26.5 ± 7.17 N, 27.92 ± 7.12 N, and 37.90 ± 3.69 N, respectively (Fig. 3D). These results indicate that Muc1 exerted positive effects during both the early and late phases of tendon repair, improving ultimate tensile strength by 43% compared with the control group and by 36% compared with the N1 group. During tendon repair, collagen types I and III play complementary and essential roles. In the early phase of healing, collagen type III is rapidly synthesized as the predominant temporary matrix [19], forming a soft fibrous framework that stabilizes the injury site and initiates the repair process, although its mechanical strength is relatively weak. As healing progresses into the maturation and remodeling stages, collagen type I is synthesized in large amounts and gradually replaces collagen type III. Although tendons are composed of various types of collagen and non-collagenous proteins, type I collagen accounts for approximately 95% of the total collagen content in tendons and 65–80% of their dry weight [20]. An ideal tendon repair involves the successful transition from collagen type III to collagen type I predominance. The dynamic balance between these two types of collagen serves as a critical indicator for evaluating the quality and maturity of tendon healing (Supplementary Fig. 2C).

In the subsequent histological processing, three rat feet from each group were randomly selected for paraffin embedding. One foot was prepared for transverse sections and two for longitudinal sections, with all sections cut at a thickness of 5 μm. In the control group, one transverse and one longitudinal section were prepared. H&E staining revealed that, compared with the other two groups, the pEGFP-Muc1 group exhibited markedly reduced inflammatory cell infiltration, clear nucleoli, and enlarged nuclei, indicating more active cell proliferation. Sections from all three groups showed overall regular cell arrangement without obvious disorganization (Fig. 3E). Since Muc1 primarily acts on vascular endothelial cells, the study focused on the process of angiogenesis. In the experimental groups, newly formed capillaries were observed around the pores, characterized by small lumens and thin vessel walls. Further observation revealed that, in the pEGFP-Muc1 group, neovessels at 20 days postoperatively were more mature than those at 10 days, with thicker vessel walls and a more stable morphology. Previous studies have indicated that the function of the Muc1 glycocalyx protein exhibits pronounced spatiotemporal specificity and environmental dependence: in the early stage of injury (within 7 days), Muc1 promotes vascular sprouting by upregulating VEGF and HIF-1α [21]; in the intermediate stage (within 2 weeks), it maintains vascular stability and maturation by recruiting pericytes and regulating macrophage polarization; and in the late repair stage (beyond 2 weeks), it facilitates partial vascular regression to preserve microenvironmental homeostasis. Meanwhile, as the nanosphere delivery system is gradually absorbed and inactivated by the tissue, it helps to avoid abnormal vascular structures or malformed tissue that could result from prolonged high-level expression [22]. Additionally, In our study, Muc1 treatment resulted in a significant upregulation of MMP-2 and MMP-9 within tendon tissue. Although excessive MMP activity could theoretically drive disproportionate matrix degradation and compromise mechanical integrity, the available experimental evidence indicates that Muc1 did not induce structural deterioration or mechanical impairment. On the contrary, histological analysis revealed improved collagen organization, and the Muc1-treated group exhibited a marked increase in tensile strength.

Tendon healing is known to proceed via both intrinsic repair, mediated by resident tenocytes, and extrinsic repair, driven by fibroblasts from peritendinous adhesions. The observed elevation of MMP-2 and MMP-9 in our model may therefore reflect not only the clearance of disorganized ECM within the tendon proper but also remodeling processes associated with reduced peritendinous adhesion tissue. Consequently, we interpret the increased MMP-2/9 expression as indicative of controlled, beneficial matrix remodeling rather than simple matrix degradation. MMP-2 and MMP-9 likely facilitate the removal of damaged, disarrayed, or excessive matrix components, thereby creating a permissive environment for new collagen deposition and more orderly matrix reconstruction. When matrix synthesis, alignment, and maturation outpace degradation, the overall tissue architecture can become more organized, with corresponding gains in mechanical performance. Moreover, tendon strength is determined not merely by ECM quantity but also by collagen fiber alignment, density, maturation state, and cross-linking. Thus, even if portions of the matrix are degraded, tensile strength can still increase if the remodeled collagen network is more ordered and mature.

Ultimately, tendon ECM homeostasis and healing outcomes are governed not by the expression of individual MMPs but by the dynamic equilibrium between MMPs and TIMPs [23]. Prior studies have shown that MMP-2 and MMP-9 are markedly upregulated in ruptured tendons, whereas TIMP expression does not necessarily change in parallel, suggesting that the remodeling outcome depends more on shifts in the MMP/TIMP ratio than on MMP elevation alone [24]. Consistent with this concept, our Western blot analysis demonstrated increased MMP-2 and MMP-9 in the Muc1-treated group, while TIMP-1 displayed an upward trend at day 20 that did not reach statistical significance (Fig. 3F–I).

3.1.2. Characterization of peritendinous vascular microenvironment after injury

To further validate our hypothesis, PAS staining was performed on tissue sections to assess angiogenic changes around the injection site. The results demonstrated significant neovascularization in the experimental group, accompanied by obvious thickening of the vascular walls, suggesting enhanced vascular maturation and stability in the local microenvironment (Fig. 4A). This alteration may be associated with the upregulation of Muc1, which enhances pro-angiogenic signaling and leads to the coordinated activation of endothelial cell proliferation, migration, and pericyte recruitment. Consequently, a structurally integrated and functionally stable neovascular network is formed. The observed thickening of vascular walls typically indicates basement membrane reconstruction and increased pericyte coverage, which not only help maintain vascular permeability stability but also create a more favorable microenvironment for nutrient supply and cellular migration during subsequent tendon regeneration. Therefore, these histological findings further confirm the effectiveness of Muc1 in promoting local vascular regeneration and improving the reparative microenvironment.

Fig. 4 — **Angiogenic effects of Muc1 plasmid-loaded PLGA nanoparticles in treating tendon injuries in rats.** (A) PAS staining of blood vessels in tendon tissues from different experimental groups; (B) Immunofluorescence staining images of CD31 and α-SMA in blood vessels from tendon tissues of different experimental groups; (C) Immunofluorescence staining images of CD31 and Col IV in blood vessels from tendon tissues of different experimental groups.

CD31 is a pan-endothelial marker that reflects total microvessel density (MVD). In the early stage of tendon injury, the tissue is in a state of ischemia and hypoxia, and angiogenesis is critical for repair [25]. CD31-positive endothelial cells indicate the formation of new capillaries, which provide oxygen and nutrients to the injured site. It is well established that CD31 expression increases progressively after injury, reaching its peak at 3 weeks. Immunofluorescence analysis revealed that CD31 expression was stronger in the pEGFP-Muc1-treated group compared with the other two groups (Fig. 4B). Immunofluorescence analysis of α-smooth muscle actin (α-SMA) showed that: Specifically, in the late stage of injury, α-SMA levels were significantly increased compared with the early stage in both groups. Moreover, although α-SMA-positive signals were most prominent in the experimental group, the difference compared with the other two groups was not statistically significant. α-SMA mainly originates from activated tendon fibroblasts, myofibroblasts, and cells stimulated by local inflammatory responses or specific growth factors following injury. During the myofibroblast activation phase (7–21 days after injury), α-SMA-positive cells proliferate extensively, driving ECM synthesis and early scar formation. At 20 days post-injury, the experimental group exhibited stronger α-SMA-positive signals, likely due to Muc1-mediated remodeling of the microenvironment; this phenomenon may serve as supporting evidence of the proposed mechanism (Fig. 4B). This hypothesis is not unfounded. In addition to regulating inflammatory responses and promoting angiogenesis, Muc1 may also indirectly influence α-SMA expression by modulating the TGF-β–dependent fibrotic pathway [26,27]. Furthermore, type IV collagen, as a key component of the extracellular matrix, plays a central role in tissue repair and regeneration. Located in the basement membrane, it provides structural support for cells and participates in various physiological processes, including proliferation, differentiation, and migration. In the early stage of tendon healing, type IV collagen promotes angiogenesis. Consistent with our findings, co-localization analysis has clearly demonstrated that type IV collagen facilitates vascularization during the initial phase of healing. Specifically, type IV collagen promotes angiogenesis in tendon healing through integrins α1β1 and α2β1 [28], which was corroborated by the synchronous overexpression of CD31 observed in 10-day tissue samples. As the healing process progresses, the original extracellular matrix is gradually degraded and replaced by newly formed tissue. Type IV collagen may participate in this process by establishing a microenvironment favorable for regenerative healing (Fig. 4C).

3.2. Cellular insights into pEGFP-Muc1: remodeling the microenvironment in vitro

Based on our preliminary experiments, we confirmed the positive in vivo effects of the transmembrane protein Muc1 on flexor tendon healing in rats. To further elucidate the underlying mechanisms, we conducted a series of studies focusing on cell-specific functions. We first examined the transfection efficiency of nanosphere-loaded plasmids in both tenocytes and endothelial cells. At 48 h post-transfection, proteins were extracted from the two cell types and analyzed by Western blot assay. Band analysis revealed that the expression level of the target protein Muc1 was significantly higher in endothelial cells compared with both the control and N1 groups (P = 0.0162, P = 0.0194) (Fig. 6A and B). Although Muc1 expression was also detected in tenocytes, the expression level was relatively lower, a finding that was largely consistent with the transfection efficiency measured by flow cytometry (Fig. 5A and B). This difference may be related to the varying sensitivity of different cell types to plasmid uptake and transcriptional–translational efficiency, and may also be closely associated with the number of receptors on the endothelial cell surface, the extracellular matrix environment, and the intrinsic role of endothelial cells as the natural target of Muc1.

Fig. 6 — **Effects of Muc1 plasmid transfection on endothelial cells.** (A) Detection of Muc1 expression levels in endothelial cells after Muc1 plasmid transfection by Western blot; (B) quantitative analysis of A (n = 3); (C) Cell viability was assessed by CCK-8 assay in different endothelial cell groups (n = 3); (D) Cell cycle analysis of endothelial cells from different experimental groups; (E-F) Analysis of S-phase and G1-phase data in D (n = 3); (G) Scratch assay comparing tenocyte migration between treatment groups; (H) Quantitative analysis of G (n = 3); (I-J) Representative EdU staining images of tenocytes from different experimental groups and Quantitative analysis (n = 3); (K) Angiogenesis images of endothelial cells from different experimental groups and Number of master junctions, number of nodes and total length analysis. (L) Representative immunofluorescence staining of Col IV in endothelial cells from different treatment groups. ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Fig. 5 — **Effects of Muc1 plasmid transfection on tenocytes.** (A) Detection of Muc1 expression levels in tenocytes after Muc1 plasmid transfection by Western blot; (B) Quantitative analysis of A (n = 3); (C) Cell viability was assessed by CCK-8 assay in different tenocyte groups (n = 3); (D) Scratch assay comparing tenocyte migration between treatment groups; (E) Quantitative analysis of D (n = 3); (F) Representative EdU staining images of tenocytes from different experimental groups; (G) Quantitative analysis of F (n = 3). ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

3.2.1. Muc1 and tenocytes: modulating matrix synthesis and fibroblast activity

We first assessed the proliferative activity of tenocytes following pEGFP-Muc1 transfection. CCK-8 assays revealed no significant differences among groups at 24 h; however, at 48 h and 72 h, cell viability in the pEGFP-Muc1 group was markedly higher than that in the control and N1 groups, suggesting that the promotive effect of Muc1 exhibits a certain temporal delay, likely due to the requirement for post-translational modifications and the cumulative activation of downstream signaling pathways (Fig. 5C). The scratch assay results revealed a significant difference only at 48 h post-transfection, while no noticeable changes were observed at the early (24 h) or late (72 h) time points (Fig. 5D and E). This finding suggests that the promotive effect of Muc1 on tenocyte migration is likely transient and phase-dependent. Such a pattern is consistent with the inherently low proliferative and migratory capacity of tenocytes, indicating that their response to exogenous stimuli may be constrained within a limited biological time window. In agreement with this, EdU assay results demonstrated that at 48 h post-transfection, the Muc1 group exhibited a significant increase in cell proliferation (Fig. 5F and G), indicating that Muc1 overexpression can transiently enhance the proliferative activity of tenocytes. However, this stimulatory effect did not persist over time, suggesting that the direct regulatory influence of Muc1 on tenocytes is relatively limited. Taken together, these findings suggest that although Muc1 can modestly promote the proliferation and migration of tenocytes, its primary biological targets are likely vascular endothelial cells. This interpretation aligns with previous reports highlighting the pivotal role of Muc1 in angiogenesis, regulation of endothelial function, and maintenance of the inflammatory microenvironment. Therefore, the contribution of Muc1 to tendon repair is more plausibly achieved indirectly by promoting vascular remodeling and modulating the local microenvironment rather than directly enhancing the intrinsic regenerative capacity of tenocytes.

3.2.2. Angiogenic potential of Muc1: driving endothelial cell activation

Similar to the previous experiments, we systematically evaluated the functional changes of endothelial cells after Muc1 transfection. The CCK-8 assay showed no significant differences in cell viability among the groups at 24 h; however, at 48 and 72 h, the Muc1 group exhibited significantly higher viability compared with the control and N1 groups (Fig. 6C). Cell cycle analysis further revealed that the proportion of cells in the S phase was markedly increased in the Muc1 group, indicating that Muc1 promotes the G1 to S phase transition, thereby accelerating DNA replication and cell proliferation (Fig. 6D–F). In the wound-healing assay, the Muc1 group displayed significantly enhanced migration at 24 h and 48 h compared with the other groups, while this difference disappeared at 72 h. This suggests that the pro-migratory effect of Muc1 primarily occurs during the early stage of repair, and may become masked once cells reach high density and confluence (Fig. 6G and H). The EdU assay corroborated these findings, showing a pronounced increase in DNA synthesis in Muc1-transfected endothelial cells, indicating enhanced cell proliferative activity (Fig. 6I and J). Regarding angiogenic capacity, the tube formation assay demonstrated that the Muc1 group had a significantly greater number of branching points and nodes, while the total tube length remained comparable to the control group (Fig. 6K). These results suggest that Muc1 enhances the branching and network connectivity of endothelial cells during the assembly of three-dimensional capillary like structures. This phenomenon reflects the ability of pEGFP-Muc1 to promote endothelial cell adhesion, migration, and alignment, thereby increasing the complexity and stability of capillary like networks. Collectively, these findings indicate that Muc1 promotes angiogenesis related functions by regulating endothelial cell proliferation, migration, and cell-cycle progression. In other words, the pronounced differences observed in the tube formation assay suggest that Muc1 plays a critical role in neovascularization, consistent with its proposed function in improving local blood supply and optimizing the microenvironment during tendon repair. Furthermore, immunofluorescence staining was performed to examine the expression of the extracellular matrix protein Collagen IV (Col4) (Fig. 6L). Under the red fluorescence channel, Col4 exhibited a characteristic reticular distribution around the cells, with markedly stronger red fluorescence signals in the experimental group. Compared with the control group, the Muc1 group displayed significantly increased Col4 fluorescence intensity, with more uniform and continuous distribution, indicating that Muc1 overexpression promotes the secretion and deposition of Col4. These results not only highlight the positive role of Muc1 in modulating extracellular matrix composition and remodeling, but also suggest that it may enhance tissue repair and cell adhesion by improving the structural integrity of the local microenvironment.

3.2.3. Amplifying tenocyte responses via pEGFP-muc1-endothelial interaction

To better simulate the microenvironment surrounding tendons after injury, we established two co-culture systems in which the supernatant from pEGFP-Muc1 treated endothelial cells was applied to tenocytes and compared with an N1-treated control group. CCK-8, EdU, wound-healing, and cell cycle assays were repeatedly performed to evaluate the functional changes of tenocytes under coculture conditions. The results showed that coculture markedly enhanced tenocyte proliferation. CCK-8 assays revealed that the cell viability in the Muc1 group was significantly higher than that in other groups (Fig. 7A), suggesting that paracrine factors secreted by pEGFP-Muc1 treated endothelial cells could activate tenocytes. Western blot analysis revealed increased TNMD expression (Fig. 7B), indicating a stronger tendon like phenotype associated with ECM remodeling and maturation. Wound healing assays in the coculture system (Fig. 7C and D) showed that the experimental group significantly accelerated the early scratch closure of tenocytes. EdU assays further confirmed this finding: compared with tenocytes directly transfected with Muc1, the coculture group exhibited stronger DNA synthesis and proliferative activity (Fig. 7E and F), highlighting the critical regulatory role of endothelial cells in this process and providing insight for subsequent experiments. Cell cycle analysis (Fig. 7G–I) showed that the S-phase fraction in the experimental group was markedly increased compared with the control group, reaching statistical significance. Together, these findings suggest that pEGFP-Muc1 treated endothelial cells mainly enhance tenocyte proliferation through paracrine signaling, while exerting limited effects on cell migration and cell cycle distribution.

Fig. 7 — **Effects of endothelial cell conditioned medium from different groups on tenocytes.** (A) Cell viability was assessed by CCK-8 assay in different medium-treated tenocyte groups (n = 3); (B) Detection of TNMD expression levels in different medium-treated tenocyte groups by Western blot and quantitative analysis (n = 3). (C) Scratch assay comparing tenocyte migration between different medium-treated tenocyte groups; (D) Quantitative analysis of D (n = 3); (E) Representative EdU staining images of tenocytes from different medium-treated tenocyte groups; (F) Quantitative analysis of E (n = 3); (G) Cell cycle analysis of endothelial cells from different experimental groups; (H-I) Analysis of S-phase and G1-phase data in G (n = 3). ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Further analysis revealed that co-culture substantially amplified the proliferative effect in tenocytes, a result that contrasts with direct transfection. A plausible mechanism is that pEGFP -Muc1 treated endothelial cells release a range of pro-repair factors via paracrine signaling, such as VEGF, PDGF, and TGF-β [29], which not only facilitate angiogenesis but also directly stimulate tenocyte proliferation and metabolic activity. In addition, pEGFP -Muc1 may remodel the profile of extracellular vesicles (exosomes) or soluble factors secreted by endothelial cells, thereby providing more favorable repair cues for tenocytes. Collectively, these findings suggest that tendon healing is not a single-cell process but rather depends on dynamic intercellular interactions. The effects of pEGFP -Muc1 in endothelial cells may be amplified through such cell–cell communication, thereby exerting a more pronounced influence on tenocyte proliferation.

3.3. Muc1 transfection enhances extracellular vesicle release from endothelial cells and uptake by tenocytes

To further explore the transcriptional alterations of tenocytes within the endothelial–tendon co-culture system, we first performed transcriptome sequencing of Muc1 transfected endothelial cells. The heatmap of differentially expressed genes (Fig. 8A) revealed a clear separation between groups at the transcriptomic level, while intra-group clustering was tight, demonstrating high data reproducibility. Compared with the control, several genes in the Muc1 group were significantly up-regulated (red) or down-regulated (blue), suggesting that Muc1 transfection remodels the global gene expression profile. These differentially expressed genes (DEGs) were mainly enriched in pathways related to angiogenesis and cell proliferation. The volcano plot (Fig. 8B) identified 106 up-regulated and 155 down-regulated genes, further confirming the significant transcriptomic impact of Muc1. The PPI network (Fig. 8C) revealed core hub genes involved in signal regulation. Functional enrichment analysis showed that GO terms (Fig. 8D) were predominantly associated with peptide transport and vesicle-mediated transport in synaptic processes, indicating that Muc1 may enhance vesicle-related activity in endothelial cells. KEGG pathway enrichment (Fig. 8E) demonstrated that DEGs were significantly enriched in the MAPK signaling pathway, suggesting that Muc1 might activate key regulatory cascades that promote vesicle secretion and intercellular communication.

Notably, SEM images (Fig. 8F) show that control transfected endothelial cells N1 (EC) display a rounded morphology with few short protrusions and membrane ruffles, whereas Muc1 (EC) cells become elongated/polarized with dense, long, interlaced filopodia/microvillus like protrusions along the cell edge and dorsal surface, consistent with extensive cytoskeletal remodeling and a pro-migratory phenotype. These results indicate a marked activation of leading-edge polarity and cytoskeletal remodeling. This morphological spectrum typically corresponds to a tip cell–like migratory/exploratory phenotype, providing the structural basis for sprouting angiogenesis. Muc1 may drive F-actin polymerization and membrane-protrusion extension via integrin–FAK/Src signaling and Rho GTPases (notably Cdc42 and Rac1) [30], and it crosstalks with TGF-β signaling: when Muc1-CT levels increase, TGF-β tends to shift toward pro-migratory programs in the noncanonical JNK/ERK arms and the Smad3 axis, thereby amplifying leading-edge adhesion–de-adhesion cycles and matrix sensing. Functionally, this is expected to manifest as increased migration speed, network branching, and tube-formation capacity [31]. On this basis, we measured the particle concentration (Fig. 8G). In the control group (N1-Exos), the particle concentration was 3.07 × 10⁶/mL; whereas in the Muc1 group (Muc1-Exos) the concentration was 4.00 × 10⁶/mL. By performing protein expression analysis of exosome-specific markers (CD9, CD63, and TSG101) on the isolated vesicles (Fig. 8I), the results showed positive expression of all these markers, thereby confirming that the isolated particles were exosomes. Furthermore, transcriptome analysis identified a set of up-regulated genes closely related to secretory functions (Fig. 8H). Among them, MCP-1 recruits monocytes and macrophages to mediate inflammation and tissue repair [32]; TMED5 is involved in protein transport from the endoplasmic reticulum to the Golgi apparatus and plays a crucial role in the secretory pathway [33]; DYNLL1 regulates vesicle trafficking via a microtubule-dependent mechanism, facilitating intracellular transport and secretion [34]. These findings suggest that Muc1 may enhance vesicle release capacity of endothelial cells by modulating key secretion-related molecules. Western blot analysis further confirmed the expression trends of these genes, consistent with the transcriptomic results, thereby reinforcing the reliability of the findings.

Transmission electron microscopy (TEM) images (Fig. 8J) confirmed the typical bilayered vesicular morphology of the isolated exosomes. Nanoparticle tracking analysis (NTA) determined the particle size distribution and concentration: the control (N1-Exos) averaged 120.27 ± 9.27 nm in diameter, while the Muc1 group (Muc1-Exos) averaged 116.2 ± 2.48 nm. These data demonstrate that Muc1 overexpression significantly promotes exosome release from endothelial cells. The green fluorescence of PKH67-labeled exosomes was widely distributed throughout the cytoplasm of tenocytes (Fig. 8K), demonstrating efficient exosome uptake and intracellular delivery of their molecular cargo.

3.4. Endothelial–tendon crosstalk regulated by Muc1: the role of PDGFA-enriched exosomes in tendon repair

Mass spectrometry analysis revealed that Muc1 transfection significantly increased the secretion of PDGFA in the endothelial cell supernatant (Fig. 9A). PDGFA is a crucial member of the PDGF family, typically functioning as a homodimer (PDGF-AA) or heterodimer (PDGF-AB) [35] that primarily binds to the PDGFRA receptor [36]. Upon receptor engagement, PDGFA activates multiple downstream signaling pathways, including PI3K/AKT, MAPK/ERK, and JAK/STAT cascades [37], thereby regulating diverse biological processes such as cell proliferation, migration, differentiation, and extracellular matrix (ECM) remodeling. During tendon injury repair, similar to PDGF-BB [38], PDGFA expression is typically upregulated in the early phase, promoting the proliferation and migration of tenocytes and fibroblasts, stimulating the synthesis of type I and type III collagen, and accelerating ECM deposition and remodeling. Moreover, PDGFA can activate endothelial cells to induce angiogenesis [39], supplying oxygen and nutrients to the injured tissue, and may synergize with TGF-β signaling to regulate scar formation and tissue repair quality.

Fig. 9 — **The effect of Muc1 plasmid-transfected endothelial cells on tenocytes is primarily mediated through PDGFA-enriched exosome secretion.** (A) Volcano plot of proteomic sequencing in endothelial cell conditioned medium; (B) ELISA quantification of PDGFA antibody binding efficiency toward PDGFA in endothelial cell-conditioned medium (n = 3); (C) Western blot analysis of Muc1 and PDGFA levels in exosomes derived from Muc1-transfected endothelial cells and quantitative analysis. (n = 3); (D) Effects of different PDGFA concentrations on cell viability of tenocytes; (E) Scratch wound healing images of tenocytes treated with endothelial cell conditioned medium, exosomes or recombinant PDGFA protein; (F) Quantitative analysis of E (n = 3); (G) Representative EdU staining images of tenocytes of tenocytes treated with endothelial cell conditioned medium, exosomes or recombinant PDGFA protein and quantitative analysis. (n = 3); (H) Expression levels of PDGFA and Muc1 in endothelial cells following Muc1 plasmid transfection (n = 3). ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

To validate PDGFA secretion, we quantified its concentration in the supernatant using ELISA, with an additional control group treated with anti-PDGFA neutralizing antibody added to the pEGFP-Muc1 supernatant. The results confirmed that PDGFA in the conditioned medium was specifically bound and neutralized by the antibody, demonstrating its genuine presence in the supernatant of Muc1 transfected endothelial cells (Fig. 9B). Previous studies have shown that Muc1, owing to its unique transmembrane structure and heavily glycosylated extracellular domain, can mediate intercellular signaling, influencing immune responses, angiogenesis, and tissue repair. Moreover, Muc1 has been identified as an important cargo component of exosomes, with its extracellular domain or associated molecules capable of being packaged and secreted via exosomal pathways. To determine whether PDGFA was present within endothelial exosomes, we isolated exosomes from the culture supernatant and analyzed their protein composition by Western blotting. The results showed that PDGFA levels were markedly elevated in exosomes derived from pEGFP-Muc1 transfected cells (Exo-Muc1) compared to controls (Fig. 9C). To determine whether exosomes are required for the pro-proliferative effect, exosome release was pharmacologically inhibited using GW4869. The results showed that blockade of exosome secretion markedly attenuated tenocyte proliferation (Supplementary Fig. 4A–E), indicating that endothelial-derived exosomes play a crucial role in mediating the Muc1-dependent pro-repair signaling.

To identify the optimal PDGFA concentration that stimulates tenocyte proliferation, we performed CCK-8 assays. The results indicated that PDGFA at 50 ng/mL produced the most pronounced pro-proliferative effect (Fig. 9D). Based on this, we further conducted wound-healing assays (Fig. 9E and F), which were consistent with the CCK-8 findings: the Muc1-conditioned medium, Muc1-derived exosomes, and exogenous PDGFA all exhibited comparable abilities to promote tenocyte proliferation and migration, supporting the existence of a “Muc1 Exosome PDGFA signaling axis.” Similarly, EdU assays (Fig. 9G) corroborated these findings, demonstrating enhanced DNA synthesis and proliferative activity in tenocytes exposed to PDGFA-related stimulation. To further determine whether PDGFA is required for the pro-proliferative effect, PDGFA expression was silenced using siRNA. The results showed that knockdown of PDGFA significantly attenuated tenocyte proliferation and migration compared with the control group (Supplementary Fig. 5A–G), indicating that PDGFA is a critical mediator of the Muc1–exosome signaling axis. A new question then arose: Does PDGFA expression also increase in tenocytes after co-culture? To address this, we performed transcriptome sequencing of co-cultured tenocytes. The results showed that PDGFA expression exhibited an upward trend, but the increase did not reach statistical significance (Fig. 9H), a finding further confirmed by qPCR analysis. This led us to the next question: How does PDGFA regulate tenocyte proliferation?

3.5. From endothelial signaling to tendon remodeling: A Muc1-Mediated PDGFA–TGF-β3 cross-cell communication network

We performed an integrated analysis combining the transcriptomic profiles of endothelial cells and co-cultured tenocytes. Fig. 10A presents a heatmap of proteins directly or indirectly associated with PDGFA in the endothelial cell transcriptome. Based on transcriptomic data and protein–protein interaction (PPI) network analysis, we selected genes showing direct or indirect association with PDGFA and plotted their expression profiles (Fig. 10B). Notably, directly interacting molecules such as PDGFRA, PDGFRB, and key components of the PI3K/AKT pathway were significantly upregulated in the Muc1 group, while indirectly associated factors including members of the MAPK family and VEGFA exhibited similar upregulation trends. These findings suggest that Muc1 may coordinately regulate endothelial cell proliferation and angiogenesis through the PDGFA-related signaling network. We further conducted gene set enrichment analysis (GSEA) on the transcriptomic data. The results showed that the cytokine signaling pathway was significantly enriched in the Muc1 group (NES = 1.37, FDR <0.05) (Fig. 10C). Among these, CCL2 was identified as a core molecule, showing marked upregulation and prominent annotation in the pathway map, indicating its potential key role in regulating cell migration. In summary, upon stimulation (such as after Muc1 transfection), intracellular signaling cascades including NF-κB, MAPK, and PI3K/Akt pathways can be activated in endothelial cells, leading to elevated CCL2 expression. The upregulation of CCL2 may, in turn, trigger or amplify vesicle biogenesis and release-related signaling, such as promoting microvesicle budding, exocytosis, or enhancing exosomal pathway activity. As a result, endothelial cells may release more vesicles enriched with signaling molecules such as PDGFA, thereby mediating intercellular communication and influencing downstream tenocyte behavior.

The heatmap shown in Fig. 10D illustrates the overall gene expression differences among samples. Distinct clustering patterns were observed between the co-culture group and the control group, indicating that treatment with endothelial cell-conditioned medium significantly remodeled the transcriptional program of tenocytes. The upregulated genes were predominantly associated with cell cycle progression and growth-related signaling. The volcano plot (Fig. 10E) visualizes the distribution of DEGs, where most genes clustered near the baseline, reflecting overall transcriptomic stability. However, a subset of genes showed significant differential expression between the Muc1 and control groups, with 170 upregulated and 155 downregulated genes. These DEGs were mainly enriched in biological processes related to ECM remodeling, inflammatory response, and cell cycle regulation, suggesting that Muc1 exerts a specific regulatory effect on the tenocyte transcriptome. The PPI network (Fig. 10F) constructed from the tenocyte transcriptome highlights proteins directly and indirectly associated with PDGFA, among which PDGFA and TGF-β3 were specifically marked as central nodes. GO enrichment analysis revealed that DEGs were significantly enriched in biological processes such as cell cycle regulation, epithelial cell proliferation, response to TGF-β signaling, and extracellular matrix organization. These findings indicate that endothelial cell-conditioned medium may stimulate tenocytes to transition from a quiescent to an activated, proliferative phenotype, while enhancing their capacity for ECM remodeling (Fig. 10G). This phenotypic conversion is particularly critical during the early stages of tissue repair. KEGG pathway enrichment analysis (Fig. 10H) further identified several key pathways associated with tissue regeneration, fibrosis modulation, and tendon repair, suggesting that endothelial cell-derived signaling molecules may transcriptionally activate tenocyte proliferation and matrix reconstruction programs [40]. Finally, immunofluorescence staining of tissue sections confirmed that TGF-β3 expression was markedly elevated in the experimental group (Fig. 10I), consistent with the transcriptomic findings.

Based on these findings, we hypothesize that PDGFA may activate its receptors (PDGFRα/PDGFRβ) to initiate downstream classical signaling cascades, including the PI3K/Akt, MAPK/ERK, and JAK/STAT pathways. This activation may subsequently induce a series of transcriptional regulators and auxiliary signaling molecules, ultimately leading to the upregulation or activation of TGF-β3. Once TGF-β3 is upregulated or activated, it can act through both Smad-dependent and Smad-independent pathways to modulate tenocyte behavior specifically by inducing the expression of cell cycle promoting genes (such as Cyclin D and Cyclin E), inhibiting cell cycle suppressors (such as p21 and p27), and regulating ECM synthesis and cell–matrix interactions, thereby promoting tenocyte proliferation and tissue repair. Moreover, a positive feedback or synergistic interaction may exist between the PDGFA and TGF-β3 signaling pathways [41]: PDGFA may induce TGF-β3 expression, while TGF-β3 could, in turn, enhance cellular responsiveness to PDGF signaling, for instance, by upregulating PDGFR expression or improving downstream receptor coupling efficiency. Together, these processes may form a pro-growth and pro-remodeling signaling milieu that facilitates tendon regeneration. In vivo experiments, rats in the Muc1 treated group exhibited significantly improved limb mobility compared with the other groups, which may be attributed to the anti-adhesive effect of TGF-β3, reducing fibrotic adhesion formation and improving functional recovery.

4. Conclusions

In conclusion, this study demonstrates a pivotal role of Muc1 in tendon repair by orchestrating a dual paracrine mechanism in endothelial cells. Specifically, Muc1 enhances the secretion of soluble PDGFA and simultaneously promotes the enrichment of PDGFA within endothelial cells derived exosomes, thereby providing sustained trophic stimulation to the tendon microenvironment. Subsequent stimulation of tenocytes with PDGFA led to a marked upregulation of TGFβ-3, a key mediator involved in extracellular matrix remodeling and tissue homeostasis. Collectively, these findings suggest that Muc1 promotes tendon healing through a PDGFA-TGFβ-3 axis, establishing a dual paracrine regulatory network between endothelial cells and tenocytes that synergistically facilitates angiogenesis and tendon regeneration.

Ethics approval

The experiment protocol was approved by the Experimental Animal Care and Use Committee of Nantong University (code S20241015-071).

Funding

This study was funded by the National Natural Science Foundation of China (82372389), Natural Science Foundation of Jiangsu Province (BK20241841), Jiangsu Provincial Research Hospital (YJXYY202204-ZD05), Jiangsu provincial medical innovation center of neuromicroscopy and minimally invasive translational medicine (CXZX202212) and China Postdoctoral Science Foundation (2025M772354).

CRediT authorship contribution statement

Yan Xue: Formal analysis, Methodology, Resources, Software, Writing – original draft. Jie Sun: Formal analysis, Methodology, Software. Xu Hao Ji: Methodology, Software. Rong Wang: Data curation, Investigation, Validation. Jia Yu Shi: Data curation, Investigation, Validation. Qian Qian Yang: Supervision, Visualization, Writing – review & editing. You Lang Zhou: Conceptualization, Funding acquisition, Project administration, Writing – review & editing. Jun Tan: Conceptualization, Funding acquisition, Project administration, Writing – review & editing.

Declaration of competing interest

The authors have declared no conflict of interest.

Acknowledgements

The authors express gratitude to Fengyin Tang and Shaojie Zhou from Hangzhou Cosmos Wisdom for their technical support in data analysis.

Footnotes

^{Appendix A}

Supplementary data to this article can be found online at https://doi.org/10.1016/j.mtbio.2026.103158.

Contributor Information

Qian Qian Yang, Email: yangqianqian259253@163.com.

You Lang Zhou, Email: youlangzhou@163.com.

Jun Tan, Email: juntan7401@gmail.com.

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Multimedia component 1

mmc1.docx^{(7.8MB, docx)}

Data availability

Data will be made available on request.

References

1.Juneja S.C., Schwarz E.M., O'Keefe R.J., Awad H.A. Cellular and molecular factors in flexor tendon repair and adhesions: a histological and gene expression analysis. Connect. Tissue Res. 2013;54:218–226. doi: 10.3109/03008207.2013.787418. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Conn J.M., Annest J.L., Ryan G.W., Budnitz D.S. Non–work-related finger amputations in the United States, 2001-2002. Ann. Emerg. Med. 2005;45:630–635. doi: 10.1016/j.annemergmed.2004.10.012. [DOI] [PubMed] [Google Scholar]
3.Dy C.J., Hernandez-Soria A., Ma Y., Roberts T.R., Daluiski A. Complications after flexor tendon repair: a systematic review and meta-analysis. J. Hand Surg. 2012;37:543–551.e1. doi: 10.1016/j.jhsa.2011.11.006. [DOI] [PubMed] [Google Scholar]
4.Liu X., Zhu B., Li Y., Liu X., Guo S., Wang C., Li S., Wang D. The role of vascular endothelial growth factor in tendon healing. Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.766080. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Müller S.A., Todorov A., Heisterbach P.E., Martin I., Majewski M. Tendon healing: an overview of physiology, biology, and pathology of tendon healing and systematic review of state of the art in tendon bioengineering. Knee Surg. Sports Traumatol. Arthrosc. 2015;23:2097–2105. doi: 10.1007/s00167-013-2680-z. [DOI] [PubMed] [Google Scholar]
6.Apte R.S., Chen D.S., Ferrara N. VEGF in signaling and disease: beyond discovery and development. Cell. 2019;176:1248–1264. doi: 10.1016/j.cell.2019.01.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Shinohara I., Tsubosaka M., Toya M., Lee M.L., Kushioka J., Murayama M., Gao Q., Li X., Zhang N., Chow S.K.-H., Matsumoto T., Kuroda R., Goodman S.B. C-C motif chemokine ligand 2 enhances macrophage chemotaxis, osteogenesis, and angiogenesis during the inflammatory phase of bone regeneration. Biomolecules. 2023;13:1665. doi: 10.3390/biom13111665. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Rafii S., Butler J.M., Ding B.-S. Angiocrine functions of organ-specific endothelial cells. Nature. 2016;529:316–325. doi: 10.1038/nature17040. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Eelen G., de Zeeuw P., Treps L., Harjes U., Wong B.W., Carmeliet P. 2018. Endothelial Cell Metabolism. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Apostolopoulos V., Stojanovska L., Gargosky S.E. MUC1 (CD227): a multi-tasked molecule. Cell. Mol. Life Sci. 2015;72:4475–4500. doi: 10.1007/s00018-015-2014-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Choi J.S., Yoon H.I., Lee K.S., Choi Y.C., Yang S.H., Kim I.-S., Cho Y.W. Exosomes from differentiating human skeletal muscle cells trigger myogenesis of stem cells and provide biochemical cues for skeletal muscle regeneration. J. Contr. Release. 2016;222:107–115. doi: 10.1016/j.jconrel.2015.12.018. [DOI] [PubMed] [Google Scholar]
12.Sahraei M., Roy L.D., Curry J.M., Teresa T.L., Nath S., Besmer D., Kidiyoor A., Dalia R., Gendler S.J., Mukherjee P. MUC1 regulates PDGFA expression during pancreatic cancer progression. Oncogene. 2012;31:4935–4945. doi: 10.1038/onc.2011.651. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Yang W., Li J., Su Y., Liang W., Ren Y., Dong Y., Shang Y., Zhong S., Xu L., Zhang T. A modified flexor tendon suture technique combining kessler and loop lock flexor tendon sutures. Clinics. 2021;76 doi: 10.6061/clinics/2021/e2358. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Chisari E., Rehak L., Khan W.S., Maffulli N. Tendon healing is adversely affected by low-grade inflammation. J. Orthop. Surg. Res. 2021;16:700. doi: 10.1186/s13018-021-02811-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Camacho‐Chacon J.A., Cuenca‐Espierrez J., Roda‐Rojo V., Martin‐Martinez A., Calderon‐Meza J.M., Alvarez‐Alegret R., Martin‐Hernandez C. Bioinductive collagen implants facilitate tendon regeneration in rotator cuff tears. J. Exp. Orthop. 2022;9:53. doi: 10.1186/s40634-022-00495-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Hart D.A., Ahmed A.S., Chen J., Ackermann P.W. Optimizing tendon repair and regeneration: how does the in vivo environment shape outcomes following rupture of a tendon such as the achilles tendon? Front. Bioeng. Biotechnol. 2024;12 doi: 10.3389/fbioe.2024.1357871. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Dhar P., McAuley J. The role of the cell surface mucin MUC1 as a barrier to infection and regulator of inflammation. Front. Cell. Infect. Microbiol. 2019;9:117. doi: 10.3389/fcimb.2019.00117. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Liu L., Zhou L., Wang L., Mao Z., Zheng P., Zhang F., Zhang H., Liu H. MUC1 attenuates neutrophilic airway inflammation in asthma by reducing NLRP3 inflammasome-mediated pyroptosis through the inhibition of the TLR4/MyD88/NF-κB pathway. Respir. Res. 2023;24:255. doi: 10.1186/s12931-023-02550-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Chan B.P., Fu S., Qin L., Lee K., Rolf C.G., Chan K. Effects of basic fibroblast growth factor (bFGF) on early stages of tendon healing: a rat patellar tendon model. Acta Orthop. Scand. 2000;71:513–518. doi: 10.1080/000164700317381234. [DOI] [PubMed] [Google Scholar]
20.Schwarz E.M., Arts J.J.C., Chen A.F. Introduction for the journal of orthopaedic research special issue on musculoskeletal infection. J. Orthop. Res. 2021;39:225–226. doi: 10.1002/jor.24981. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.1-s2.0-S2352320419301610-main, (n.d.).
22.Li D., Jiu J., Liu H., Yan X., Li X., Yan L., Zhang J., Fan Z., Li S., Du G., Li J.J., Du Y., Liu W., Wang B. Tissue-engineered mesenchymal stem cell constructs alleviate tendinopathy by suppressing vascularization. Bioact. Mater. 2024;36:474–489. doi: 10.1016/j.bioactmat.2024.06.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Minkwitz S., Schmock A., Kurtoglu A., Tsitsilonis S., Manegold S., Wildemann B., Klatte-Schulz F. Time-dependent alterations of MMPs, TIMPs and tendon structure in human achilles tendons after acute rupture. Int. J. Math. Stat. 2017;18:2199. doi: 10.3390/ijms18102199. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Karousou E., Ronga M., Vigetti D., Passi A., Maffulli N. Collagens, proteoglycans, MMP-2, MMP-9 and TIMPs in human achilles tendon rupture. Clin. Orthop. Relat. Res. 2008;466:1577–1582. doi: 10.1007/s11999-008-0255-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Liu X., Li Y., Wang S., Lu M., Zou J., Shi Z., Xu B., Wang W., Hu B., Jin T., Wu F., Liu S., Fan C. PDGF-loaded microneedles promote tendon healing through p38/cyclin D1 pathway mediated angiogenesis. Mater. Today Bio. 2022;16 doi: 10.1016/j.mtbio.2022.100428. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Walton K.L., Johnson K.E., Harrison C.A. Targeting TGF-β mediated SMAD signaling for the prevention of fibrosis. Front. Pharmacol. 2017;8:461. doi: 10.3389/fphar.2017.00461. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Zhang J., Brown R., Hogan M.V., Wang J.H.-C. Mitigating scar tissue formation in tendon injuries: Targeting HMGB1, AMPK activation, and myofibroblast migration all at once. Pharmaceuticals. 2023;16:1739. doi: 10.3390/ph16121739. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Zeltz C., Gullberg D. The integrin–collagen connection – a glue for tissue repair? J. Cell Sci. 2016;129:1284. doi: 10.1242/jcs.188672. 1284. [DOI] [PubMed] [Google Scholar]
29.Li Q., Liu G., Shao D., Wang J., Yuan H., Chen T., Zhai R., Ni W., Tai G. Mucin1 mediates autocrine transforming growth factor beta signaling through activating the c-Jun N-terminal kinase/activator protein 1 pathway in human hepatocellular carcinoma cells. Int. J. Biochem. Cell Biol. 2015;59:116–125. doi: 10.1016/j.biocel.2014.11.012. [DOI] [PubMed] [Google Scholar]
30.Shen Q., Rahn J.J., Zhang J., Gunasekera N., Sun X., Shaw A.R.E., Hendzel M.J., Hoffman P., Bernier A., Hugh J.C. MUC1 initiates Src-CrkL-Rac1/Cdc42–Mediated actin cytoskeletal protrusive motility after ligating intercellular adhesion Molecule-1. Mol. Cancer Res. 2008;6:555–567. doi: 10.1158/1541-7786.MCR-07-2033. [DOI] [PubMed] [Google Scholar]
31.Shurer C.R., Kuo J.C.-H., Roberts L.M., Gandhi J.G., Colville M.J., Enoki T.A., Pan H., Su J., Noble J.M., Hollander M.J., O'Donnell J.P., Yin R., Pedram K., Möckl L., Kourkoutis L.F., Moerner W.E., Bertozzi C.R., Feigenson G.W., Reesink H.L., Paszek M.J. Physical principles of membrane shape regulation by the glycocalyx. Cell. 2019;177:1757–1770.e21. doi: 10.1016/j.cell.2019.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Toya M., Zhang N., Tsubosaka M., Kushioka J., Gao Q., Li X., Chow S.K.-H., Goodman S.B. CCL2 promotes osteogenesis by facilitating macrophage migration during acute inflammation. Front. Cell Dev. Biol. 2023;11 doi: 10.3389/fcell.2023.1213641. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Aber R., Chan W., Mugisha S., Jerome-Majewska L.A. Transmembrane emp24 domain proteins in development and disease. Genet. Res. 2019;101:e14. doi: 10.1017/S0016672319000090. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Naisbitt S., Valtschanoff J., Allison D.W., Sala C., Kim E., Craig A.M., Weinberg R.J., Sheng M. Interaction of the postsynaptic Density-95/Guanylate kinase domain-associated protein complex with a light chain of Myosin-V and dynein. J. Neurosci. 2000;20:4524–4534. doi: 10.1523/JNEUROSCI.20-12-04524.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Kang S., Yoon J.S., Lee J.Y., Kim H.-J., Park K., Kim S.E. Long-term local PDGF delivery using porous microspheres modified with heparin for tendon healing of rotator cuff tendinitis in a rabbit model. Carbohydr. Polym. 2019;209:372–381. doi: 10.1016/j.carbpol.2019.01.017. [DOI] [PubMed] [Google Scholar]
36.Heldin C.-H., Westermark B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol. Rev. 1999;79:1283–1316. doi: 10.1152/physrev.1999.79.4.1283. [DOI] [PubMed] [Google Scholar]
37.Gai Q.-J., Fu Z., He J., Mao M., Yao X.-X., Qin Y., Lan X., Zhang L., Miao J.-Y., Wang Y.-X., Zhu J., Yang F.-C., Lu H.-M., Yan Z.-X., Chen F.-L., Shi Y., Ping Y.-F., Cui Y.-H., Zhang X., Liu X., Yao X.-H., Lv S.-Q., Bian X.-W., Wang Y. EPHA2 mediates PDGFA activity and functions together with PDGFRA as prognostic marker and therapeutic target in glioblastoma. Signal Transduct. Targeted Ther. 2022;7:33. doi: 10.1038/s41392-021-00855-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Rieber J., Wolint P., Meier-Bürgisser G., Ongini E., Giovanoli P., Calcagni M., Snedeker J.G., Buschmann J. Synergistic effects of insulin-like growth Factor-1 and platelet-derived growth Factor-BB in tendon healing. Int. J. Math. Stat. 2025;26:4039. doi: 10.3390/ijms26094039. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Raica M., Cimpean A.M. Platelet-derived growth factor (PDGF)/PDGF receptors (PDGFR) axis as target for antitumor and antiangiogenic therapy. Pharmaceuticals. 2010;3:572–599. doi: 10.3390/ph3030572. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Dou Y., Zhai H., Li H., Xing H., Zhu C., Xuan Z. Endothelial cells-derived exosomes-based hydrogel improved tendinous repair via anti-inflammatory and tissue regeneration-promoting properties. J. Nanobiotechnol. 2024;22:401. doi: 10.1186/s12951-024-02607-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.O.I.C. Saavedra, The cross-talk between TGF-β and PDGFRα signaling pathways regulates stromal fibro/adipogenic progenitors' fate, J. Cell Sci, 132, 2019, jcs232157, 10.1242/jcs.232157. [DOI] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1

mmc1.docx^{(7.8MB, docx)}

Data Availability Statement

Data will be made available on request.

[bib1] 1.Juneja S.C., Schwarz E.M., O'Keefe R.J., Awad H.A. Cellular and molecular factors in flexor tendon repair and adhesions: a histological and gene expression analysis. Connect. Tissue Res. 2013;54:218–226. doi: 10.3109/03008207.2013.787418. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib2] 2.Conn J.M., Annest J.L., Ryan G.W., Budnitz D.S. Non–work-related finger amputations in the United States, 2001-2002. Ann. Emerg. Med. 2005;45:630–635. doi: 10.1016/j.annemergmed.2004.10.012. [DOI] [PubMed] [Google Scholar]

[bib3] 3.Dy C.J., Hernandez-Soria A., Ma Y., Roberts T.R., Daluiski A. Complications after flexor tendon repair: a systematic review and meta-analysis. J. Hand Surg. 2012;37:543–551.e1. doi: 10.1016/j.jhsa.2011.11.006. [DOI] [PubMed] [Google Scholar]

[bib4] 4.Liu X., Zhu B., Li Y., Liu X., Guo S., Wang C., Li S., Wang D. The role of vascular endothelial growth factor in tendon healing. Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.766080. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] 5.Müller S.A., Todorov A., Heisterbach P.E., Martin I., Majewski M. Tendon healing: an overview of physiology, biology, and pathology of tendon healing and systematic review of state of the art in tendon bioengineering. Knee Surg. Sports Traumatol. Arthrosc. 2015;23:2097–2105. doi: 10.1007/s00167-013-2680-z. [DOI] [PubMed] [Google Scholar]

[bib6] 6.Apte R.S., Chen D.S., Ferrara N. VEGF in signaling and disease: beyond discovery and development. Cell. 2019;176:1248–1264. doi: 10.1016/j.cell.2019.01.021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] 7.Shinohara I., Tsubosaka M., Toya M., Lee M.L., Kushioka J., Murayama M., Gao Q., Li X., Zhang N., Chow S.K.-H., Matsumoto T., Kuroda R., Goodman S.B. C-C motif chemokine ligand 2 enhances macrophage chemotaxis, osteogenesis, and angiogenesis during the inflammatory phase of bone regeneration. Biomolecules. 2023;13:1665. doi: 10.3390/biom13111665. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] 8.Rafii S., Butler J.M., Ding B.-S. Angiocrine functions of organ-specific endothelial cells. Nature. 2016;529:316–325. doi: 10.1038/nature17040. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib9] 9.Eelen G., de Zeeuw P., Treps L., Harjes U., Wong B.W., Carmeliet P. 2018. Endothelial Cell Metabolism. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] 10.Apostolopoulos V., Stojanovska L., Gargosky S.E. MUC1 (CD227): a multi-tasked molecule. Cell. Mol. Life Sci. 2015;72:4475–4500. doi: 10.1007/s00018-015-2014-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib11] 11.Choi J.S., Yoon H.I., Lee K.S., Choi Y.C., Yang S.H., Kim I.-S., Cho Y.W. Exosomes from differentiating human skeletal muscle cells trigger myogenesis of stem cells and provide biochemical cues for skeletal muscle regeneration. J. Contr. Release. 2016;222:107–115. doi: 10.1016/j.jconrel.2015.12.018. [DOI] [PubMed] [Google Scholar]

[bib12] 12.Sahraei M., Roy L.D., Curry J.M., Teresa T.L., Nath S., Besmer D., Kidiyoor A., Dalia R., Gendler S.J., Mukherjee P. MUC1 regulates PDGFA expression during pancreatic cancer progression. Oncogene. 2012;31:4935–4945. doi: 10.1038/onc.2011.651. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] 13.Yang W., Li J., Su Y., Liang W., Ren Y., Dong Y., Shang Y., Zhong S., Xu L., Zhang T. A modified flexor tendon suture technique combining kessler and loop lock flexor tendon sutures. Clinics. 2021;76 doi: 10.6061/clinics/2021/e2358. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] 14.Chisari E., Rehak L., Khan W.S., Maffulli N. Tendon healing is adversely affected by low-grade inflammation. J. Orthop. Surg. Res. 2021;16:700. doi: 10.1186/s13018-021-02811-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib15] 15.Camacho‐Chacon J.A., Cuenca‐Espierrez J., Roda‐Rojo V., Martin‐Martinez A., Calderon‐Meza J.M., Alvarez‐Alegret R., Martin‐Hernandez C. Bioinductive collagen implants facilitate tendon regeneration in rotator cuff tears. J. Exp. Orthop. 2022;9:53. doi: 10.1186/s40634-022-00495-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] 16.Hart D.A., Ahmed A.S., Chen J., Ackermann P.W. Optimizing tendon repair and regeneration: how does the in vivo environment shape outcomes following rupture of a tendon such as the achilles tendon? Front. Bioeng. Biotechnol. 2024;12 doi: 10.3389/fbioe.2024.1357871. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib17] 17.Dhar P., McAuley J. The role of the cell surface mucin MUC1 as a barrier to infection and regulator of inflammation. Front. Cell. Infect. Microbiol. 2019;9:117. doi: 10.3389/fcimb.2019.00117. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] 18.Liu L., Zhou L., Wang L., Mao Z., Zheng P., Zhang F., Zhang H., Liu H. MUC1 attenuates neutrophilic airway inflammation in asthma by reducing NLRP3 inflammasome-mediated pyroptosis through the inhibition of the TLR4/MyD88/NF-κB pathway. Respir. Res. 2023;24:255. doi: 10.1186/s12931-023-02550-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib19] 19.Chan B.P., Fu S., Qin L., Lee K., Rolf C.G., Chan K. Effects of basic fibroblast growth factor (bFGF) on early stages of tendon healing: a rat patellar tendon model. Acta Orthop. Scand. 2000;71:513–518. doi: 10.1080/000164700317381234. [DOI] [PubMed] [Google Scholar]

[bib20] 20.Schwarz E.M., Arts J.J.C., Chen A.F. Introduction for the journal of orthopaedic research special issue on musculoskeletal infection. J. Orthop. Res. 2021;39:225–226. doi: 10.1002/jor.24981. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib21] 21.1-s2.0-S2352320419301610-main, (n.d.).

[bib22] 22.Li D., Jiu J., Liu H., Yan X., Li X., Yan L., Zhang J., Fan Z., Li S., Du G., Li J.J., Du Y., Liu W., Wang B. Tissue-engineered mesenchymal stem cell constructs alleviate tendinopathy by suppressing vascularization. Bioact. Mater. 2024;36:474–489. doi: 10.1016/j.bioactmat.2024.06.029. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib23] 23.Minkwitz S., Schmock A., Kurtoglu A., Tsitsilonis S., Manegold S., Wildemann B., Klatte-Schulz F. Time-dependent alterations of MMPs, TIMPs and tendon structure in human achilles tendons after acute rupture. Int. J. Math. Stat. 2017;18:2199. doi: 10.3390/ijms18102199. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib24] 24.Karousou E., Ronga M., Vigetti D., Passi A., Maffulli N. Collagens, proteoglycans, MMP-2, MMP-9 and TIMPs in human achilles tendon rupture. Clin. Orthop. Relat. Res. 2008;466:1577–1582. doi: 10.1007/s11999-008-0255-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib25] 25.Liu X., Li Y., Wang S., Lu M., Zou J., Shi Z., Xu B., Wang W., Hu B., Jin T., Wu F., Liu S., Fan C. PDGF-loaded microneedles promote tendon healing through p38/cyclin D1 pathway mediated angiogenesis. Mater. Today Bio. 2022;16 doi: 10.1016/j.mtbio.2022.100428. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib26] 26.Walton K.L., Johnson K.E., Harrison C.A. Targeting TGF-β mediated SMAD signaling for the prevention of fibrosis. Front. Pharmacol. 2017;8:461. doi: 10.3389/fphar.2017.00461. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib27] 27.Zhang J., Brown R., Hogan M.V., Wang J.H.-C. Mitigating scar tissue formation in tendon injuries: Targeting HMGB1, AMPK activation, and myofibroblast migration all at once. Pharmaceuticals. 2023;16:1739. doi: 10.3390/ph16121739. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib28] 28.Zeltz C., Gullberg D. The integrin–collagen connection – a glue for tissue repair? J. Cell Sci. 2016;129:1284. doi: 10.1242/jcs.188672. 1284. [DOI] [PubMed] [Google Scholar]

[bib29] 29.Li Q., Liu G., Shao D., Wang J., Yuan H., Chen T., Zhai R., Ni W., Tai G. Mucin1 mediates autocrine transforming growth factor beta signaling through activating the c-Jun N-terminal kinase/activator protein 1 pathway in human hepatocellular carcinoma cells. Int. J. Biochem. Cell Biol. 2015;59:116–125. doi: 10.1016/j.biocel.2014.11.012. [DOI] [PubMed] [Google Scholar]

[bib30] 30.Shen Q., Rahn J.J., Zhang J., Gunasekera N., Sun X., Shaw A.R.E., Hendzel M.J., Hoffman P., Bernier A., Hugh J.C. MUC1 initiates Src-CrkL-Rac1/Cdc42–Mediated actin cytoskeletal protrusive motility after ligating intercellular adhesion Molecule-1. Mol. Cancer Res. 2008;6:555–567. doi: 10.1158/1541-7786.MCR-07-2033. [DOI] [PubMed] [Google Scholar]

[bib31] 31.Shurer C.R., Kuo J.C.-H., Roberts L.M., Gandhi J.G., Colville M.J., Enoki T.A., Pan H., Su J., Noble J.M., Hollander M.J., O'Donnell J.P., Yin R., Pedram K., Möckl L., Kourkoutis L.F., Moerner W.E., Bertozzi C.R., Feigenson G.W., Reesink H.L., Paszek M.J. Physical principles of membrane shape regulation by the glycocalyx. Cell. 2019;177:1757–1770.e21. doi: 10.1016/j.cell.2019.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] 32.Toya M., Zhang N., Tsubosaka M., Kushioka J., Gao Q., Li X., Chow S.K.-H., Goodman S.B. CCL2 promotes osteogenesis by facilitating macrophage migration during acute inflammation. Front. Cell Dev. Biol. 2023;11 doi: 10.3389/fcell.2023.1213641. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] 33.Aber R., Chan W., Mugisha S., Jerome-Majewska L.A. Transmembrane emp24 domain proteins in development and disease. Genet. Res. 2019;101:e14. doi: 10.1017/S0016672319000090. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] 34.Naisbitt S., Valtschanoff J., Allison D.W., Sala C., Kim E., Craig A.M., Weinberg R.J., Sheng M. Interaction of the postsynaptic Density-95/Guanylate kinase domain-associated protein complex with a light chain of Myosin-V and dynein. J. Neurosci. 2000;20:4524–4534. doi: 10.1523/JNEUROSCI.20-12-04524.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] 35.Kang S., Yoon J.S., Lee J.Y., Kim H.-J., Park K., Kim S.E. Long-term local PDGF delivery using porous microspheres modified with heparin for tendon healing of rotator cuff tendinitis in a rabbit model. Carbohydr. Polym. 2019;209:372–381. doi: 10.1016/j.carbpol.2019.01.017. [DOI] [PubMed] [Google Scholar]

[bib36] 36.Heldin C.-H., Westermark B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol. Rev. 1999;79:1283–1316. doi: 10.1152/physrev.1999.79.4.1283. [DOI] [PubMed] [Google Scholar]

[bib37] 37.Gai Q.-J., Fu Z., He J., Mao M., Yao X.-X., Qin Y., Lan X., Zhang L., Miao J.-Y., Wang Y.-X., Zhu J., Yang F.-C., Lu H.-M., Yan Z.-X., Chen F.-L., Shi Y., Ping Y.-F., Cui Y.-H., Zhang X., Liu X., Yao X.-H., Lv S.-Q., Bian X.-W., Wang Y. EPHA2 mediates PDGFA activity and functions together with PDGFRA as prognostic marker and therapeutic target in glioblastoma. Signal Transduct. Targeted Ther. 2022;7:33. doi: 10.1038/s41392-021-00855-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib38] 38.Rieber J., Wolint P., Meier-Bürgisser G., Ongini E., Giovanoli P., Calcagni M., Snedeker J.G., Buschmann J. Synergistic effects of insulin-like growth Factor-1 and platelet-derived growth Factor-BB in tendon healing. Int. J. Math. Stat. 2025;26:4039. doi: 10.3390/ijms26094039. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib39] 39.Raica M., Cimpean A.M. Platelet-derived growth factor (PDGF)/PDGF receptors (PDGFR) axis as target for antitumor and antiangiogenic therapy. Pharmaceuticals. 2010;3:572–599. doi: 10.3390/ph3030572. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib40] 40.Dou Y., Zhai H., Li H., Xing H., Zhu C., Xuan Z. Endothelial cells-derived exosomes-based hydrogel improved tendinous repair via anti-inflammatory and tissue regeneration-promoting properties. J. Nanobiotechnol. 2024;22:401. doi: 10.1186/s12951-024-02607-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41.O.I.C. Saavedra, The cross-talk between TGF-β and PDGFRα signaling pathways regulates stromal fibro/adipogenic progenitors' fate, J. Cell Sci, 132, 2019, jcs232157, 10.1242/jcs.232157. [DOI] [PubMed]

PERMALINK

Muc1 drives tendon regeneration by activating an endothelial-to-tenocyte PDGFA signaling axis via extracellular vesicles

Yan Xue

Jie Sun

Xu Hao Ji

Rong Wang

Jia Yu Shi

Qian Qian Yang

You Lang Zhou

Jun Tan

Abstract

Graphical abstract

1. Introduction

Scheme 1.

2. Material and methods

2.1. Design and synthesis of the Muc1 overexpression plasmid

2.2. Preparation of PLGA nanoparticles and plasmid/nanoparticle complexes

2.3. Ethics statement

2.4. Simulated tendon injury in animals

2.5. Gliding function and biomechanical testing

2.6. Tissue sectioning

2.7. Morphological observation, staining and analysis

2.8. Cell extraction and culture

2.9. Transfection efficiency of PLGA nanoparticle complexes

2.10. Cell counting Kit-8

2.11. 5-Ethynyl-20-deoxyuridine assay

2.12. Wound healing assay

2.13. Cell cycle analysis

2.14. Tube formation assay

2.15. Co-culture in vitro

2.16. Exosome culture, isolation and inhibition workflow

2.17. The transcriptome sequencing and mass spectrometry

2.18. Western blot

2.19. Real-time qPCR

2.20. Design and synthesis of PDGFA siRNAs

Table 1.

2.21. Immunohistochemistry experimental methods

2.22. Statistical analysis

3. Results and discussion

3.1. Overexpression of Muc1 contributes to tendon healing

Fig. 1.

3.1.1. Construction of a sustained-release gene delivery platform and in vivo model

Fig. 2.

Fig. 3.

Table 2.

3.1.2. Characterization of peritendinous vascular microenvironment after injury

Fig. 4.

3.2. Cellular insights into pEGFP-Muc1: remodeling the microenvironment in vitro

Fig. 6.

Fig. 5.

3.2.1. Muc1 and tenocytes: modulating matrix synthesis and fibroblast activity

3.2.2. Angiogenic potential of Muc1: driving endothelial cell activation

3.2.3. Amplifying tenocyte responses via pEGFP-muc1-endothelial interaction

Fig. 7.

3.3. Muc1 transfection enhances extracellular vesicle release from endothelial cells and uptake by tenocytes

Fig. 8.

3.4. Endothelial–tendon crosstalk regulated by Muc1: the role of PDGFA-enriched exosomes in tendon repair

Fig. 9.

3.5. From endothelial signaling to tendon remodeling: A Muc1-Mediated PDGFA–TGF-β3 cross-cell communication network

Fig. 10.

4. Conclusions

Ethics approval

Funding

CRediT authorship contribution statement

Declaration of competing interest

Acknowledgements

Footnotes

Contributor Information

Appendix A. Supplementary data

Data availability

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases