Abstract
The molecular genetics of macrolide resistance were analyzed in 49 clinical pneumococci (including an “atypical” bile-insoluble strain currently assigned to the new species Streptococcus pseudopneumoniae) with efflux-mediated erythromycin resistance (M phenotype). All test strains had the mef gene, identified as mef(A) in 30 isolates and mef(E) in 19 isolates (including the S. pseudopneumoniae strain) on the basis of PCR-restriction fragment length polymorphism analysis. Twenty-eight of the 30 mef(A) isolates shared a pulsed-field gel electrophoresis (PFGE) type corresponding to the England14-9 clone. Of those isolates, 27 (20 belonging to serotype 14) yielded multilocus sequence type ST9, and one isolate yielded a new sequence type. The remaining two mef(A) isolates had different PFGE types and yielded an ST9 type and a new sequence type. Far greater heterogeneity was displayed by the 19 mef(E) isolates, which fell into 11 PFGE types, 12 serotypes (though not serotype 14), and 12 sequence types (including two new ones and an undetermined type for the S. pseudopneumoniae strain). In all mef(A) pneumococci, the mef element was a regular Tn1207.1 transposon, whereas of the mef(E) isolates, 17 carried the mega element and 2 exhibited a previously unreported organization, with no PCR evidence of the other open reading frames of mega. The mef gene of these two isolates, which did not match with the mef(E) gene of the mega element (93.6% homology) and which exhibited comparable homology (91.4%) to the mef(A) gene of the Tn1207.1 transposon, was identified as a novel mef gene variant and was designated mef(I). While penicillin-nonsusceptible isolates (three resistant isolates and one intermediate isolate) were all mef(E) strains, tetracycline resistance was also detected in three mef(A) isolates, due to the tet(M) gene carried by a Tn916-like transposon. A similar mechanism accounted for resistance in four of the five tetracycline-resistant isolates carrying mef(E), in three of which mega was inserted in the Tn916-like transposon, giving rise to the composite element Tn2009. In the fifth mef(E)-positive tetracycline-resistant isolate (the S. pseudopneumoniae strain), tetracycline resistance was due to the presence of the tet(O) gene, apparently unlinked to mef(E).
Constitutively or inducibly expressed erm(B)-mediated ribosomal methylation is still the prevalent, albeit not the sole, mechanism of macrolide resistance in pneumococci. Apart from other target site modification-dependent mechanisms, such as the one mediated by the erm(A) subclass erm(TR) (35), another methylase gene very common in Streptococcus pyogenes (15) but only occasionally reported in Streptococcus pneumoniae (19), and the one due to mutations in 23S rRNA or ribosomal proteins (19), the current focus of attention is on a worldwide emerging active efflux-dependent mechanism. This is due to a drug pump belonging to the major facilitator superfamily class with efflux driven by the proton-motive force (19) that is associated with a usually low-level resistance pattern affecting, among macrolide, lincosamide, and streptogramin B antibiotics, only 14- and 15-membered macrolides (M phenotype) (40).
M-type resistance is mediated by the mef gene. The mef variant discovered in S. pneumoniae was initially called mef(E) (41), whereas the one discovered in S. pyogenes was called mef(A) (6). Because the mef gene was mostly detected using a PCR method that was unable to distinguish between the two variants (39) and since mef(A) and mef(E) have 90% identity (41), they have been recommended to be regarded as a single gene class, designated mef(A) (35). However, it has subsequently been shown that the two variants are carried by two different nonconjugative elements in S. pneumoniae: the mef(A) gene by a ca. 7.2-kb transposon (Tn1207.1) containing eight open reading frames (ORFs), of which mef(A) is the fourth (38), and the mef(E) gene by a ca. 5.5-kb element (macrolide efflux genetic assembly [mega] element) containing five ORFs, of which mef(E) is the first, having related sequences with the last five ORFs of Tn1207.1 (13). Whereas various nucleotide differences have been found among the sequences deposited as mef(A), the five deposited mef(E) gene sequences are 100% identical to the one described initially (GenBank accession no. U83667) (17, 41). Downstream of the mef gene, both Tn1207.1 and mega carry an ORF, originally named orf5 (38) or mel (13) and recently collectively given the designation msr(D) (M. C. Roberts, personal communication), showing homology to msr(A), an ATP-binding cassette gene associated with macrolide efflux in Staphylococcus aureus (36). While the Tn1207.1 transposon has a unique insertion site on the pneumococcal chromosome corresponding to the celB gene (38), the mega element is integrated at other sites of the bacterial chromosome (10, 13). In some clinical pneumococci resistant to both tetracycline and erythromycin, mega has also been found to be inserted into a Tn916-like transposon, typically containing tet(M) (7), giving rise to a new composite transposon (Tn2009) (11).
The rationale of the present study was to explore the molecular genetics of erythromycin resistance in a collection of extensively typed clinical pneumococci with the M phenotype of macrolide resistance recently isolated in Italy. The responsible genes and the gene-carrying elements were extensively analyzed, and molecular investigations of associated tetracycline resistance were performed. While some previously reported differences between mef(A)- and mef(E)-containing pneumococcal populations were confirmed, others were not. A novel mef gene subclass, identified as mef(E) by PCR-restriction fragment length polymorphism (RFLP) analysis, was detected and designated mef(I).
MATERIALS AND METHODS
Bacterial strains.
Forty-nine pneumococcal isolates with efflux-mediated erythromycin resistance (MIC range, 2 to 16 mg/liter) were examined. All were clinical isolates recovered in different areas of Italy between 2002 and 2004 from a variety of clinical specimens (upper respiratory tract material, sputum, bronchial aspirate, blood, and cerebrospinal fluid). Multiple isolates from the same patient were avoided. Conventional tests, such as susceptibility to optochin and solubility in bile, and the API 20 Strep system (BioMérieux, Marcy-l'Etoile, France) were performed in our laboratory to confirm strain identification. These tests revealed that one bronchial aspirate isolate was not a typical member of S. pneumoniae but belonged to a recently recognized subset of bile-insoluble “atypical” pneumococci (29, 44) recently described as a new species called Streptococcus pseudopneumoniae (2). This strain was positive for the ply gene encoding pneumolysin, and its API profile (0060400) was identical to the one reported previously for other S. pseudopneumoniae strains (2). This isolate was investigated together with the other 48 typical pneumococci. All 49 test strains were confirmed to belong to the M phenotype of macrolide resistance on the basis of their patterns of susceptibility to macrolide, lincosamide, and streptogramin B antibiotics and the triple-disk (erythromycin plus clindamycin and rokitamycin) test (27).
Antibiotics and susceptibility tests.
Erythromycin, clindamycin, tetracycline, and penicillin were purchased from Sigma-Aldrich (Milan, Italy). The other antibiotics were obtained from the following sources: azithromycin was from Pfizer Italiana (Rome, Italy), rokitamycin was from Formenti Grünenthal (Milan, Italy), and telithromycin and levofloxacin were from Aventis Pharma (Lainate, Italy). Broth microdilution MICs were determined as recommended by the National Committee for Clinical Laboratory Standards (28). S. pneumoniae ATCC 49619 was used for quality control.
Typing methods.
Serotyping was performed by the capsular swelling test using specific antisera (Statens Seruminstitut, Copenhagen, Denmark). Serotypes were indicated with conventional capsular type designations.
Macrorestriction with SmaI endonuclease (New England Biolabs, Beverly, Mass.) and pulsed-field gel electrophoresis (PFGE) analysis were performed, and PFGE types (designated with a capital letter) and subtypes (if any, designated with the same capital letter followed by an Arabic numeral) were separated as described elsewhere previously (34).
Multilocus sequence typing (MLST) was carried out using the procedure and the seven housekeeping loci described previously by Enright and Spratt (12). The alleles of the seven housekeeping loci and the resulting sequence types were obtained from the MLST database (http://www.mlst.net). Isolates were clustered using the program for tree building provided by the MLST database.
PCR amplification experiments.
All primer pairs used in PCR experiments to detect individual ORFs, disclose gene linkages, or assess the insertion of genetic elements into the chromosome or other elements or for sequencing purposes are listed in Table 1. DNA preparation and amplification and electrophoresis of PCR products were carried out by established procedures following the reported conditions for the use of individual primer pairs. The Ex Taq system (TaKaRa Bio, Shiga, Japan) was used in the amplification experiments expected to yield PCR products exceeding 3 kb in size. Differentiation between mef(A) and mef(E) was achieved by PCR-RFLP analysis of an undiscriminating 348-bp amplicon (39) using BamHI endonuclease (New England Biolabs), which has no restriction site in mef(E) and one in mef(A) generating two fragments of 284 and 64 bp (26). To determine whether the mef and tet genes were linked, the four primer combinations associated with the possible reciprocal orientation of the two genes were used in cross-PCR assays with the chromosomal DNAs of the strains resistant to both erythromycin and tetracycline. If amplicons spanning mef and tet genes were obtained, the PCR products were purified using Montage PCR filter units (Millipore Corporation, Bedford, Mass.) and sequenced.
TABLE 1.
Oligonucleotide primer pairs used
| Gene | Primer
|
Reference | Product size (bp) | |
|---|---|---|---|---|
| Designation | Sequence (5′-3′) | |||
| orf1a | ORF1 | TGATGAAGAGGAAAATTAG | 21 | 266 |
| ORF1R | TACATCAACATTACCATCTG | 1 | ||
| orf1-orf2a | ORF1 | TGATGAAGAGGAAAATTAG | 21 | 1,066 |
| ORF2R | GATTGATGTTCCTGATGC | 21 | ||
| orf2-orf3a | ORF2 | GCATCAGGAACATCAATC | 21 | 1,119 |
| ORF3R | GACCTACCTGAACAATACC | 21 | ||
| orf3-mef(A)a | ORF3 | GGTATTGTTCAGGTAGGTC | 21 | 1,050 |
| OM18 | TGCTTGCCCTGCCCATATT | 10 | ||
| mef(A)a | MEFA1 | AGTATCATTAATCACTAGTGC | 39 | 348 |
| MEFA2 | TTCTTCTGGTACTAAAAGTGG | 39 | ||
| mef(A)a | MEF3 | GCGTTTAAGATAAGCTGGCA | 10 | 1,743 |
| MEF4 | CCTGCACCATTTGCTCCTAC | 10 | ||
| mef(A)-msr(D)a | MF4AR | TTCTTTGCTGATAAAATCGGTGT | 21 | 440 |
| ORF5F-R | GGCAAGTTCACCCAGATG | 21 | ||
| msr(D)a | MSRD1 | TGCCTATATTCCCCAGTT | 1 | 708 |
| MSRD2 | TTAATTTCCGCACCGACTA | 1 | ||
| msr(D)-orf6a | MSRD2F | TAGTCGGTGCGGAAATTAA | 1 | 893 |
| ORF6R | CTACCGCTACTCCAACATG | 21 | ||
| orf6-orf7a | ORF6 | CATGTTGGAGTAGCGGTAG | 21 | 202 |
| ORF7R | CCAAGTCTGACCAAAGATTTC | 21 | ||
| orf7-orf8a | ORF7 | GAAATCTTTGGTCAGACTTGG | 21 | 297 |
| ORF8R | CGCTGGTGGATTGGAGGG | 21 | ||
| celB | CELB1 | GAGAAAGTATTTTCTACGGGATGT | 37 | 430 |
| CELB2 | CCATACAGAACTAGGGTATCATCGTG | 37 | ||
| orf9-mef | MEFA2 | TTCTTCTGGTACTAAAAGTGG | 39 | 1,795 |
| SG3 | GAATCTTTAGCCAGCGGTATC | 11 | ||
| int | INT1 | GCGTGATTGTATCTCACT | 31 | 1,046 |
| INT2 | GACGCTCCTGTTGCTTCT | 31 | ||
| xis | XIS1 | AAGCAGACTGACATTCCTA | 1 | 194 |
| XIS2 | GCGTCCAATGTATCTATAA | 1 | ||
| tet(K) | TETK1 | TATTTTGGCTTTGTATTCTTTCAT | 42 | 1,159 |
| TETK2 | GCTATACCTGTTCCCTCTGATAA | 42 | ||
| tet(L) | TETL1 | ATAAATTGTTTCGGGTCGGTAAT | 42 | 1,077 |
| TETL2 | AACCAGCCAACTAATGACAATGAT | 42 | ||
| tet(M) | TETM3 | GAACTCGAACAAGAGGAAAGC | 30 | 740 |
| TETM4 | ATGGAAGCCCAGAAAGGAT | 30 | ||
| tet(O) | TETO1 | AACTTAGGCATTCTGGCTCAC | 30 | 2,002 |
| TETO3 | TGCTCCCACAAACAGGACACAATATC | 4 | ||
DNA sequence analysis.
Amplicon sequencing was performed bidirectionally using ABI Prism (Perkin-Elmer Applied Biosystems, Foster City, Calif.) with dye-labeled terminators. Sequences were analyzed using the Sequence Navigator software package (Perkin-Elmer Applied Biosystems). ORF analysis was performed with the DNA Star software package (Lasergene, Madison, Wis.), and sequence similarity was analyzed using the tools (BLAST and CDART) available online from the National Center for Biotechnology Information of the National Library of Medicine (Bethesda, Md.) (http://www.ncbi.nlm.nih.gov).
Transformation and conjugation experiments.
Transformation experiments were carried out as described previously by Pozzi et al. (32) using S. pneumoniae Rx1, a well-known unencapsulated laboratory strain, as the recipient. Transformants were selected by plating the transformation mixture onto selective plates containing erythromycin (1 μg/ml) and/or tetracycline (5 μg/ml). The transforming DNA was a pneumococcal crude lysate purified using Montage PCR filter units. The transformation frequency was expressed as the number of CFU of the transformants divided by the number of the recipients. After preliminary selection for resistance to rifampin (25 mg/liter) and fusidic acid (25 mg/liter), S. pneumoniae R6, a well-known laboratory strain susceptible to erythromycin and tetracycline, was used as the recipient in conjugation experiments. The mating procedure was performed as described previously by Luna and Roberts (22), with the exception that a 1:10 donor-recipient ratio was used. Transconjugants were selected by using multilayer selection plates that contained rifampin (10 μg/ml) and fusidic acid (10 μg/ml) plus erythromycin (1 μg/ml) and/or tetracycline (5μg/ml). The frequency of transfer was expressed as the number of transconjugants per donor.
RESULTS AND DISCUSSION
mef gene.
All 49 test strains had the mef gene. Based on PCR-RFLP analysis, the mef gene was identified as mef(A) in 30 isolates and mef(E) in 19 isolates (including the S. pseudopneumoniae strain).
Antibiotic susceptibilities.
Both mef(A) and mef(E) isolates were resistant to azithromycin, with an MIC range (2 to 32 μg/ml) similar to that of erythromycin (2 to 16 μg/ml). Remarkably, our results were not consistent with the reported finding of significantly higher erythromycin MICs for mef(A) than for mef(E) strains (1). All isolates were susceptible to rokitamycin, telithromycin, and clindamycin. Eight isolates, three carrying mef(A) and five, including the S. pseudopneumoniae strain, carrying mef(E), were resistant to tetracycline. All 30 mef(A) isolates were susceptible to penicillin, while 4 nonsusceptible isolates (3 resistant and 1 intermediate) were detected among mef(E) strains. No test strain was resistant or intermediate to levofloxacin.
While our finding of penicillin-nonsusceptible strains only among mef(E) pneumococci is consistent with findings of previous studies (3, 10), the detection of tetracycline-resistant strains among both mef(A) and mef(E) pneumococci is in contrast to previous reports of tetracycline resistance detected solely among the latter (1, 3, 10). A tetracycline-resistant mef(A) pneumococcus has only been described in a previous study by our group (25).
Typing.
PFGE types, MLST sequence types, and serotypes are summarized in Table 2. The MLST-based dendrogram of the genetic relationships among the 48 test strains of S. pneumoniae is illustrated in Fig. 1.
TABLE 2.
Typing and mef element of 49 clinical pneumococci with efflux-mediated erythromycin resistance subdivided according to the mef gene carried
| Isolates (total no.) bearing mef gene | PFGE type (no. of isolates) | MLST sequence type (no. of isolates) | Serotype (no. of isolates) |
mef element
|
|
|---|---|---|---|---|---|
| Tn1207.1 | mega | ||||
| mef(A) (30) | A (22) | ST9 (21) | 14 (17), 23F (2), 19A (1), 31 (1) | + | − |
| ST1733a (1) | 23F (1) | + | − | ||
| A1 (5) | ST9 (5) | 14 (3), 23F (1), 33A (1) | + | − | |
| A2 (1) | ST9 (1) | 3 (1) | + | − | |
| G (1) | ST1775a (1) | 3 (1) | + | − | |
| I (1) | ST9 (1) | 23F (1) | + | − | |
| mef(E) (19) | A (2) | ST9 (1) | 19F (1) | − | + |
| ST448 (1) | 6B (1) | − | + | ||
| A1 (1) | ST199 (1) | 23A (1) | − | + | |
| B (2) | ST81 (2) | 23F (1), 35 (1) | − | + | |
| B1 (1) | ST81 (1) | 23A (1) | − | + | |
| C (2)b | ST1774a (2) | 11A (2) | − | − | |
| D (2) | ST490 (2) | 18F (1), 19A (1) | − | + | |
| E (1) | ST180 (1) | 23F (1) | − | + | |
| E1 (1) | ST180 (1) | 9V (1) | − | + | |
| F (2) | ST156 (2) | 23F (2) | − | + | |
| H (1) | ST218 (1) | 12F (1) | − | + | |
| J (1) | ST1776a (1) | 3 (1) | − | + | |
| K (1)c | NDb (1) | 19A (1) | − | + | |
| L (1) | ST1250 (1) | 10F (1) | − | + | |
| M (1) | ST448 (1) | 6B (1) | − | + | |
New (not previously identified) sequence type.
In the course of this study, these two isolates were found to carry a novel mef gene variant, named mef(I).
S. pseudopneumoniae strain. ND, sequence type not determined; being an atypical pneumococcus, this strain could not be entered into the pneumococcal MLST database.
FIG. 1.
MLST-based dendrogram of the genetic relationships among the 48 test strains of S. pneumoniae. Genetic distances between sequence types are indicated. PFGE types corresponding to individual sequence types are shown in the third column (relevant numbers of isolates are reported in parentheses in case of more than one PFGE type per sequence type).
Of the 30 isolates carrying mef(A), 28 (93%), including 6 isolates assigned to closely related subtypes A1 (n = 5) and A2 (n = 1), shared the same PFGE fingerprint pattern (type A) of SmaI restriction digests, exactly corresponding to the England14-9 clone of the Pneumococcal Molecular Epidemiology Network (23) reported in the United Kingdom (16), Italy (10), and Spain (3). Of these 28 isolates, 20 belonged to serotype 14 and shared the same sequence type (ST9); the other eight type A isolates grouped into five different serotypes, but seven still yielded sequence type ST9, whereas the eighth isolate (serotype 23F) displayed a new (i.e., not previously identified) sequence type (ST1733). The remaining two mef(A) isolates (PFGE types G and I) belonged to serotypes 3 and 23F and yielded a new sequence type (ST1775) and the ST9 type, respectively. Thus, overall, 27 (90%) of the 30 mef(A) isolates shared the same sequence type (ST9) detected in Scottish (1) and Italian (24) surveys, and most (n = 20 [74%]) of these 27 isolates belonged to serotype 14. It is worth noting that, while variable rates of mef(A) pneumococci belonging to serotypes other than serotype 14 have been reported in some studies (1, 9, 24), this was the sole serotype found in other investigations (3, 10, 46).
Far greater heterogeneity was displayed by the 19 isolates carrying mef(E), which fell into 11 PFGE types (three of which, A, B, and E, were associated with one subtype each), 12 serotypes, and 12 sequence types, including two new ones and an undetermined type for the S. pseudopneumoniae strain (see below). Interestingly, while the isolates fell into the PFGE type A predominant among mef(A) isolates, the 12 serotypes did not include serotype 14, which, in contrast, has been found in mef(E) isolates from Spain (3), Canada (46), and other regions of the world (9) as well as in one Italian isolate also carrying erm(B) (24). The 12 sequence types included ST9, detected in a single PFGE type A, serotype 19F isolate, and two new sequence types (ST1774 and ST1776) corresponding to PFGE types C (two isolates, both belonging to serotype 11A) and J (one isolate belonging to serotype 3), respectively. The same serotype (6B) and sequence type (ST448) were shared by two isolates belonging to different PFGE types (A and M). The S. pseudopneumoniae strain was assigned to PFGE type K and serotype 19A; a sequence type could not be obtained because, being an atypical pneumococcus, it could not be entered into the pneumococcal MLST database. However, compared with the pairwise percentage differences in the allelic profiles of the seven housekeeping genes from typical pneumococci, those from this strain fitted within a range (2% to 7%) that was closer to that calculated for typical alleles included in the database than was the range reported for atypical pneumococci in other studies (29, 44).
mef elements.
The homogeneity of pneumococci carrying mef(A) was also confirmed with regard to the mef element which, in PCR experiments, was invariably found to be a regular Tn1207.1 transposon (38) inserted into the celB gene of the pneumococcal chromosome (Table 2).
In 17 (including the S. pseudopneumoniae strain) of the 19 mef(E) isolates, the mef(E) gene was carried by the mega element (13), whereas no PCR evidence of msr(D) or of the last three ORFs of mega was found in the remaining two isolates (Table 2). The last two isolates, which shared an identical PFGE type (C), serotype (11A), and new sequence type (ST1774) but which had been isolated from different materials in different areas and years, were also analyzed using the mef primer pair described previously by Del Grosso et al. (10), which yields a PCR product of 1,743 bp. The amplicons from the two isolates had identical sequences and demonstrated homologies of 93.6% and 91.4% with the corresponding sequences from the mega element and the Tn1207.1 transposon, respectively (Fig. 2).
FIG. 2.
A, alignment of three mef gene-containing nucleotide sequences: (i) amplicon obtained by pairing primers MEF3 and MEF4 (10) from the Tn1207.1 transposon (GenBank accession no. AF227520); (ii) corresponding sequence, containing the mef(E) gene, from the mega element (accession no. AF274302); (iii) corresponding sequence containing the mef(I) gene (accession no. AJ971089). B, alignment of the amino acid sequences corresponding to the coding regions of the three above-described nucleotide sequences. Alignments were obtained using the ClustalW program available online from the European Bioinformatics Institute (Cambridge, United Kingdom). Dots represent residues in nucleotide or amino acid sequences of ii and iii identical to those of i.
mef(I), a novel mef gene subclass.
The mef gene identified as mef(E) on the basis of PCR-RFLP analysis in the two isolates apparently lacking the mega element and showing comparable homologies with the mef(E) gene of mega and the mef(A) gene of Tn1207.1 appears to be a novel mef gene subclass that we propose to call mef(I). It is worth noting that divergences in the mef(E) gene sequence have never been reported (17). The amino acid sequence corresponding to mef(I) showed similarities of 96.5% to the protein encoded by mef(E) and of 94.3% to the protein encoded by mef(A), which are both greater than the similarity between mef(A) and mef(E) (93.8%).
Molecular characterization of tetracycline-resistant strains.
Tetracycline resistance genes sought using PCR included tet(K), tet(L), tet(M), and tet(O). The genes xis (excisase) and int (integrase) were analyzed to reveal the presence of conjugative transposons of the Tn916 family (7) (both genes were tested after pneumococci that were positive for only one of them were described [1]). The major findings of the molecular characterization of the eight tetracycline-resistant isolates are summarized in Table 3.
TABLE 3.
Molecular characterization of eight tetracycline-resistant isolates detected among 49 clinical pneumococci with efflux-mediated erythromycin resistance subdivided according to the mef gene carried
| Tetracycline-resistant isolates (total no.) bearing mef gene | Tetracycline resistance genea
|
Genes of Tn916-like transposons
|
Apparent linkageb between the relevant mef gene and the relevant tet gene | ||
|---|---|---|---|---|---|
| tet(M) | tet(O) | xis | int | ||
| mef(A) (3) | + | + | + | No | |
| + | + | + | No | ||
| + | + | + | No | ||
| mef(E) (5)c | + | + | + | Yesd | |
| + | + | + | Yesd | ||
| + | + | + | Yesd | ||
| + | + | + | No | ||
| + | − | − | No | ||
tet(K) and tet(L) were not detected in any test strain.
Of course, a linkage could be detected provided that the two genes were not so distant as to prevent PCR products from being obtained.
The fifth, tet(O)-positive isolate was the S. pseudopneumoniae strain.
The linkage between mef(E) and tet(M) was due to the integration of the mega element into a Tn916-like transposon to form the composite element Tn2009 (11).
All three tetracycline-resistant isolates bearing mef(A) had the tet(M) gene and were positive for xis and int. No apparent linkage between mef(A) and tet(M) was detected in cross-PCR assays with primers specific for the two genes. Both mef(A)- and tet(M)-carrying elements could be separately transferred: Tn1207.1 in transformation assays to the Rx1 recipient (frequency, 2 × 10−5) and Tn916 in conjugation assays to the R6 recipient (frequency, 8 × 10−8).
In four of the five tetracycline-resistant isolates bearing mef(E), PCR assays showed the presence of genes tet(M), xis, and int. The tet(M) genes of these four isolates had identical sequences and were identical to the tet(M) gene carried by Tn5251 (GenBank accession no. X90939), a transposon of the Tn916 family previously described in S. pneumoniae (33). Pairing of a mef-specific primer (MEFA1) with a primer specific for tet(M) (TETM3) (Table 1) yielded an amplicon of approximately 5.5 kb in three isolates, indicating linkage and opposite and convergent orientations of the genes mef(E) and tet(M). In these three isolates, PCR assays performed by pairing primers SG3 and MEFA2 (Table 1) confirmed the integration of the mega element into a Tn916-like transposon, and sequencing of the PCR product identified this composite element as Tn2009 (GenBank accession no. AF376746) (11). No amplicon was obtained with the fourth isolate using the four combinations of primer pairs associated with the possible reciprocal orientation of mef(E) and tet(M), showing that the two genes were unlinked and that the mega and Tn916-like elements were not integrated to form a composite element in this strain. When transformation and conjugation experiments were performed using two of these four tet(M)-carrying isolates as donors, i.e., one of those carrying Tn2009 and the one with unlinked mef(E) and tet(M), neither transformants nor transconjugants were obtained with the former donor, whereas transformants and transconjugants were both obtained with the latter donor (the mega element was transformed at a frequency of 1.8 × 10−6, and the Tn916-like element was transferred at a frequency of 2.6 × 10−7). The fifth tetracycline-resistant isolate that contained mef(E) (in a regular mega element) was the S. pseudopneumoniae strain. Its tetracycline resistance was due to the presence of the tet(O) gene. This could not be transferred by either transformation or conjugation and exhibited sequence homologies of 98.8% with the tet(O) gene from S. pneumoniae isolated in South Africa (GenBank accession no. Y07780) (45) and of 98.5% with the same gene from S. pyogenes recently described in Italy (GenBank accession no. AJ715499) (4, 14). No apparent linkage between mef(E) and tet(O) was detected in this strain in cross-PCR assays with primers specific for the two genes. The tet(O) gene has so far been reported in S. pneumoniae from only two geographic areas: South Africa (45) and Washington State (22). The failure to find it in Europe had been attributed to the requirement for acquisition of the gene and the absence of selective pressure (18). However, the tet(O) gene has recently been found to be the customary tetracycline resistance determinant in the erythromycin-resistant S. pyogenes strains carrying gene mef(A) (4, 14) or erm(A) (14).
Conclusions.
After initial perplexity (10, 26) about the usefulness of uniting the mef(A) and mef(E) variants of the mef gene under a single class designated mef(A) (35), and after several authors continued using the names mef(A) and mef(E) in spite of this recommendation, a recent minireview concluded that the current knowledge of the properties of the mef genes is now in favor of maintaining the original distinction (17). The most straightforward method for molecular discrimination between mef(A) and mef(E) is based on the differential presence of restriction enzyme recognition sites in the two genes (17), and differentiation can be achieved by means of RFLP analysis of different PCR products (10, 26). However, this method was unable to detect the mef(I) gene subclass and differentiate it from mef(E). mef(I) did not exactly match with either mef(A) (91.4% homology) or mef(E) (93.6% homology) and occurred in the absence of both the Tn1207.1 transposon and the mega element. Sequencing experiments are in progress to understand whether the novel mef gene is associated with a new (or defective) genetic element, to set up a new PCR-RFLP approach capable of differentiating among the three mef gene variants, and to assess the meaning of the lack of PCR evidence of the msr(D) gene. Indeed, it cannot be excluded that differences similar to those emerging in the mef gene class and resulting in the novel mef variant might also be present in the msr gene class and result in msr variants that are undetectable using the customary primers. Gay and Stephens (13) showed that msr(D) not only is consistently found adjacent to mef(E) but is also cotranscribed with it and suggested that the proteins encoded by the two genes are a dual efflux system in S. pneumoniae. More recently, the ATP-dependent efflux pump encoded by msr(D) has been reported to be capable of functioning independently of that encoded by mef(E) (9) and has even been reported to be more important in determining M-type macrolide resistance (F. Iannelli, M. Santagati, J. D. Doquier, M. Cassone, M. R. Oggioni, G. Rossolini, S. Stefani, and G. Pozzi, Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C1-1188, 2004). However, the erythromycin MICs for the two mef(I)-positive isolates (16 μg/ml) were in the high MIC range (2 to 16 μg/ml) for the mef-positive isolates examined in this study. Remarkably, evidence is emerging that the mef gene, far from being confined to streptococci, can be associated with a wide range of gram-positive and gram-negative bacteria (8, 20, 21, 43). Whether the mef gene is close to an msr gene has not generally been investigated in these organisms, but, at least in Bacteroides strains, an msr gene has been found adjacent to mef (43). In contrast, no msr gene has been detected in a minority of viridans group streptococci carrying the mef gene (5).
Acknowledgments
We thank Eleonora Giovanetti for helpful discussions. We also thank Angela Brueggemann, curator of the S. pneumoniae database in the MLST website, for assessing new allelic variants in some of our isolates.
This work was supported in part by the Italian Ministry of Education, University, and Research.
REFERENCES
- 1.Amezaga, M. R., P. E. Carter, P. Cash, and H. McKenzie. 2002. Molecular epidemiology of erythromycin resistance in Streptococcus pneumoniae isolates from blood and noninvasive sites. J. Clin. Microbiol. 40:3313-3318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Arbique, J. C., C. Poyart, P. Trieu-Cuot, G. Quesne, M. G. S. Carvalho, A. G. Steigerwalt, R. E. Morey, D. Jackson, R. J. Davidson, and R. R. Facklam. 2004. Accuracy of phenotypic and genotypic testing for identification of Streptococcus pneumoniae and description of Streptococcus pseudopneumoniae sp. nov. J. Clin. Microbiol. 42:4686-4696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ardanuy, C., F. Tubau, J. Liñares, M. A. Domínguez, R. Pallarés, R. Martín, et al. 2005. Distribution of subclasses mefA and mefE of the mefA gene among clinical isolates of macrolide-resistant (M-phenotype) Streptococcus pneumoniae, viridans group streptococci, and Streptococcus pyogenes. Antimicrob. Agents Chemother. 49:827-829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Brenciani, A., K. K. Ojo, A. Monachetti, S. Menzo, M. C. Roberts, P. E. Varaldo, and E. Giovanetti. 2004. Distribution and molecular analysis of mef(A)-containing elements in tetracycline-susceptible and -resistant Streptococcus pyogenes clinical isolates with efflux-mediated erythromycin resistance. J. Antimicrob. Chemother. 54:991-998. [DOI] [PubMed] [Google Scholar]
- 5.Cerdá Zolezzi, P., L. Millán Laplana, C. Rubio Calvo, P. Goñi Cepero, M. Canales Erazo, and R. Gómez-Lus. 2004. Molecular basis of resistance to macrolides and other antibiotics in commensal viridans group streptococci and Gemella spp. and transfer of resistance genes to Streptococcus pneumoniae. Antimicrob. Agents Chemother. 48:3462-3467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Clancy, J., J. Petitpas, F. Dib-Hajj, W. Yuan, M. Cronan, A. V. Kamath, J. Bergeron, and J. A. Retsema. 1996. Molecular cloning and functional analysis of a novel macrolide resistance determinant, mefA, from Streptococcus pyogenes. Mol. Microbiol. 22:867-879. [DOI] [PubMed] [Google Scholar]
- 7.Clewell, D. B., S. E. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 3:229-236. [DOI] [PubMed] [Google Scholar]
- 8.Cousin, S., Jr., W. L. H. Whittington, and M. C. Roberts. 2003. Acquired macrolide resistance genes in pathogenic Neisseria spp. isolated between 1940 and 1987. Antimicrob. Agents Chemother. 47:3877-3880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Daly, M. M., S. Doktor, R. Flamm, and D. Shortridge. 2004. Characterization and prevalence of MefA, MefE, and the associated mrs(D) gene in Streptococcus pneumoniae clinical isolates. J. Clin. Microbiol. 42:3570-3574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Del Grosso, M., F. Iannelli, C. Messina, M. Santagati, N. Petrosillo, S. Stefani, G. Pozzi, and A. Pantosti. 2002. Macrolide efflux genes mef(A) and mef(E) are carried by different genetic elements in Streptococcus pneumoniae. J. Clin. Microbiol. 40:774-778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Del Grosso, M., A. Scotto d'Abusco, F. Iannelli, G. Pozzi, and A. Pantosti. 2004. Tn2009, a Tn916-like element containing mef(E) in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 48:2037-2042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Enright, M. C., and B. G. Spratt. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 144:3049-3060. [DOI] [PubMed] [Google Scholar]
- 13.Gay, K., and D. S. Stephens. 2001. Structure and dissemination of a chromosomal insertion element encoding macrolide efflux in Streptococcus pneumoniae. J. Infect. Dis. 184:56-65. [DOI] [PubMed] [Google Scholar]
- 14.Giovanetti, E., A. Brenciani, R. Lupidi, M. C. Roberts, and P. E. Varaldo. 2003. Presence of the tet(O) gene in erythromycin- and tetracycline-resistant strains of Streptococcus pyogenes and linkage with either the mef(A) or the erm(A) gene. Antimicrob. Agents Chemother. 47:1935-1940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Giovanetti, E., M. P. Montanari, M. Mingoia, and P. E. Varaldo. 1999. Phenotypes and genotypes of erythromycin-resistant Streptococcus pyogenes strains in Italy and heterogeneity of inducibly resistant strains. Antimicrob. Agents Chemother. 43:1935-1940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hall, L. M. C., R. A. Whiley, B. Duke, R. C. George, and A. Efstratiou. 1996. Genetic relatedness within and between serotypes of Streptococcus pneumoniae from the United Kingdom: analysis of multilocus enzyme electrophoresis, pulsed-field gel electrophoresis, and antimicrobial resistance patterns. J. Clin. Microbiol. 34:853-859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Klaassen, C. H., and J. W. Mouton. 2005. Molecular detection of the macrolide efflux genes: to discriminate or not between mef(A) and mef(E). Antimicrob. Agents Chemother. 49:1271-1278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Klugman, K. P. 2002. The successful clone: the vector of dissemination of resistance in Streptococcus pneumoniae. J. Antimicrob. Chemother. 50(Suppl. S2):1-5. [DOI] [PubMed] [Google Scholar]
- 19.Leclercq, R., and P. Courvalin. 2002. Resistance to macrolides and related antibiotics in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 46:2727-2734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Luna, V. A., P. Coates, E. A. Eady, J. Cove, T. T. H. Nguyen, and M. C. Roberts. 1999. A variety of gram-positive bacteria carry mobile mef genes. J. Antimicrob. Chemother. 44:19-25. [DOI] [PubMed] [Google Scholar]
- 21.Luna, V. A., M. Heiken, K. Judge, C. Ulep, N. Van Kirk, H. Luis, M. Bernaedo, J. Leitao, and M. C. Roberts. 2002. Distribution of mef(A) in gram-positive bacteria from healthy Portuguese children. Antimicrob. Agents Chemother. 46:2513-2517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Luna, V. A., and M. C. Roberts. 1998. The presence of the tetO gene in a variety of tetracycline-resistant Streptococcus pneumoniae serotypes from Washington State. J. Antimicrob. Chemother. 42:613-619. [DOI] [PubMed] [Google Scholar]
- 23.McGee, L., L. McDougal, J. Zhou, B. G. Spratt, F. C. Tenover, R. George, R. Hakenbeck, W. Hryniewicz, J. C. Lefèvre, A. Tomasz, and K. P. Klugman. 2001. Nomenclature of major antimicrobial-resistant clones of Streptococcus pneumoniae defined by the Pneumococcal Molecular Epidemiology Network. J. Clin. Microbiol. 39:2565-2571. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Monaco, M., R. Camilli, F. D'Ambrosio, M. Del Grosso, and A. Pantosti. 2005. Evolution of erythromycin resistance in Streptococcus pneumoniae in Italy. J. Antimicrob. Chemother. 55:256-259. [DOI] [PubMed] [Google Scholar]
- 25.Montanari, M. P., I. Cochetti, M. Mingoia, and P. E. Varaldo. 2003. Phenotypic and molecular characterization of tetracycline- and erythromycin-resistant strains of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 47:2236-2241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Montanari, M. P., M. Mingoia, I. Cochetti, and P. E. Varaldo. 2003. Phenotypes and genotypes of erythromycin-resistant pneumococci in Italy. J. Clin. Microbiol. 41:428-431. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Montanari, M. P., M. Mingoia, E. Giovanetti, and P. E. Varaldo. 2001. Differentiation of resistance phenotypes among erythromycin-resistant pneumococci. J. Clin. Microbiol. 39:1311-1315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.National Committee for Clinical Laboratory Standards. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 6th ed. Approved standard M7-A6. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 29.Obregón, V., P. García, E. García, A. Fenoll, R. López, and J. L. García. 2002. Molecular peculiarities of the lytA gene isolated from clinical pneumococcal strains that are bile insoluble. J. Clin. Microbiol. 40:2545-2554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Olsvik, B., I. Olsen, and F. C. Tenover. 1995. Detection of tet(M) and tet(O) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease. Oral Microbiol. Immunol. 10:87-92. [DOI] [PubMed] [Google Scholar]
- 31.Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courvalin. 1989. Molecular characterization of two proteins involved in the excision of the conjugative transposon Tn1545: homologies with other site-specific recombinases. EMBO J. 8:2425-2433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Pozzi, G., L. Masala, F. Iannelli, R. Manganelli, L. S. Havarstein, L. Piccoli, D. Simon, and D. A. Morrison. 1996. Competence for genetic transformation in encapsulated strains of Streptococcus pneumoniae: two allelic variants of the peptide pheromone. J. Bacteriol. 178:6087-6090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Provvedi, R., R. Manganelli, and G. Pozzi. 1996. Characterization of conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol. Lett. 135:231-236. [DOI] [PubMed] [Google Scholar]
- 34.Ripa, S., C. Zampaloni, L. A. Vitali, E. Giovanetti, M. P. Montanari, M. Prenna, and P. E. Varaldo. 2001. SmaI macrorestriction analysis of Italian isolates of erythromycin-resistant Streptococcus pyogenes and correlations with macrolide-resistance phenotypes. Microb. Drug Resist. 7:65-71. [DOI] [PubMed] [Google Scholar]
- 35.Roberts, M. C., J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H. Seppälä. 1999. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob. Agents Chemother. 43:2823-2830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ross, J. I., E. A. Eady, J. H. Cove, W. J. Cunliffe, S. Baumberg, and J. C. Wootton. 1990. Inducible erythromycin resistance in staphylococci is encoded by a member of the ATP-binding transport super-gene family. Mol. Microbiol. 4:1207-1214. [DOI] [PubMed] [Google Scholar]
- 37.Santagati, M., F. Iannelli, C. Cascone, F. Campanile, M. R. Oggioni, S. Stefani, and G. Pozzi. 2003. The novel conjugative transposon Tn1207.3 carries the macrolide efflux gene mef(A) in Streptococcus pyogenes. Microb. Drug Resist. 9:243-247. [DOI] [PubMed] [Google Scholar]
- 38.Santagati, M., F. Iannelli, M. R. Oggioni, S. Stefani, and G. Pozzi. 2000. Characterization of a genetic element carrying the macrolide efflux gene mef(A) in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 44:2585-2587. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562-2566. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Sutcliffe, J., A. Tait-Kamradt, and L. Wondrack. 1996. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40:1817-1824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Tait-Kamradt, A., J. Clancy, M. Cronan, F. Dib-Hajj, L. Wondrack, W. Yuan, and J. Sutcliffe. 1997. mefE is necessary for erythromycin-resistant M phenotype in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 41:2251-2255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Trzcinski, K., B. S. Cooper, W. Hryniewicz, and C. G. Dowson. 2000. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J. Antimicrob. Chemother. 45:763-770. [DOI] [PubMed] [Google Scholar]
- 43.Wang, Y., G. R. Wang, A. Shelby, N. B. Shoemaker, and A. A. Salyers. 2003. A newly discovered Bacteroides conjugative transposon, CTnGERM1, contains genes also found in gram-positive bacteria. Appl. Environ. Microbiol. 69:4595-4603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Whatmore, A. M., A. Efstratiou, A. P. Pickerill, K. Broughton, G. Woodard, D. Sturgeon, R. George, and C. G. Dowson. 2000. Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: characterization of “atypical” pneumococci and organisms allied to S. mitis harboring S. pneumoniae virulence factor-encoding genes. Infect. Immun. 68:1374-1382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Widdowson, C. A., K. P. Klugman, and D. Hanslo. 1996. Identification of the tetracycline resistance gene, tet(O), in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 40:2891-2893. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Wierzbowski, A. K., D. Swedlo, D. Boyd, M. Mulvey, K. A. Nichol, D. J. Hoban, and G. G. Zhanel. 2005. Molecular epidemiology and prevalence of macrolide efflux genes mef(A) and mef(E) in Streptococcus pneumoniae obtained in Canada from 1997 to 2002. Antimicrob. Agents Chemother. 49:1257-1261. [DOI] [PMC free article] [PubMed] [Google Scholar]