Effects of circadian rhythms on antimicrobial peptide concentrations in lactating goat milk

Abstract

Background

Immune system is regulated by circadian rhythms, which promote inflammation and facilitate pathogen elimination. Antimicrobial peptides secreted by milk somatic cells and mammary gland epithelial cells play a crucial role in protecting the mammary gland from pathogenic invasion and mastitis. In this study, we aimed to investigate the circadian rhythms of clock gene and antimicrobial peptide gene expression in goat milk somatic cells, as well as the circadian variation in antimicrobial peptide concentrations in milk.

Results

Milk and blood samples were collected from eight goats every 4 h for three days, with light exposure from 6:30 to 19:00. Notably, plasma prolactin level, milk Na⁺ concentration, and somatic cell count exhibited circadian rhythms (cosinor: P < 0.05; time: P < 0.01). Expression levels of some clock genes (Clock, cryptochrome circadian regulator 2, period circadian regulator 2, and nuclear receptor subfamily 1 group D member 1) exhibited circadian rhythms (cosinor: P < 0.05), whereas those of other clock genes, such as basic helix-loop-helix ARNT-like 1, period circadian regulator 1, cryptochrome circadian regulator 1, and retinoic acid receptor-related orphan receptor-α, did not exhibit circadian rhythms. Among the milk antimicrobial peptides, gene expression level of cathelicidin-7 (cosinor and time: P < 0.05), but not that of lactoferrin (cosinor: P = 0.079), exhibited a circadian rhythm in somatic cells. Additionally, goat β-defensin-1, cathelicidin-7, and lactoferrin levels exhibited circadian rhythms in milk (cosinor and time: P < 0.01).

Conclusions

Overall, our results suggest that leukocyte migration and antimicrobial peptide production exhibit circadian rhythms in the mammary glands. These findings provide valuable insights to ensure safe milking conditions by milking during periods of high immune activity in the mammary glands.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-026-05444-5.

Background

Mammalian brain receives photic information from the eyes and transmits it to the suprachiasmatic nucleus, the central circadian clock of the body [1]. Circulating hormones, along with the autonomic nervous system [2, 3] and feeding–fasting cycles [4, 5], are regulated by the central circadian clock and serve as entrainment cues for peripheral tissues. These entrainment cues activate the molecular clock system, involving core clock genes such as the period circadian regulator (PER), cryptochrome circadian regulator (CRY), CLOCK, basic helix-loop-helix ARNT like 1 (BMAL1), retinoic acid receptor-related orphan receptor-α (RORα), and nuclear receptor subfamily 1 group D member 1 (NR1D1), in peripheral tissue cells [1].

Intracellular molecular clocks participate in various immune activities, such as cytokine and antimicrobial peptide (AMP) production [6–9], immune cell migration [10], and antigen processing by dendritic cells [11]. Circadian rhythms of the immune system already contribute to the development of novel therapeutic strategies for human diseases—such as optimizing the timing of immune checkpoint antibody therapy in cancer treatment [12], and improving the timing of vaccine administration [13]. However, research on circadian rhythms, particularly those related to mammary gland immune functions, in lactating animals remains limited. Harnessing the circadian rhythms of the immune system may enhance the treatment of diseases such as mastitis in lactating animals.

Mammary glands, the primary milk-producing organs, are highly susceptible to pathogen invasion, which leads to mastitis in dairy animals, resulting in significant economic losses to the dairy industry [14]. Somatic cells (leukocytes migrating from the blood), along with AMPs, such as lactoferrin, S100 family proteins, cathelicidins, and β-defensins secreted by both somatic cells and mammary gland epithelial cells (MECs), play crucial roles in the innate immune functions of mammary glands and serve as the first line of defense against pathogen invasion [15, 16]. Lactoferrin is mainly secreted by the mammary epithelium and leukocytes, and its milk concentration increases during udder infections [15, 17, 18]. It exhibits direct bactericidal activity against several bacteria, including Escherichia coli, Vibrio cholerae, Streptococcus mutans, Streptococcus pnelimoniae, and Legionella pneumophila [19]. It also destabilizes the bacterial membrane, allowing antibacterial substances to penetrate the bacteria [20]. S100 family proteins, the calcium-binding proteins secreted by the mammary gland tissues and leukocytes, exhibit antimicrobial activity against E. coli in the mammary glands [21, 22]. The S100 family also affects immune cell functions, regulating both the innate and adaptive immune functions [23]. S100 family protein levels increase during inflammation in the mammary glands [22, 24]. These characteristics of the S100 family proteins highlight their important roles in the mammary gland defense responses during infection. Cathelicidins are an AMP family found in neutrophils and the epithelium [15]. They exhibit direct antimicrobial activity against various bacteria [25]. Cathelicidin levels are upregulated in both bovine and goat mastitic milk, and cathelicidins exhibit direct antimicrobial activity against various mastitic bacteria, including E. coli, Klebsiella pneumonia, Staphylococcus epidermidis, Prototheca spp. [26, 27]. β-Defensin is an AMP mainly expressed in the epithelium [28]. β-Defensin is expressed in the goat mammary glands and secreted into milk; it inhibits E. coli growth [29–31]. Modification of milking processes to increase the AMP levels in mammary glands is a novel strategy to reduce the use of antibiotics and prevent and treat mastitis, ultimately mitigating bacterial resistance [32–34]. We previously reported that milk AMP levels vary depending on the milking time, with S100A7 levels being higher during milking at 6:00 than at 9:00, and β-defensin levels being higher during milking at 12:00 than at 9:00 [32]. However, the specific circadian rhythms of AMP levels in milk remain ambiguous.

Therefore, this study elucidated the circadian rhythms of leukocyte migration (as indicated by somatic cell count), AMP gene expression in milk somatic cells, and AMP concentration in milk. Additionally, to better interpret the circadian changes in leukocyte migration and AMP production, we also analyzed the expression of intracellular molecular clock genes in milk somatic cells, as well as the concentrations of key hormones and cytokines in blood—specifically prolactin, insulin, and IL-8—which are strong candidates for the regulation of AMP production and leukocyte migration in the mammary gland.

Methods

Animals and experimental design

Eight Tokara goats (15 udders, one is nonfunctional) in the mid-lactation phase (body weight, 20–40 kg; parity, 1–4; milk yield, 30–300 mL/d) were used in this study. The goats were owned and individually housed in the experimental farm of Hiroshima University and provided 0.6 kg of hay cubes and 0.2 kg of barley per day, with free access to water and a trace mineral salt block. Diets were provided twice daily at 9:00 and 15:00, and the light period lasted from 6:30 to 19:00 h. Only udders with low somatic cell counts (SCCs < 5,000 × 10³ cells/mL) in milk were included in the experiments. All experiments were approved by the Hiroshima University Animal Research Committee and adhered to its guidelines (C19-4). We also conducted this investigation in accordance with the ARRIVE standards and regulations (https://arriveguidelines.org).

Goats were milked every 4 h for three days. Day 1 of the experiment was used for adaptation. Milk and blood samples were collected on days 2 and 3 and used for subsequent experiments.

Sample collection and SCC and Na⁺ concentration measurement

Whole milk was collected via hand milking, and blood was collected from the goat jugular vein into heparinized tubes. Blood was centrifuged at 800 × g for 15 min at 4 °C. Whole milk was centrifuged at 2, 300 × g for 5 min at 4 °C, and milk fat and skim milk were separated from the somatic cell pellet [35]. The separated plasma and skim milk were stored at –25 °C until analysis, and the cell pellet in milk was resuspended in phosphate-buffered saline to measure SCC using a Countess Automated Cell Counter (Thermo Fisher Scientific, Waltham, MA, USA) [36]. The cell pellet form centrifuged milk was further collected and preserved at –80 °C for reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Milk Na⁺ concentration was measured using the LAQUAtwin-Na-11 pocket tester (HORIBA Advanced Techno, Co., Ltd., Kyoto, Japan) [37].

RT-qPCR

Total RNA was extracted from the somatic cell pellet using Sepasol RNA I Super (Cat. No. 09379–97; Nacalai Tesque, Inc., Kyoto, Japan) according to the manufacturer’s instructions. Tris–EDTA Buffer (10 mM Tris [pH 8.0] and 1 mM EDTA) was used to dissolve the extracted products. Total RNA concentration in each sample was measured using NanoDrop Lite (UV–Vis; Thermo Fisher Scientific). RNA was reverse-transcribed into cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (Cat. No. FSQ-301; Toyobo Co., Ltd., Osaka, Japan) on the T100 Thermal Cycler (Cat. No. #1,861,096; Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions. Real-time PCR was performed using the AriaMX real-time PCR system (Cat. No. G8830-64001; Agilent Technologies, Santa Clara, CA) with the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Cat. No. #600,883; Agilent Technologies). A 2-step protocol (heat denaturation and annealing) with 50 cycles was used for all genes. Heat denaturation was performed at 95 °C for 5 s. Annealing temperature was set at 59 or 60 °C, and time for amplification was set according to the primer product size (Table 1). Brilliant III enzyme elongates the products at a rate of 15–20 bp/s; in this experiment, annealing time was set at 10 s for PCR products < 200 bp and 30 s for PCR products > 200 bp. Clock and antimicrobial component gene levels were normalized to the ribosomal protein S18 (a housekeeping gene widely used for goats) levels and calculated using the 2^–∆∆Ct method as follows: ∆Ct = Ct (target gene) – Ct (housekeeping gene); ∆∆Ct = ∆Ct (target sample) – ∆Ct (control sample).

Table 1.

Primer sequences, accession numbers, and annealing temperatures used for reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Gene	Primer sequence	Accession No	Product size (bp)
Bmal1	F: AAGCTTCTGCACAATCCACA	XM_018059578.1	251
	R: AAATAGCTGTTGCCCTCTGGT
Clock	F: AGGGGTCACTGACTACGCAT	XM_018049466.1	148
	R: GTGTTTTTCTTTCACGGGAGC
Per1	F: CAGGATGTGGATGAGAGGGC	XM_018064610.1	182
	R: TTACGGGCACAGAAGCGAAT
Per2	F: TTCCAGGACGTGGACCAA	XM_018040197.1	142
	R: CCCCAGACTGCACGATCTTC
Cry1	F: CTGGTCTTGGCAGTGGGAAA	XM_013964057.2	104
	R: CAAAGCTCTCCTCCTTACCTAAT
Cry2	F: TGGGGACTACATCAGGCGATA	XM_018059193.1	126
	R: GGGTAGTCCACGCCAATGAT
Nr1d1	F: CCCTGGCTTCCGTGATCTTT	XM_018065020.1	104
	R: CCTTCACGTTGAACAGCGAC
Rorα	F: CGCAGCGATGAAAGCTCAAA	NM_001285652.1	148
	R: AGGACAGGAGTAGGTGGCAT
Lactoferrin	F: CGCAGTGTGGATGGCAAGGAG	NM_180998.2	215
	R: TTCAAGGCGGTCAAGTAACGG
Cathelicidin-2	F: ACTTCAAGGAGAATGGGCTGG	NM_001285577.1	150
	R: GATTGAATGGCGGACGGATTG
Cathelicidin-7	F: GAAGAGGTGGGCAGAAAATC	NM_001285620.1	111
	R: CAGAAGTCTGAGCCAGGATAAC
S100A10	F: ACGTACTAAGGCGCCCTGC	XM_018046106.1	132
	R: GGCGTGTTCCATTTGAGACG
RPS18	F: GTGTGGGACGAAGATACGCT	NM_001285639.1	101
	R: GATCACACGTTCCACCTCGT

Bmal1, basic helix-loop-helix ARNT-like 1 (also known as Arntl); Clock, clock circadian regulator; Per, period circadian regulator; Cry, cryptochrome circadian regulator; Nr1d1, nuclear receptor subfamily 1 group D member 1; Rorα, retinoic acid receptor-related orphan receptor alpha

Enzyme immunoassay

Enzyme immunoassay was performed to measure the cathelicidin-7, S100A7, lactoferrin, and goat β-defensin (GBD)−1 levels in skim milk [34, 35, 38, 39] and interleukin (IL)−8 levels in plasma [40]. Intra-assay coefficients of variation for cathelicidin-7, GBD-1, S100A7, lactoferrin, and IL-8 were 3.7, 6.8, 7.5, 6.5, and 4.7%, respectively, and their inter-assay coefficients of variation were 20, 17.7, 19.6, 9.3, and 12.0%, respectively.

Time-resolved fluoroimmunoassay

Plasma prolactin and insulin levels were measured via competitive time-resolved fluoroimmunoassay with the Multilabel Reader Nivo (PerkinElmer, Inc., Waltham, MA, USA), as previously described [32, 41, 42].

Statistical analyses

Milk yield, SCC, Na⁺ concentration, gene expression, and protein concentration measurement results were subjected to Anderson–Darling and Shapiro–Wilk normal distribution analyses using the JMP Pro 16 software (SAS Institute Inc., Cary, NC, USA). Results that did not fit a normal distribution were log-transformed (log₁₀) and assessed using a mixed model in the JMP software and the cosinor online tool (https://cosinor.online/app/cosinor.php) [43, 44]. The mixed model was fitted using restricted maximum likelihood (REML). Time was included as a fixed effect and modelled as a continuous variable. Goat identity was included as a random effect to account for repeated measurements within animals. No additional covariance structure for repeated measures was specified. Model assumptions were evaluated using residual diagnostics. The mixed model was used to detect the daily changes in data, and cosinor analysis was performed to determine whether the detected changes exhibited circadian rhythms. Additionally, the mixed model and cosinor analysis were directly used to assess the results showing a normal distribution. Except for the RT-qPCR results, other data are expressed as ratios relative to those at 2:00 after distribution analysis and log transformation (log₁₀). In addition, the results for determine the experimental period was analyzed by the Wilcoxon analysis of the one-way analysis of variance (Fig. 1A). Outliers were identified and removed for each endpoint using JMP Pro 16 software according to the detection procedures. The final results are expressed as the mean ± standard error of the mean. Statistical significance was set at P < 0.05.

Fig. 1.

Milk yield, Na⁺ concentration, and somatic cell count (SCC) (A: n = 7 udders derived from 4 goats) during the first milking of each day. *P < 0.05. Results of days 2 and 3 are consolidated into a 24-h period to show the changes in milk yield (B: n = 27 from 15 udders of 8 goats), Na⁺ concentration (C: n = 27 from 15 udders of 8 goats), and SCC (D: n = 27 from 15 udders of 8 goats) in one day. Samples collected at all time points per udder. Results are presented as relative values based on those observed at 2:00 as the mean ± standard error of the mean (SEM). Time (P < 0.05) indicates the significant differences within one day, and cosinor (P < 0.05) indicates the significant circadian rhythms

Results

Milk yield, Na⁺ concentration, and SCC

The first milk sample of each day was used to analyze the daily changes in milk yield, SCC, and Na⁺ concentration to determine the training period. Both milk SCC and Na⁺ concentration on days 2 and 3 were significantly lower than those on day 1 of milking (P < 0.05; Fig. 1A), with no significant changes observed between days 2 and 3. Therefore, days 2 and 3 were set as the experimental period, and the corresponding samples were used for analyses.

Milk yield did not show a significant circadian rhythm but was higher between 2:00 and 10:00 and lower between 14:00 and 22:00 (cosinor: P > 0.1; time: P > 0.1; Fig. 1B). Na⁺ concentration showed significant differences over one day (time: P < 0.01; Fig. 1C) and exhibited a circadian rhythm (cosinor: P < 0.01; Fig. 1C). Specifically, Na⁺ concentration increased from 2:00 to 10:00 and subsquently decreased from 14:00 to 22:00. SCC also showed significant differences over one day (time: P < 0.01; Fig. 1D) and exhibited a significant circadian rhythm (cosinor: P < 0.01; Fig. 1D). Specifically, SCC increased from 6:00 to 18:00.

Plasma hormone and IL-8 levels

In this study, plasma prolactin level showed significantly differences over one day (time: P < 0.01; Fig. 2A) and exhibited a significant circadian rhythm (cosinor: P < 0.01; Fig. 2A). However, no significant differences (time: P > 0.1; Fig. 2B and C) or circadian rhythms (cosinor: P > 0.1; Fig. 2B and C) were observed in insulin and IL-8 levels throughout the day.

Fig. 2.

Daily changes and circadian rhythms in the plasma prolactin (A: n = 14 from 8 goats), insulin (B: n = 14 from 8 goats), and interleukin (IL)−8 (C: n = 14 from 8 goats) levels. Samples collected at all time points per goat. Results of days 2 and 3 are consolidated into a 24-h period to show the changes in these parameters. Results are expressed as the mean ± SEM. Time (P < 0.05) indicates the significant differences within one day, and cosinor (P < 0.05) indicates the significant circadian rhythms

Clock gene expression levels in milk somatic cells

Bmal1, Per1, Cry1, and Rorα clock gene levels did not exhibit circadian rhythms (cosinor: P > 0.1 for Bmal1, Cry1, and Rorα; cosinor: P = 0.077 for Per1; Fig. 3A–D). However, Clock, Per2, Cry2, and Nr1d1 clock gene levels showed circadian rhythms (cosinor: P < 0.05 for Clock, Cry2, Nr1d1 and Per2; Fig. 3E–H). Moreover, Per2 and Nr1d1 levels exhibited significant differences over one day (P < 0.05; Fig. 3F and H).

Fig. 3.

Circadian rhythms in the basic helix-loop-helix ARNT-like 1 (Bmal1) (A: n = 12 from 6 udders of 3 goats), period circadian regulator (Per)-1 (B: n = 12 from 6 udders of 3 goats), cryptochrome circadian regulator (Cry)-1 (C: n = 12 from 6 udders of 3 goats), retinoic acid receptor-related orphan receptor-α (Rorα) (D: n = 12 from 6 udders of 3 goats), Clock (E: n = 12 from 6 udders of 3 goats), Per2 (F: n = 12 from 6 udders of 3 goats), Cry2 (G: n = 12 from 6 udders of 3 goats), and nuclear receptor subfamily 1 group D member 1 (Nr1d1) (H: n = 12 from 6 udders of 3 goats) clock gene levels. Samples collected at all time points per udder. Results of days 2 and 3 are consolidated into a 24-h period to show the changes in these parameters. Results are expressed as the mean ± SEM. Time (P < 0.05) indicates the significant differences within one day, and cosinor (P < 0.05) indicates the significant circadian rhythms

AMP levels

Gene expression levels of cathelicidin-2, S100A10, and lactoferrin in milk somatic cells did not show significant differences in circadian rhythm analysis (cosinor: P > 0.1 [Fig. 4A and B]; cosinor: P = 0.079 [Fig. 4C]) or daily changes (time: P > 0.1; Fig. 4A–C). However, cathelicidin-7 levels showed significant differences over one day (time: P < 0.05; Fig. 4D) and exhibited a circadian rhythm (cosinor: P < 0.05; Fig. 4D).

Fig. 4.

Daily differences and circadian rhythms in the cathelicidin-2 (A: n = 12 from 6 udders of 3 goats), S100A10 (B: n = 12 from 6 udders of 3 goats), lactoferrin (C: n = 12 from 6 udders of 3 goats), and cathelicidin-7 (D: n = 12 from 6 udders of 3 goats) antimicrobial peptide gene levels and goat β-defensin-1 (GBD1; E: n = 27 from 15 udders of 8 goats), S100A7 (F: n = 27 from 15 udders of 8 goats), lactoferrin (G: n = 27 from 15 udders of 8 goats), and cathelicidin-7 (H: n = 27 from 15 udders of 8 goats) antimicrobial peptide levels in milk. Samples collected at all time points per udder. Results of days 2 and 3 are consolidated into a 24-h period to show the changes within one day. Results are expressed as the mean ± SEM. Time (P < 0.05) indicates the significant differences within one day, and cosinor (P < 0.05) indicates the significant circadian rhythms

Milk S100A7 level did not show significant differences in circadian rhythm analysis (cosinor: P > 0.1; Fig. 4F) or daily changes (time: P > 0.1; Fig. 4F). In contrast, GBD1, lactoferrin, and cathelicidin-7 levels showed significant differences over one day (time: P < 0.01; Fig. 4E, G, and H) and exhibited circadian rhythms (cosinor: P < 0.01; Fig. 4E, G, and H). Notably, GBD1, lactoferrin and cathelicidin-7 levels were high from 14:00 to 22:00.

Discussion

Circadian rhythms are observed in various physiological processes, including immune processes, in mammals. Diurnal changes in immune cell numbers in blood and tissues [45], cytokine production under pathogen stimulation [8], and immune cell effector functions [13] suggest that both the innate and adaptive immune systems in peripheral tissues are regulated by the circadian system. However, research on immune system circadian rhythms in lactating animals, particularly in their mammary glands, remains limited. Therefore, we investigated the immune system circadian rhythms in the mammary glands of lactating animals, focusing on AMP levels, to mitigate the economic losses caused by mastitis in the dairy industry.

In this study, milk SCC and Na⁺ concentration showed circadian rhythms. Na⁺ is a marker of tight junctions between epithelial cells in the mammary glands [46]. Therefore, the significant circadian rhythm in milk Na⁺ concentration indicates a circadian rhythm in tight junction permeability in the mammary glands. Tight junction proteins, such as occludin and claudin-1, are under circadian control in the mouse colon [47]. These tight junction proteins also exist in the mammary glands and contribute to the blood–milk barrier [48]. Therefore, the circadian rhythm in tight junction permeability in the mammary glands is possibly associated with the daily changes in occludin and claudin-1 levels. Additionally, tight junction permeability contributes to leukocyte migration from the blood into the mammary glands, increasing the SCC [49]. This suggests that the circadian rhythm in SCC is associated with changes in the blood–milk barrier. IL-8 upregulates leukocyte β2 integrin levels, promoting the attachment and transmigration of neutrophils from the bloodstream into tissues during inflammation [50]. β2 integrin levels exhibit circadian rhythms in neutrophils, lymphocytes, and monocytes, guiding the circadian migration of these cells into tissues [45]. In this study, blood IL-8 levels did not change significantly, suggesting that the circadian migration of leukocytes is associated with other factors, such as the intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in endothelial cells. These molecules are also under circadian control and regulate the rhythmic adhesion and migration of leukocytes into tissues [45, 51]. Other chemokines, such as the C-X-C motif chemokine ligand-5 and monocyte chemoattractant protein-1, also contribute to leukocytes recruitment [52, 53].

In this study, prolactin level, but not milk production, exhibited a significant circadian rhythm. Prolactin plays an important role in milk production in MECs [32]. Our results suggest that the differences in prolactin levels over one day do not affect the milk yield. Prolactin also increases the level of tight junctions between MECs [54]. It stimulates the integrin-mediated adhesion of circulating mononuclear cells to endothelial cells [55]. Overall, we propose that the circadian rhythm in prolactin level influences the circadian variation in blood–milk barrier permeability and that leukocyte migration increases the SCC, but not milk production.

In addition to systemic circadian factors, intracellular circadian clock is critical for the circadian rhythms in immune functions [11]. Considering the important roles of somatic cells in the immune functions of mammary glands, this study clarified the intracellular circadian clock gene levels in somatic cells. In this study, some clock gene (Clock, Cry2, Per2 and Nr1d1) levels exhibited circadian rhythms, suggesting that somatic cells possess their own circadian rhythms. However, no circadian rhythms were observed for the other clock genes. Milking every 4 h significantly decreased the milk SCC in this study (Fig. 1A). Clock gene oscillations in fibroblast cells are affected by the cell density, and number of rhythmic cells decreases drastically as the cell density drops below 30 cells/mm² [56]. This explains the non-significant circadian rhythms in other clock genes observed in this study.

Gene expression levels and concentrations of AMPs in milk were analyzed to examine the circadian rhythms in immune functions in somatic cells. Gene expression and milk concentration of cathelicidin-7 exhibited significant daily changes and circadian rhythms. GBD1 and lactoferrin concentrations in milk also showed significant daily changes and circadian rhythms. These results suggest that the immune functions of somatic cells are controlled by circadian rhythms in dairy goats. Cathelicidin and β-defensin levels exhibit circadian rhythms in the mouse skin and liver and human colon [6, 7]. Sherman et al. revealed that the CLOCK: BMAL1 heterodimer regulates β-defensin expression levels by binding to the E-box enhancer sequences of these peptides [7]. Therefore, the circadian rhythm in β-defensin expression is possibly associated with that in CLOCK expression in this study. β-Defensins are chemotactic for immature dendritic and T cells [57]. Here, we observed an increase in the percentage of mononuclear cells among the milk somatic cells in the evening (data not shown). Therefore, the circadian rhythm in GBD1 levels observed in this study possibly contributed to the daily variations in SCC. However, the mechanisms underlying the circadian rhythms in cathelicidin levels remain unknown. As the transcription and translation patterns of cathelicidins are generally consistent, the circadian rhythm in milk cathelicidin concentration is possibly associated with the circadian regulation at the transcriptional level in somatic cells. Further exploration of the relationship between E-box sequences in the enhancers of cathelicidins and clock genes is necessary to clarify the circadian changes in milk cathelicidin levels. To the best of our knowledge, this study is the first to report the circadian rhythm in milk lactoferrin concentration [58]. However, lactoferrin gene expression did not exhibit a circadian rhythm in somatic cells. Milk lactoferrin concentration is possibly controlled by the circadian rhythms in the post-translational modifications in cells [59], warranting further research. In this study, SCC and AMP levels increased from evening to night, suggesting the upregulation of immune functions during this period. Therefore, night-time is a critical period for eliminating any invading bacteria and preventing further infection.

Conclusions

This study demonstrated the circadian rhythms in immune functions and processes in the mammary gland, including leukocyte migration (SCC), AMP gene expression in somatic cells, and their concentrations in milk. Overall, our findings provide valuable insights to ensure safe milking conditions and improve the milk quality by milking during periods of high immune activity in the mammary glands.

Authors’ contributions

ZL: Formal analysis, Investigation, Writing – original draft – review & editing; TN: Methodology, Resources; TS: Methodology, Resources; NI: Conceptualization, Funding acquisition, Formal analysis, Methodology, Resources, Validation, Writing – original draft – review & editing.

Funding

This study was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS Kakenhi; grant no. 21K05893 for Naoki Isobe).

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The study was conducted in accordance with the guidelines for animal experiments issued by Hiroshima University and were approved by the Animal Research Committee of Hiroshima University (No. C 19–4). We conducted this investigation in accordance with the ARRIVE standards and regulations (https://arriveguidelines.org).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.