Skip to main content
NCBI home page
Human Molecular Genetics logoLink to Human Molecular Genetics
. 2025 Jul 10;34(18):1541–1552. doi: 10.1093/hmg/ddaf116

Novel neurofilament light (Nefl) E397K mouse models of Charcot–Marie-tooth type 2E (CMT2E) present early and chronic axonal neuropathy

Dennis O Pérez-López 1,2, Audrey A Shively 3, F Javier Llorente Torres 4,5, Mohammed T Abu-Salah 6, Michael L Garcia 7, W David Arnold 8,9, Monique A Lorson 10,11,✉, Christian Lorson 12,13,✉
PMCID: PMC13169171  PMID: 40635134

Abstract

Charcot–Marie-Tooth (CMT) is the most common hereditary peripheral neuropathy with an incidence of 1:2500. CMT2 clinical symptoms include distal muscle weakness and atrophy, sensory loss, toe and foot deformities, with some patients presenting with reduced nerve conduction velocity. Mutations in the neurofilament light chain (NEFL) gene result in a specific form of CMT2 disease, CMT2E. NEFL encodes the protein, NF-L, one of the core intermediate filament proteins that contribute to the maintenance and stability of the axonal cytoskeleton. To better understand the underlying biology of CMT2E disease and advance the development of therapeutics, we generated a Nefl+/E397K mouse model. While the Nefl+/E397K mutation is inherited in a dominant manner, we also characterized NeflE397K/E397K mice to determine whether disease onset, progression or severity would be impacted. Consistent with CMT2E, lifespan was not altered in these novel mouse models. A longitudinal electrophysiology study demonstrated significant in vivo functional abnormalities as early as P21 in distal latency, compound muscle action potential (CMAP) amplitude and negative area. A significant reduction in the sciatic nerve axon area, diameter, and G-ratio was also present as early as P21. Through the twelve months measured, disease became more evident in all assessments. Collectively, these results demonstrate an early and robust in vivo electrophysiological phenotype and axonal pathology, making Nefl+/E397K and NeflE397K/E397K mice ideal for the evaluation of therapeutic approaches.

Keywords: charcot marie tooth, animal model, peripheral nervous system, neurofilament

Graphical Abstract

Graphical Abstract.

Graphical Abstract

Open in a new tab

Introduction

Charcot–Marie-Tooth (CMT) is one of the most common inherited neurological disorders with an incidence of ~ 1:2500. Clinical classification of CMT is primarily based on patient electrophysiology measurements. There are eight classifications of CMT (1–7 and CMT-X). CMT1 and CMT2 are the most prevalent forms and are associated with deficiencies in myelination or axonal dysfunction and degeneration, respectively. CMT2 is a result of mutations in many genes. CMT2 clinical symptoms are characterized as slow but progressive with a wide spectrum of distal muscle weakness and atrophy, sensory loss, decreased deep-tendon reflexes, toe, and foot deformities, gait disturbances, with some patients presenting with reduced motor nerve conduction velocity (MNCV). CMT2E is caused by mutations in the neurofilament light chain (NEFL) gene and is primarily inherited in an autosomal dominant manner. CMT2E disease onset and severity are variable even within families with the same mutation [1–6].

Neurofilaments, also known as intermediate filaments, contribute to the expansion and maintenance of axonal caliber, axon structure and transport. Mutations in neurofilaments lead to axonal dysfunction, characteristic of CMT2. In peripheral nerves, neurofilament light protein (NF-L), neurofilament heavy (NF-H), neurofilament medium (NF-M), and peripherin assembly to form intermediate filaments. In the central nervous system (CNS), intermediate filaments are composed of the core proteins NF-H, NF-M, NF-L, and alpha internexin [3, 7–11]. There are over 30 different mutations in NEFL that are distributed throughout the three functional domains (head, rod, tail). Homozygous recessive mutations in NEFL, while rare, have been reported; however, CMT2E is primarily associated with dominant mutations. The most prevalent NEFL mutation, E396K, is located within a highly conserved motif at carboxy terminal end of the rod domain. The rod domain is involved in dimerization and mutations, such as E396K, likely disrupt neurofilament assembly [12]. Mutations in NEFL result in impaired axonal assembly, accumulation of neurofilaments, atrophied axons, and perturbed localization and transport of the mitochondria [13–15].

There are several mouse models of Nefl that are associated with patient mutations (NeflN98S, NeflP8R, NeflL394P, hNEFLE396K and hNEFLP22S) [14, 16–21]. NeflN98S and NeflP8R models have the orthologous mutation generated within the mouse genome, while the NeflL394P mouse has mutant mouse Nefl driven by the murine sarcoma virus promoter. hNEFLE396K and hNEFLP22S models each overexpress the human E396K or P22S transgenes, respectively, with wild type mouse Nefl expression present. Each model recapitulates many phenotypes associated with CMT2E disease to varying degrees. The NeflN98S mouse presents with the earliest disease onset and most robust axon pathology (~6 weeks) [16, 22]. As NEFLE396K is a predominant mutation, we wanted to examine disease biology in the context of the highly conserved mouse genome with the orthologous mutation:E397K. While NEFL mutations are predominantly dominant, we examined Nefl+/E397K and NeflE397K/397K mice to determine whether disease onset or severity were altered. Here we report our electrophysiological findings, axonal pathology and neuromuscular junction innervation status for mouse models, Nefl+/E397K and NeflE397K/397K. These models show a clinically relevant phenotype with a chronic axonopathy characterized by electrophysiological deficits. Importantly, these mouse models provide an important context for future therapeutic development.

Results

Generation of the Nefl E397K mouse models of CMT2E

Mutations in the NEFL gene result in CMT2E, a slowly progressive disease characterized by motor function deficits and axonal pathology. To better understand disease development and mechanistic pathways, we generated a Nefl+/E397K mouse model with an orthologous mutation that corresponds to the human NEFL-E396K mutation (Fig. 1A). While Nefl-E397K presents as a dominant mutation, we wanted to determine whether the NeflE397K/E397K mouse would be more severe; therefore, Nefl+/E397K and NeflE397K/E397K mice were analyzed. Mice were identified using allele-specific PCR. Survival was monitored over 360 days with 100% survival for the Nefl+/E397K and the NeflE397K/E397K mice (Fig. 1B), consistent with CMT2E patient outcomes. Weight was measured from P1-P360; there was no statistical difference between wild type (mean 27.72 grams) and Nefl+/E397K mice (mean 28.76 grams), but there was statistical significance difference in wild type versus NeflE397K/E397K mice (mean 25.41 grams, P < 0.0001). From ~P240, NeflE397K/E397K mice trended towards weighing less (Fig. 1C). There were no sex-based differences for weight; all male mice gained weight at higher rates than females of the same genotype. Nefl+/E397K and the NeflE397K/E397K mice were phenotypically indistinguishable compared to their wild type littermates at early time points; however, as disease progressed there were overt signs of hindlimb weakness (Fig. 1D). To measure the impact of the E397K mutation on protein expression, total protein extract from the mouse sciatic nerve was analyzed by Western blot. NF-L expression was reduced compared to wildtype in the Nefl+/E397K samples and was further reduced in the NeflE397K/E397K extracts (Fig. 1E, mean 1.10, P = 0.0421; mean 0.125, P = 0.0022, respectively).

Figure 1.

Figure 1

Open in a new tab

Generation of the Nefl E397K mouse models of CMT2E. (A) Cartoon depicting the neurofilament light protein (NF-L). The glutamic acid to lysine (E397K) alteration with nucleotide changes GAA to AAA were generated using CRISPR Cas9. The wild type Nefl, Nefl+/E397K and NeflE397K/E397K sequences generated from tail DNA isolated from wild type and Nefl mutant mice. (B) Percent survival for wild type, Nefl+/E397K and NeflE397K/E397K mice recorded from P0 to P360. (C) Weight in grams for wild type, Nefl+/E397K and NeflE397K/E397K mice recorded from P0 to P360. One way ANOVA with Tukey’s multiple comparison test was used to determine significance. (D) Images of wild type and Nefl mutant mice. Top images are of female mice at P120. Bottom images are of male mice at P360. (E) NF-L protein western blot representative image of the mouse sciatic nerve. NF-L protein relative band intensities for wild type (mean 2.166), Nefl+/E397K mice (mean 1.10), and NeflE397K/E397K mice (mean 0.125). N = number of animals evaluated, g = grams, P = postnatal day.

Electrophysiology showed an early clinically relevant phenotype

One of the hallmarks of CMT2E disease is the presence of distinct electrophysiological abnormalities, which can also be assessed in mice. While there is variability within the patient population, CMT2E patients have relatively preserved MNCV values with reduced amplitudes of sensory and CMAP responses [23]. However, a subset of CMT2E patients have reduced MNCV that is attributed to a decrease in axon caliber and not myelination [2, 24, 25].

An initial electrophysiology study was conducted on four cohorts of animals at three weeks, twelve weeks, six months and twelve months of age. At each time point, animals were sacrificed and tissues were collected. Electrophysiological measurements were recorded from the right rear leg (including the gastrocnemius and tibialis anterior) and included distal latency, CMAP amplitude (measured peak-to-peak), and negative peak area. At three weeks, distal latency was significantly prolonged in Nefl+/E397K (0.7586 ms, P = 0.0026) and NeflE397K/E397K (0.7963 ms, P = 0.0085) mice when compared to wild type (0.5271 ms) (Fig. 2A). CMAP amplitude and negative area were also significantly different in the Nefl mutants when compared to the wild type cohort (Fig. 2A). At twelve weeks, the distal latency of Nefl+/E397K (0.7532 ms, P = 0.0008) and NeflE397K/E397K (0.9213 ms, P < 0.0001) mice was prolonged compared to wild type mice (0.5208 ms) with significant worsening in NeflE397K/E397K mice (Fig. 2B). CMAP amplitude also remained significantly different between the Nefl mutants and the wild type cohort at twelve weeks (Fig. 2B). Interestingly, at twelve weeks there was improvement in the negative area of Nefl+/E397K mice but NeflE397K/E397K mice remained significantly reduced from wild type mice (Fig. 2B). At six and twelve months, there remained significant differences between wild type and Nefl mutants in distal latency; however, CMAP amplitude and negative area values were similar between all cohorts (Fig. 2C and D). These results show that Nefl+/E397K and NeflE397K/E397K mice have significant defects in distal latency starting at P21 and continuing throughout the study (P360).

Figure 2.

Figure 2

Open in a new tab

Electrophysiology showed an early clinically relevant phenotype. Distal latency, CMAP amplitude and negative area were measured following stimulation of the sciatic nerve and recordings from the lower right leg region (including the gastrocnemius and tibialis anterior). Wild type, Nefl+/E397K and NeflE397K/E397K mice were evaluated at three weeks, twelve weeks, six months, and twelve months. (A) Electrophysiology recordings at three weeks, wild type (N = 17), Nefl+/E397K (N = 23) and NeflE397K/E397K (N = 8). Distal latency for wild type (mean = 0.5271), Nefl+/E397K (mean = 0.7586, P = 0.0026) and NeflE397K/E397K (mean = 0.7963, P = 0.0085) mice. CMAP amplitude for wild type (mean = 68.13), Nefl+/E397K (mean = 57.82, P = 0.0037) and NeflE397K/E397K (mean = 42.23, P < 0.0001) mice. Negative area for wild type (mean = 25.89), Nefl+/E397K (mean = 22.30, P = 0.0341) and NeflE397K/E397K (mean = 19.65, P = 0.0051) mice. (B) Electrophysiology recordings at twelve weeks, wild type (N = 13), Nefl+/E397K (N = 19) and NeflE397K/E397K (N = 8). Distal latency for wild type (mean = 0.5208), Nefl+/E397K (mean = 0.7532, P = 0.0008) and NeflE397K/E397K (mean = 0.9213, P < 0.0001) mice. CMAP amplitude for wild type (mean = 84.15), Nefl+/E397K (mean = 71.43, P = 0.0224) and NeflE397K/E397K (mean = 59.93, P = 0.0005) mice. Negative area for wild type (mean = 31.63), Nefl+/E397K (mean = 28.08, NS) and NeflE397K/397K (mean = 23.34, P = 0.0240) mice. (C) Electrophysiology recordings at six months, wild type (N = 16), Nefl+/E397K (N = 23) and NeflE397K/E397K (N = 15). Distal latency for wild type (mean = 0.4338), Nefl+/E397K (mean = 0.4983, NS) and NeflE397K/E397K (mean = 0.5727, P = 0.0007) mice. CMAP amplitude and negative area were not statistically significant between genotypes. (D) Electrophysiology recordings at twelve months, wild type (N = 10), Nefl+/E397K (N = 8) and NeflE397K/E397K (N = 9). Distal latency for wild type (mean = 0.4920), Nefl+/E397K (mean = 0.6900, P = 0.0065) and NeflE397K/E397K (mean = 0.7922, P < 0.0001) mice. CMAP amplitude and negative area were not statistically significant between genotypes. Statistical significance was determined using ordinary one-way ANOVA and Dunnett’s multiple comparisons test. Ms = milliseconds, mV = millivolts, CMAP = compound muscle action potential, NS = not significant, N = number of mice evaluated.

The initial electrophysiology study showed prolonged distal latency from three weeks to twelve months in the Nefl mutants; however, CMAP amplitude and negative area differences improved from P21 to P360. To determine whether these changes reflected disease progression, a twelve-month longitudinal study was performed on a cohort of wild type, Nefl+/E397K and NeflE397K/E397K mice. The longitudinal assessments showed that the NeflE397K/E397K presented with prolonged distal latency as early as P21, while Nefl+/E397K distal latency became statistically different from wild type mice at P90 (Supplementary Fig. 1A). The mean distal latency between wild type (0.4630 ms) and Nefl+/E397K mice (0.6545 ms) was statistically different (P = 0.0002), as well as between NeflE397K/E397K mice (0.8745 ms, P < 0.0001). There was also a statistical significance in distal latency between Nefl+/E397K and NeflE397K/E397K mice (P = 0.0010). NeflE397K/E397K distal latency was statistically different from wild type mice throughout the study (P21-P360) suggesting, like some CMT2E patients, there is a reduction in axon caliber (Supplementary Fig. 1A). Interestingly, P21-P60 NeflE397K/E397K CMAP amplitude values were statistically different from wild type mice; however, for the remainder of the study differences varied (Supplementary Fig. 1B). There was a statistical difference between the mean CMAP amplitude values for wild type (81.12 mV) and Nefl+/E397K mice (76.41 mV, P = 0.0319) and NeflE397K/E397K mice (66.39 mV, P = 0.0001). As well, there were CMAP amplitude differences between Nefl+/E397K and NeflE397K/E397K mice (P = 0.0012). The same trends were observed for negative area measurements in NeflE397K/E397K mice (Supplementary Fig. 1C). There was no statistical difference between the mean negative area values for wild type (26.55) and Nefl+/E397K mice (26.51) and NeflE397K/E397K mice (23.93). Importantly, results of the longitudinal study were consistent with the mixed cohort electrophysiology study; distal latency was severely impacted early in NeflE397K/E397K mice with differences occurring later in Nefl+/E397K mice. In NeflE397K/E397K and Nefl+/E397K mice, CMAP amplitude and negative area differences were apparent early; however, measurable differences were not observed later in the disease. The subtle differences between the two studies were likely attributed to disease variation between the cohorts.

To determine whether there was variability between individual mice in the longitudinal study, consistent with the CMT2E patient population, we analyzed the longitudinal electrophysiology data from P21 to P360 per mouse (Supplementary Fig. 2A-C). When measurements were followed for each mouse, there was little variability between P21 wild type mice in distal latency (0.560 ms ±0.14); however, there was measurable variability between Nefl+/E397K (0.870 ms ±0.495) and NeflE397K/E397K mice (0.844 ms ±0.306) (Supplementary Fig. 2A). The variability between Nefl mutant mice diminished by P180 (wild type 0.444 ms ±0.044; +/E397K 0.740 ms ±0.119; E397K/E397K mice 0.731 ms ±0.173); however, distal latency variability was increased in the Nefl mutants compared to wild type mice at all timepoints measured (Supplementary Fig. 2A). However, CMAP amplitude values for NeflE397K/E397K mice (66.49 mV ±3.98, P < 0.0001) trended lower at all timepoints when compared to wild type mice (81.12 mV ±2.85) (Supplementary Fig. 2B and C).

Nefl mutant mice showed chronic axonal neuropathy

Our electrophysiology findings showed that there were measurable differences in Nefl mutants. To further quantify these deficits, we examined the histopathology of the sciatic nerve at P21, P84, P180, and P360 (Fig. 3, Table 1). Axon area, axon diameter and G-ratio (ratio of the inner axonal diameter to the total outer diameter) were measured. Cross-sectional images of the sciatic nerve showed significant changes in Nefl+/E397K and NeflE397K/E397K mice at all time points analyzed. At P21, significant changes in axon area were apparent in Nefl+/E397K (0.0047μm2, P < 0.0001) and NeflE397K/E397K (0.0035μm2, P < 0.0001) compared to wild type mice (0.0122μm2) (Fig. 3, Table 1). Throughout the analyses, axon area was consistently smaller in Nefl+/E397K (P360, 0.0148μm2, P < 0.0001) and NeflE397K/E397K (P360, 0.0098μm2, P < 0.0001) mice when compared to wild type mice (P360, 0.0314μm2) (Fig. 3, Table 1). Axon diameter was also significantly reduced in Nefl+/E397K and NeflE397K/E397K mice at all time points analyzed (Fig. 3, Table 1). The G-ratio was also reduced in Nefl+/E397K (P360 0.5557, P < 0.0001) and NeflE397K/E397K mice (P360 0.5515, P < 0.0001) compared to wild type mice (P360 0.6415). (Fig. 3, Table 1). From three weeks to twelve months, differences in axon area, diameter and G-ratio were more apparent in NeflE397K/E397K mice as compared to Nefl+/E397K mice (Fig. 3, Table 1). The reduced axon number/field from twelve weeks to six months in Nefl E397K/E397K (P = 0.0266) largely is not a result of increased number of axons with larger caliber but is attributed to loss of axons (Fig. 3, Table 1). From six months to twelve months, some regeneration is likely occurring. There is a substantial increase in the number of axons/field from six months to twelve months in NeflE397K/E397K and Nefl+/E397K mice and those axons represent smaller axons (Fig. 3A-E, Table 1, Supplementary Fig. 3). Importantly, the chronic axonal neuropathy observed in NeflE397K/E397K and Nefl+/E397K mice was consistent with the impaired distal latency measured by electrophysiology.

Figure 3.

Figure 3

Open in a new tab

Nefl mutant mice showed chronic axonal neuropathy. The sciatic nerve was harvested from wild type (N = 16) Nefl+/E397K (N = 17) and NeflE397K/E397K (N = 16) mice at three weeks, twelve weeks, six months, and twelve months of age. (A) Sciatic nerve at three weeks were evaluated in wild type (N = 5), Nefl+/E397K (N = 4) and NeflE397K/E397K (N = 5). Three weeks axon area for wild type (0.0122μm2, 1141 axons), Nefl+/E397K (0.0047μm2, P < 0.0001, 623 axons) and NeflE397K/E397K (0.0035μm2, P < 0.0001, 724 axons) mice. Three weeks axon diameter for wild type (0.1196 μm, 1141 axons), Nefl+/E397K (0.0750 μm, P < 0.0001, 623 axons) and NeflE397K/E397K (0.0624 μm, P < 0.0001, 724 axons) mice. Three weeks G-ratio for wild type (0.6338, 800 axons), Nefl+/E397K (0.4802, P < 0.0001, 536 axons) and NeflE397K/E397K (0.4465, P < 0.0001, 653 axons) mice. (B) Sciatic nerve at twelve weeks were evaluated in wild type (N = 4), Nefl+/E397K (N = 6) and NeflE397K/E397K (N = 4). Twelve weeks axon area for wild type (0.0280μm2, 759 axons), Nefl+/E397K (0.0150μm2, P < 0.0001, 1090 axons) and NeflE397K/E397K (0.0110μm2, P < 0.0001, 795 axons) mice. Twelve weeks axon diameter for wild type (0.1724 μm, 759 axons), Nefl+/E397K (0.1281 μm, P < 0.0001, 1090 axons) and NeflE397K/E397K (0.1117 μm, P < 0.0001, 795 axons) mice. Twelve weeks G-ratio for wild type (0.6596, 653 axons), Nefl+/E397K (0.5981, P < 0.0001, 992 axons) and NeflE397K/E397K (0.5578, P < 0.0001, 644 axons) mice. (C) Sciatic nerve at six monthswere evaluated in wild type (N = 4), Nefl+/E397K (N = 3) and NeflE397K/E397K (N = 4). Six months axon area for wild type (0.0250μm2, 704 axons), Nefl+/E397K (0.0131μm2, P < 0.0001, 553 axons) and NeflE397K/E397K (0.0076μm2, P < 0.0001, 769 axons) mice. Six months axon diameter for wild type (0.1670 μm, 704 axons), Nefl+/E397K (0.1215 μm, P < 0.0001, 553 axons) and NeflE397K/E397K (0.0915 μm, P < 0.0001, 769 axons) mice. Six months G-ratio for wild type (0.6386, 622 axons), Nefl+/E397K (0.5751, P < 0.0001, 464 axons) and NeflE397K/E397K (0.5093, P < 0.0001, 635 axons) mice. (D) Sciatic nerve at twelve months were evaluated in wild type (N = 3), Nefl+/E397K (N = 4) and NeflE397K/E397K (N = 3). Twelve months axon area for wild type (0.0314μm2, 542 axons), Nefl+/E397K (0.0148μm2, P < 0.0001, 719 axons) and NeflE397K/E397K (0.0098μm2, P < 0.0001, 627 axons) mice. Twelve months axon diameter for wild type (0.1802 μm, 542 axons), Nefl+/E397K (0.1302 μm, P < 0.0001, 719 axons) and NeflE397K/E397K (0.1049 μm, P < 0.0001, 627 axons) mice. Twelve months G-ratio for wild type (0.6415, 480 axons), Nefl+/E397K (0.5557, P < 0.0001, 636 axons) and NeflE397K/E397K (0.5515, P < 0.0001, 465 axons) mice. (E) Representative images of axons from wild type, Nefl+/E397K and NeflE397K/E397K mice at three weeks, twelve weeks, six months and twelve months of age following. Statistics were determined using one-way ANOVA with Dunnett’s multiple comparison test. N = number of mice evaluated.

Table 1.

Axon area, axon diameter, G-ratio and axon numbers. The values reported are the mean ± standard error of the mean.

Axon area (μm2) Nefl+/+ Nefl+/E397K NeflE397K/E397K
3 weeks 0.0124 ± 0.00020 0.0046 ± 9.0e-005, P < 0.0001 0.0033 ± 9.3e-005, P < 0.0001
12 weeks 0.0352 ± 0.0011 0.0181 ± 0.00042, P < 0.0001 0.0122 ± 0.00024, P < 0.0001
6 months 0.0274 ± 0.00075 0.0118 ± 0.00027, P < 0.0001 0.0067 ± 0.00016, P < 0.0001
12 months 0.0370 ± 0.0013 0.0169 ± 0.00038, P < 0.0001 0.0092 ± 0.00025, P < 0.0001
Axon diameter (μm) Nefl+/+ Nefl+/E397K NeflE397K/E397K
3 weeks 0.1225 ± 0.0010 0.0747 ± 0.00079, P < 0.0001 0.0628 ± 0.0010, P < 0.0001
12 weeks 0.1948 ± 0.0025 0.1457 ± 0.0016, P < 0.0001 0.1220 ± 0.0013, P < 0.0001
6 months 0.1813 ± 0.0026 0.1249 ± 0.0016, P < 0.0001 0.0932 ± 0.0013, P < 0.0001
12 months 0.2031 ± 0.0039 0.1443 ± 0.0018, P < 0.0001 0.1079 ± 0.0016, P < 0.0001
G-ratio Nefl+/+ Nefl+/E397K NeflE397K/E397K
3 weeks 0.6514 ± 0.0026 0.4802 ± 0.0046, P < 0.0001 0.4322 ± 0.0050, P < 0.0001
12 weeks 0.6983 ± 0.0027 0.6424 ± 0.0028, P < 0.0001 0.5977 ± 0.0037, P < 0.0001
6 months 0.6555 ± 0.0036 0.5890 ± 0.0045, P < 0.0001 0.5283 ± 0.0039, P < 0.0001
12 months 0.6884 ± 0.0045 0.5903 ± 0.0040, P < 0.0001 0.5744 ± 0.0047, P < 0.0001
Axon number/field in sciatic nerve Nefl+/+ Nefl+/E397K NeflE397K/E397K
3 weeks 528.60 ± 41.99 744.60 ± 47.71, P = 0.0042 731.40 ± 48.13, P = 0.0106
12 weeks 436.00 ± 55.35 420.75 ± 35.16, NS 548.33 ± 21.87, NS
6 months 306.25 ± 37.27 353.50 ± 26.51, NS 245.75 ± 31.11, NS
12 months 285.00 ± 25.66 409.25 ± 39.53, NS 424.33 ± 55.26, NS
Open in a new tab

When we analyzed axonal area from three weeks to twelve months in Nefl+/E397K and NeflE397K/E397K mice there was a distribution towards more smaller axon calibers with NeflE397K/E397K demonstrating more smaller caliber axons than Nefl+/E397K mice (Supplementary Fig. 3). These results are consistent with the electrophysiology studies and axonal pathology.

Neuromuscular junction denervation was present as disease progressed in Nefl mutant mice

To investigate whether neuromuscular junction (NMJ) innervation status was altered in Nefl mutant mice, biceps brachii, triceps brachii, gastrocnemius, and tibialis anterior (TA) muscles were analyzed at three weeks, twelve weeks, and twelve months (Fig. 4). At three weeks, there were no significant differences between wild type and Nefl mutant mice in any of the muscles examined; however, at twelve weeks the percentage of fully innervated endplates decreased, and partially and fully denervated endplates increased with differences observed between the muscles (Fig. 4B). At twelve weeks, the most significant differences were observed in the TA muscle. TA fully innervated endplates in Nefl+/E397K mice were 88% with 12% partially innervated endplates. NeflE397K/E397K mice had 73% fully innervated endplates (P = 0.0039) with 9% partially innervated and 18% fully denervated endplates in the TA muscle (Fig. 4B). The differences in innervation status between wild type and Nefl mutants became more apparent at twelve months across all muscles with the greatest differences observed in the TA muscle. TA fully innervated endplates in Nefl+/E397K mice were 70% (P = 0.0448) with 24% partially innervated endplates and 6% fully denervated endplates. NeflE397K/E397K mice had 56% fully innervated endplates (P = 0.0013) with 32% partially innervated (P = 0.0239) and 12% fully denervated endplates in the TA muscle (Fig. 4C and D).

Figure 4.

Figure 4

Open in a new tab

Neuromuscular junction denervation in Nefl mutant mice. The neuromuscular junction innervation status of wild type, Nefl+/E397K, and NeflE397K/E397K mice was analyzed at three weeks, twelve weeks, and twelve months of age in the biceps brachii, triceps brachii, gastrocnemius and tibialis anterior (TA) muscles. End plates with complete overlap with the terminal were considered fully innervated, end plates with partial overlap were considered partially innervated, and end plates with missing overlapping terminal were considered denervated. (A) Three-week evaluation. (B) Twelve-week evaluation. Biceps brachii fully innervated endplates between wild type (100%) and NeflE397K/E397K mice (78%, P = 0.0167). Biceps brachii fully innervated endplates between Nefl+/E397K and NeflE397K/E397K mice (P = 0.0227). Biceps brachii NeflE397K/397K partially innervated endplates 4%, fully denervated endplates 18%. TA fully innervated endplates between wild type (99%) and NeflE397K/E397K mice (73%, P = 0.0039). TA NeflE397K/E397K partially innervated endplates 9%, fully denervated endplates 18%. (C) Twelve months evaluation. Biceps brachii fully innervated endplates between wild type (96%) and Nefl+/E397K mice (66%, P = 0.0155). Biceps brachii Nefl+/E397K partially innervated endplates 23%, fully denervated endplates 11%. Triceps brachii fully innervated endplates between wild type (100%) and Nefl+/E397K mice (73%, P = 0.0138). Triceps brachii Nefl+/E397K partially innervated endplates 21%, fully denervated endplates 6%. Gastrocnemius fully innervated endplates between wild type (99%) and Nefl+/E397K mice (60%, P = 0.0094). Gastrocnemius Nefl+/E397K partially innervated endplates 12%, fully denervated endplates 28%. TA fully innervated endplates between wild type (100%) and Nefl+/E397K mice (70%, P = 0.0448). TA Nefl+/E397K partially innervated endplates 24%, fully denervated endplates 6%. TA fully innervated endplates between wild type (100%) and NeflE397K/E397K mice (56%, P = 0.0013). TA NeflE397K/E397K partially innervated endplates (32%, P = 0.0239), fully denervated endplates 12%. (D) Representative images for TA muscle at three weeks and twelve months. Anti-neurofilament heavy chain labelled the axon (green) and anti-synaptic vesicle 2 (SV2) (green) labelled the synaptic terminal. acetylcholine receptors were labeled with Alexa Fluor 594-conjugated α-Bungarotoxin (magenta). Four to seven animals were analyzed per muscle. Two-way ANOVA with Tukey’s multiple comparisons test determined statistical significance.

Total axon number per field and total NMJ numbers per field were also examined in the gastrocnemius muscle, where electrophysiology measures were recorded. In wild type mice, the total number of axons per field decreased as the axons grew in area at P84 (436.0, NS), P180 (306.3, P = 0.0020) and P360 (285.0, P = 0019) compared to P21 (528.6) (Fig. 5A-D, Table 1). Additionally, total axons numbers per field was significantly increased in Nefl+/E397K (744.6, P = 0.0232) and NeflE397K/E397K (731.4, P = 0.0321) compared to wild type mice (528.6) at P21, but not significant at later timepoints (Fig. 5A-D, Table 1), potentially due to a developmental delay in the mutant mice. From P21 through P360 there was a consistent decrease in total axons/field in both Nefl mutants but did not show significant differences between genotypes. Nefl+/E397K presented a significant decrease in the total number of axons/field at P84 (420.8, P < 0.0001), P180 (353.5, P < 0.0001), and P360 (409.3, P < 0.0001) compared to P21(744.6). Similarly, NeflE397K/E397K presented a significant decrease in total number of axons/field at P84 (548.3, P = 0.0260), P180 (245.8, P < 0.0001), and P360 (424.3, P < 0.0001) compared to P21 (731.4). However, starting at P84 there was an increase in total number of NMJ/field consistent with wild type mice while there were no significant changes between NeflE397K animals and wild type controls (Fig. 5A-D, Table 1). At P360, NeflE397K/E397K axon area was 69% smaller and Nefl+/E397K axon area was 53% smaller than wild type with 33% and 30% more axons/field, respectively. At P360, the average total number of NMJ/field was 47 for wild type mice, 46 for Nefl+/E397K mice, and 40 for NeflE397K/E397K mice, which did not show significant differences, but the innervation status was significantly changed (Fig. 4).

Figure 5.

Figure 5

Open in a new tab

Nefl mutants with comparison of axon numbers and NMJs. The total number of axons per 63X field (a, B) and the total neuromuscular junctions (NMJs) per 20X field (C, D) were quantified and compared. wild type, Nefl+/E397K, and NeflE397K/E397K mice were analyzed at three weeks, twelve weeks, six months, and twelve months of age. Axons of the sciatic nerve and NMJs associated with the gastrocnemius muscle were quantified. wild type (P360 = 285 axons, 47 = NMJ), Nefl+/E397K (P360 = 409 axons, 46 = NMJ), and NeflE397K/E397K (P360 = 424 axons, 40 = NMJ) mice. A mixed-effect analysis with Tukey’s multiple comparison test was used to determine significance. P = postnatal day, n = number of animals evaluated.

Discussion

Here we report two Nefl-E397K mouse models that present with early electrophysiology differences and axon pathology that persisted throughout the lifespan of the mice. Additionally, in the characterization of Nefl+/E397K or NeflE397K/E397K mice we found that NeflE397K/E397K mice demonstrate disease pathology earlier than Nefl+/E397K mice and in most instances disease pathology was more severe. Consistent with CMT2E patients, there was not a reduction in lifespan for Nefl+/E397K or NeflE397K/E397K mice; however, weight for Nefl+/E397K mice trended upward while weight for NeflE397K/E397K mice trended downward. These differences might be reflected by the mobility of the mice, any associated neuropathic pain and disease severity.

Electrophysiology measurements recorded with individual cohorts or within the longitudinal study were consistent demonstrated significant differences as early as P21, revealing an early, quantifiable phenotype. Distal latency was significantly prolonged throughout the 360 days while CMAP amplitude was consistently lower in the Nefl mutants. At three weeks, electrophysiology measurements (distal latency, CMAP amplitude and negative area) demonstrated significant differences from wild type cohorts. A possible interpretation of the prolonged distal latency includes reduction of action potential propagation rates along motor axons due to reduced axonal size as previously shown in other Nefl models, though some contribution of NMJ transmission cannot be excluded. Furthermore, reduction of CMAP amplitude and area could reflect muscle fiber denervation causing loss of muscle fiber excitation and/or reduced muscle fiber size [23, 26]. The distal latency was consistent with the significant decrease in axon area and diameter observed in Nefl+/E397K and NeflE397K/E397K mice. At three weeks, there was no NMJ denervation present in the forelimb nor hindlimb muscles examined in Nefl mutants. In our companion study, significantly reduced muscle fiber area in Nefl mutants further supports the electrophysiology findings.

Interestingly, from three to twelve weeks distal latency was further prolonged in Nefl mutant mice with NeflE397K/E397K more severe than Nefl+/E397K mice. There was some improvement in CMAP amplitude and negative area at twelve weeks; however, both remained statistically different from the wild type cohort. Nefl mutant axonal growth continued, but axon area remained significantly smaller than wild type axons contributing to the prolonged distal latency. For NeflE397K/E397K mice from three weeks to twelve weeks, there was a three-fold increase in axon area; however, axons were 39% the size of wild type axons. Nefl+/E397K mice presented with more, larger axons than NeflE397K/E397K mice. Overall, NMJ innervation was largely preserved in Nefl+/E397K mice with increased partial and full denervated endplates observed in NeflE397K/E397K mice. The increased axon caliber, ‘maintenance’ of NMJ innervation and potential for sprouting likely stabilized CMAP and negative area in the Nefl mutants.

From twelve weeks to six months, axon degeneration persisted in the Nefl mutants, most notably in NeflE397K/E397K mice. Nefl+/E397K demonstrated a 13% reduction in axon caliber with a 16% reduction in the number of axons per field (smaller axons and fewer axons counted). NeflE397K/E397K mice demonstrated a 31% reduction in axon caliber with a 55% reduction in the number of axons (much smaller axons and significantly fewer axons counted). Additionally, there was an increase in the absence of axons within the fields scored at six months, indicating axon loss. NeflE397K/E397K mice had 70% smaller axon area than wild type mice at six months and a 20% reduction in the number of axons. Notably, Nefl mutant mice increased total NMJs consistent with wild type mice suggesting compensatory mechanisms such as sprouting were occurring. Together, these results support the electrophysiology: distal latency was prolonged due to the small axons. CMAP and negative area were largely preserved due to compensatory mechanisms that maintained NMJ innervation and facilitated sprouting as well as muscle fiber hypertrophy in Nefl mutant mice (companion manuscript).

From six months to twelve months, axon caliber slightly increased in Nefl mutant mice; however, wild type mice demonstrated a decrease in the number of axons/field (consistent with increased caliber) while Nefl mutants demonstrated increased axon number (Nefl+/E397K 13%, NeflE397K/E397K 42%) suggesting regeneration was occurring. More, smaller axons were present at twelve months in comparison to six months in Nefl mutants. The increased but smaller axons resulted in significantly prolonged distal latency. While there was not a significant difference in P–P CMAP amplitude and negative area, Nefl mutants consistently had lower measurements than their wild type cohort. The maintenance of NMJ numbers could serve as a compensatory mechanism for the changes in NMJ innervation status.

Materials and methods

Animals

All experimental procedures were approved by the University of Missouri Animal Care and Use committee and were performed according to the guidelines set forth in the Guide for the Use and Care of Laboratory Animals. Experimental cohorts were composed of equal number of male and female mice and separate analysis showed that there was no sex-difference in parameters excluding weight.

CRISPR/Cas9, Nefl-E397K sgRNA and repair template

Nefl mice were generated on a C57BL/6 J background using CRISPR technology at the University of Missouri Animal Modeling Core. An enhanced-specificity Cas9 (eSPCas9) protein was used to reduce off-target effects. Any predicted off-target site with less than a 2 bp mismatch (including DNA or RNA bulges) or with less than 3 bp mismatches if no mismatches are in the 12 bp seed region of the sgRNA was PCR amplified and sequenced to ensure no erroneous edits were made. The sgRNA was ordered as chemically modified synthetic sgRNA (Synthego). The repair template was chemically synthesized as a 199 bp single stranded DNA oligo (ssODN) (IDT). The ssODN was complementary to the non-target strand and contained symmetrical homology arms.

sgRNA sequence: 5′- TCTTGGAAGGCGAAGAGACC-3′. Repair template sequence (sgRNA sequence disrupted by the desired mutation) 5′- GAGGAAAGTAATGAATGTGGGCTTAGAGCAATGAACACATCCAGCCTTGCTCTAACTGTACTCTTCATTCCCTCTCCACCAGAAAACTCTTGGAAGGCAAAGAGACCAGACTCAGTTTCACCAGCGTGGGTAGCATAACCAGCGGCTACTCTCAGAGCTCGCAGGTCTTCGGCCGTTCTGCTTACAGTGGCTTGCAGAGC -3′. The boxed area represents the sgRNA target sequence, and the bold underlined letter indicates the mutation engineered in the DNA repair template.

Zygote electroporation and embryo transfer

A mix containing a final concentration of 3.0 μM sgRNA, 2.0 μM Cas9 protein (Sigma) and 1.6 μM ssODN was made immediately prior to electroporation. CRISPR sgRNA/Cas9 RNP complexes were formed with incubation at room temperature for 10 min followed by the addition of the ssODN repair template. Zygotes were electroporated (NepaGene21) using a 1.5 mm gap glass slide electrode under the following conditions: Poring pulse: 40 V, 3.5 ms length, 50 ms interval, 10% decay rate, positive polarity (x4 pulses) Transfer pulse: 5 V, 50 ms length, 50 ms interval, 40% decay rate, alternating polarity (x5 pulses). Electroporated zygotes were transferred to pseudo pregnant surrogate females.

Genotyping

Genotyping of neonatal pups was performed at postnatal day (P) 0. Genomic DNA isolation was performed using a protocol from Jacksons labs. C57BL/6 J-NeflE397K mice were genotyped using a high-resolution melt analysis (EvaGreen qPCR precision melt supermix, Bio-Rad) and the primers 5’-CTTCATTCCCTCTCCACCAG-3′ and 5’-CACGCTGGTGAAACTGAG-3′. PCR conditions were 95 °C denaturing for 2:00 min (m) followed by 39 cycles of 95 °C denaturing for 10 seconds (s), 60 °C annealing for 30s and 72 °C extension for 30s, 95 °C for 30s, 60 °C for 1:00 m, and melt curve 65 °C to 95 °C in increments of 0.2 every 10s. Melting temperature for the wild type, Nefl+/E397K, and NeflE397K/E397K were 78.5 Inline graphic0.03 °C, 77.7 Inline graphic0.03 °C, and 77.2 Inline graphic0.06 °C, respectively.

Western blot

For western blotting, tissues were homogenized in ice-cold phosphate-buffered saline (PBS) containing 8 M urea and centrifuged in a tabletop microcentrifuge as previously reported [16]. Concentrations were determined using the Coomassie Protein Assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Fifty microgram of sciatic nerve protein were separated by 10% SDS page and transfer into a 0.45 μm PDVF membrane. Membranes were blocked with SuperBlock Blocking buffer in PBS (catalog no. 37515, Thermo Fischer Scientific, Scientific, Waltham, MA, USA) for 1 h. After blocking membranes were incubated with primary antibodies in 1:1 ratio of SuperBlock Blocking buffer:TBST overnight at 4 °C. After washing TBST membranes were incubated with secondary antibodies for 1.5 h, washed with TBST, immunoreactive proteins were visualized with SuperSignal West Femto Maximum Sensitivity Substrate (catalog no. 34095, Thermo Fischer Scientific, Scientific, Waltham, MA, USA), and visualize in the iBright FL1500 (Thermo Fischer Scientific, Scientific, Waltham, MA, USA). Intensities of blots were measured in arbitrary units in Fiji (ImageJ). NF-L protein levels were calculated as a ratio between NF-L signal and loading control (GAPDH). Sciatic nerve protein samples were collected from different sets of animals and run on gels in triplicate. Significance was calculated using ordinary one-way ANOVA with Dunnett’s multiple comparison test. NEFL monoclonal antibody clone DA2 was used in a 1:100 dilution (catalog no. 13–0400, Thermo Fischer Scientific, Scientific, Waltham, MA, USA). GAPDH loading control monoclonal antibody clone GA1R, HRP conjugated was used in 1:1000 dilution (catalog no. MA5–15738-HRP, Thermo Fischer Scientific, Scientific, Waltham, MA, USA). NF-L secondary antibody was Goat anti-Mouse IgG (H + L) Secondary Antibody, HRP (catalog no. 31430, Thermo Fischer Scientific, Scientific, Waltham, MA, USA).

Electrophysiology studies

Measurements of the right rear leg, including the gastrocnemius and tibialis anterior muscle, were recorded following stimulation of the sciatic nerve as previously described [27]. Briefly, mice were anesthetized with isoflurane (2–5% for induction and 2–3% for maintenance) and placed on a warming mat set at 37 °C. The right hindlimb was shaved and an active ring electrode was placed over the shaved region of the leg while a reference ring electrode was placed over the metatarsals of the right hind paw (Alpine Biomed, Skovlunde, Denmark). Spectra 360 electrode gel was applied to decrease impedance (Parker Laboratories, Fairfield, NJ). A common reference electrode was placed around the tail. Two 28-gauge monopolar needle electrodes (Teca, Oxford Instruments Medical, New York, NY) were placed on each side of the sciatic nerve in the region of the proximal thigh. A portable electrodiagnostic system (Cadwell Sierra Summit, Kennewick, WA) was used to stimulate the sciatic nerve (0.1 ms pulse, 1–10 mA intensity) and distal latency, compound muscle action potential amplitude, and negative area were recorded.

Sciatic nerve dissection and processing

Sciatic nerves were fixed with 8% glutaraldehyde in phosphate buffer and processed for resin (Poly/Bed® 812; #21844–1; Polysciences Inc.) embedding as previously described [17, 28]. After fixation, nerves were incubated in 2% osmium tetroxide in phosphate buffer followed by rinses in ascending ethanol concentrations (50%, 70%, 80%, 95%, and 100%) and propylene oxide. Samples were then incubated in a 1:1 propylene oxide: resin mixture for 1 h, incubated in resin overnight, placed in a resin mold, and cured at 60 °C for 8 h. Semi-thin sections of 1 μm were stained with alkaline toluidine blue, cover-slipped with Permount mounting medium (ThermoFisher Scientific), and visualized by light microscopy (Leica DM5500 B, Leica Microsystems Inc.). Image quantification was performed in a blind manner using the semi-automated MyelTracer software [29]. Axon area, perimeter, diameter, and G-ratios were recorded.

Neuromuscular junction (NMJ) immunohistochemistry

Mice were perfused with 4% PFA. NMJ immunohistochemistry whole mount preparations were stained and analyzed as previously described [30]. Muscles were incubated with primary antibodies anti-Neurofilament Heavy Chain (NF-H) (1:2000; AB5539, Chemicon, EMD Millipore) and anti-Synaptic Vesicle 2 (SV2) (1:200; YE269, Life Technologies) followed by Donkey anti-Chicken Alexa Fluor 488 (1:400; Jackson ImmunoResearch) and Goat anti-Rabbit Alexa Fluor 488 (1:200; Jackson ImmunoResearch) secondary antibodies to label the axon and synaptic terminal. Acetylcholine receptors were labeled with Alexa Fluor 594-conjugated α-Bungarotoxin (1:200; Life Technologies). NMJ analyses were performed blind on three randomly selected fields at 20X magnification (Leica DM5500 B, Leica Microsystems Inc.). Analyses were based on the overlap of the end plate and synaptic terminal. End plates with complete overlap with the terminal were considered fully innervated, end plates with partial overlap were considered partially innervated, and end plates with missing overlapping terminal were considered denervated using Fiji software (NIH). Representative images were obtained using a laser scanning confocal microscope at 40x magnification (Leica TCS SP8, Leica Microsystems Inc.).

Statistical analyses

All experiments were conducted with at least three biological replicates to ensure the reproducibility of the data. One-way ANOVA accompanied by Tukey’s multiple comparison test was utilized to assess significance of weight. Statistical significance was evaluated using ordinary one-way ANOVA and Dunnett’s multiple comparison test for western blot, electrophysiology assessments, and axonal pathology measurements. For longitudinal electrophysiology assessments, a mixed-effects analysis with Dunnett’s multiple comparison test and one-way ANOVA with Tukey’s multiple comparison test were employed to determine significance. Two-way ANOVA with Tukey’s multiple comparisons test assessed the statistical significance of neuromuscular junction innervation status. Statistical analyses for each experimental protocol are noted within the figure legends.

Conflict of interest statement: Ownership: CLL is co-founder and chief scientific officer of Shift Pharmaceuticals. MAL is associated with Shift by family relation. Income: CLL has received more than $10 000 in income per annum from Shift Pharmaceuticals. Research support: Research in the CLL and MAL labs have been supported by sub-awards from Shift Pharmaceuticals (as part of grants from the DOD, CMT Research Foundation, and the NIH). WDA is a member of the Charcot-Marie-Tooth Research Foundation scientific advisory board and has received funding and consultant fees from NMD Pharma.

Supplementary Material

Supplementary_Data_ddaf116
supplementary_data_ddaf116.zip (4.6MB, zip)

Contributor Information

Dennis O Pérez-López, Department of Veterinary Pathobiology, University of Missouri, 201 Connaway Hall, 1500 Bouchelle Ave, Columbia, MO 65201; Bond Life Sciences Center, University of Missouri, 1201 Rollins St, Columbia, MO 65211.

Audrey A Shively, Department of Veterinary Pathobiology, University of Missouri, 201 Connaway Hall, 1500 Bouchelle Ave, Columbia, MO 65201.

F Javier Llorente Torres, Department of Veterinary Pathobiology, University of Missouri, 201 Connaway Hall, 1500 Bouchelle Ave, Columbia, MO 65201; Bond Life Sciences Center, University of Missouri, 1201 Rollins St, Columbia, MO 65211.

Mohammed T Abu-Salah, Department of Veterinary Pathobiology, University of Missouri, 201 Connaway Hall, 1500 Bouchelle Ave, Columbia, MO 65201.

Michael L Garcia, Department of Biological Sciences, University of Missouri, Tucker Hall, 105, 612 Hitt St, Columbia, MO 65201.

W David Arnold, Department of Physical Medicine and Rehabilitation, University of Missouri, 1 Hospital Drive DC046.00, Columbia, MO 65212; NextGen Precision Health, University of Missouri, 1030 Hitt St, Columbia, MO 65211.

Monique A Lorson, Department of Veterinary Pathobiology, University of Missouri, 201 Connaway Hall, 1500 Bouchelle Ave, Columbia, MO 65201; Bond Life Sciences Center, University of Missouri, 1201 Rollins St, Columbia, MO 65211.

Christian Lorson, Department of Veterinary Pathobiology, University of Missouri, 201 Connaway Hall, 1500 Bouchelle Ave, Columbia, MO 65201; Bond Life Sciences Center, University of Missouri, 1201 Rollins St, Columbia, MO 65211.

Funding

We acknowledge the MU Animal Modeling Core, MU Genomics Technology Core, and MU Advanced Light Microscopy Core for assistance with these studies. This work was supported by the Charcot–Marie-Tooth Research Foundation (grant 00070082). DPL was supported by the MU Life Sciences Fellowship, National Institutes of Health Training grant T32 GM008396 and a Southeastern Conference (SEC) Scholar fellowship. MTA was funded by the IMSD/MARC program National Institutes of Health Training grant T34 GM136493. AAS was funded by the MU Cherng Summer Scholars program.

References

  • 1. Mersiyanova  IV, Perepelov  AV, Polyakov  AV. et al.  A new variant of Charcot-Marie-tooth disease type 2 is probably the result of a mutation in the neurofilament-light gene. Am J Hum Genet  2000;67:37–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Della Marina  A, Hentschel  A, Czech  A. et al.  Novel genetic and biochemical insights into the Spectrum of NEFL-associated phenotypes. J Neuromuscul Dis  2024;11:625–645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Stone  EJ, Kolb  SJ, Brown  A. A review and analysis of the clinical literature on Charcot-Marie-tooth disease caused by mutations in neurofilament protein L. Cytoskeleton (Hoboken)  2021;78:97–110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. De Jonghe  P, Mersivanova  I, Nelis  E. et al.  Further evidence that neurofilament light chain gene mutations can cause Charcot-Marie-tooth disease type 2E. Ann Neurol  2001;49:245–249. [DOI] [PubMed] [Google Scholar]
  • 5. Jordanova  A, De Jonghe  P, Boerkoel  CF. et al.  Mutations in the neurofilament light chain gene (NEFL) cause early onset severe Charcot-Marie-tooth disease. Brain  2003;126:590–597. [DOI] [PubMed] [Google Scholar]
  • 6. Elbracht  M, Senderek  J, Schara  U. et al.  Clinical and morphological variability of the E396K mutation in the neurofilament light chain gene in patients with Charcot-Marie- tooth disease type 2E. Clin Neuropathol  2014;33:335–343. [DOI] [PubMed] [Google Scholar]
  • 7. Herrmann  H, Aebi  U. Intermediate filaments: structure and assembly. Cold Spring Harb Perspect Biol  2016;8:8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Herrmann  H, Strelkov  SV, Burkhard  P. et al.  Intermediate filaments: primary determinants of cell architecture and plasticity. J Clin Invest  2009;119:1772–1783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Eriksson  JE, Dechat  T, Grin  B. et al.  Introducing intermediate filaments: from discovery to disease. J Clin Invest  2009;119:1763–1771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Liem  RK, Messing  A. Dysfunctions of neuronal and glial intermediate filaments in disease. J Clin Invest  2009;119:1814–1824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kotaich  F, Caillol  D, Bomont  P. Neurofilaments in health and Charcot-Marie-tooth disease. Front Cell Dev Biol  2023;11:1275155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Pisciotta  C, Bai  Y, Brennan  KM. et al.  Reduced neurofilament expression in cutaneous nerve fibers of patients with CMT2E. Neurology  2015;85:228–234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Brownlees  J, Ackerley  S, Grierson  AJ. et al.  Charcot-Marie-tooth disease neurofilament mutations disrupt neurofilament assembly and axonal transport. Hum Mol Genet  2002;11:2837–2844. [DOI] [PubMed] [Google Scholar]
  • 14. Lee  MK, Marszalek  JR, Cleveland  DW. A mutant neurofilament subunit causes massive, selective motor neuron death: implications for the pathogenesis of human motor neuron disease. Neuron  1994;13:975–988. [DOI] [PubMed] [Google Scholar]
  • 15. Perez-Olle  R, Leung  CL, Liem  RK. Effects of Charcot-Marie-tooth-linked mutations of the neurofilament light subunit on intermediate filament formation. J Cell Sci  2002;115:4937–4946. [DOI] [PubMed] [Google Scholar]
  • 16. Adebola  AA, Di Castri  T, He  CZ. et al.  Neurofilament light polypeptide gene N98S mutation in mice leads to neurofilament network abnormalities and a Charcot-Marie-tooth type 2E phenotype. Hum Mol Genet  2015;24:2163–2174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Lancaster  E, Li  J, Hanania  T. et al.  Myelinated axons fail to develop properly in a genetically authentic mouse model of Charcot-Marie-tooth disease type 2E. Exp Neurol  2018;308:13–25. [DOI] [PubMed] [Google Scholar]
  • 18. Shen  H, Barry  DM, Dale  JM. et al.  Muscle pathology without severe nerve pathology in a new mouse model of Charcot-Marie-tooth disease type 2E. Hum Mol Genet  2011;20:2535–2548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Dale  JM, Villalon  E, Shannon  SG. et al.  Expressing hNF-LE397K results in abnormal gaiting in a transgenic model of CMT2E. Genes Brain Behav  2012;11:360–365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Dequen  F, Filali  M, Lariviere  RC. et al.  Reversal of neuropathy phenotypes in conditional mouse model of Charcot-Marie-tooth disease type 2E. Hum Mol Genet  2010;19:2616–2629. [DOI] [PubMed] [Google Scholar]
  • 21. Filali  M, Dequen  F, Lalonde  R. et al.  Sensorimotor and cognitive function of a NEFL(P22S) mutant model of Charcot-Marie-tooth disease type 2E. Behav Brain Res  2011;219:175–180. [DOI] [PubMed] [Google Scholar]
  • 22. Zhao  J, Brown  K, Liem  RKH. Abnormal neurofilament inclusions and segregations in dorsal root ganglia of a Charcot-Marie-tooth type 2E mouse model. PLoS One  2017;12:e0180038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Wilbourn  AJ. Nerve conduction studies. Types, components, abnormalities, and value in localization. Neurol Clin  2002;20:305–338  v. [DOI] [PubMed] [Google Scholar]
  • 24. Miltenberger-Miltenyi  G, Janecke  AR, Wanschitz  JV. et al.  Clinical and electrophysiological features in Charcot-Marie-tooth disease with mutations in the NEFL gene. Arch Neurol  2007;64:966–970. [DOI] [PubMed] [Google Scholar]
  • 25. Bienfait  HM, Verhamme  C, van  Schaik  IN. et al.  Comparison of CMT1A and CMT2: similarities and differences. J Neurol  2006;253:1572–1580. [DOI] [PubMed] [Google Scholar]
  • 26. Mallik  A, Weir  AI. Nerve conduction studies: essentials and pitfalls in practice. J Neurol Neurosurg Psychiatry  2005;76:ii23-31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Arnold  WD, Sheth  KA, Wier  CG. et al.  Electrophysiological motor unit number estimation (MUNE) measuring compound muscle action potential (CMAP) in mouse Hindlimb muscles. 2015;J. Vis. Exp.:52899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Rich  KA, Pino  MG, Yalvac  ME. et al.  Impaired motor unit recovery and maintenance in a knock-in mouse model of ALS-associated Kif5a variant. Neurobiol Dis  2023;182:106148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kaiser  T, Allen  HM, Kwon  O. et al.  MyelTracer: a semi-automated software for myelin g-ratio quantification. eNeuro.  2021;8:ENEURO.0558–ENEU20.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Smith  CE, Lorson  MA, Ricardez Hernandez  SM. et al.  The Ighmbp2D564N mouse model is the first SMARD1 model to demonstrate respiratory defects. Hum Mol Genet  2022;31:1293–1307. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary_Data_ddaf116
supplementary_data_ddaf116.zip (4.6MB, zip)

Articles from Human Molecular Genetics are provided here courtesy of Oxford University Press

RESOURCES