Effect of alone & combined application of benzylaminopurine and gibberellic acid on in-vitro germination and growth rate of broccoli

Abstract

Broccoli (Brassica oleraceae L. var. italica) is an important crop and faces challenges of further propagation due to genetic segregation and climate change. Efficient micropropagation protocols are necessary for the rapid production of true-to-type plantlets and are essential for this process. However, the synergistic effects of 6-benzylaminopurine (BAP) and gibberellic acid (GA₃) for this species have not been extensively studied. The study evaluated five pre-sowing seed-soaking treatments with various concentrations of BAP and GA₃ (Control: T₀; T₁: 25 + 25; T₂: 25 + 50; T₃: 50 + 25; T₄: 50 + 50 ppm) on Murashige and Skoog (MS) medium over a 16 h photoperiod, using a completely randomized design (CRD) with individual in vitro seedlings as experimental units. Morphological, physiological, biochemical, antioxidant, and gene expression (RT-qPCR) parameters were assessed.. All hormonal treatments significantly exhibited better response as compared to the control (T₀) treatment (p ≤ 0.05). The application of hormonal treatment (25 ppm BAP + 50 ppm GA₃) (T₂) significantly better response with an increase in shoot length and elevation in plant biomass, chlorophyll (a, b and T Chl), total phenolic content (TPC), flavonoids (TFC) and DPPH scavenging activity. Antioxidant enzymes, such as superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) and seedling vigor index (SVI-I, SVI-II) were significantly increased under T₂, markedly a mitigating enzyme activity. RT-qPCR analysis further confirmed these results by showing high levels of transcript abundance of antioxidant-related genes (BoSOD1, BoAPX1 and BoCAT) under T₂ than in the control group with amplification specificity verified through melt curve analysis. Multivariate analyses, correlation heatmap, network analysis and principal component analysis indicated significant positive interrelationships among the growth traits, photosynthetic pigments, antioxidant capacity and vigor indices, implying the coordinated physiological regulation. Similarly, T₂ as an efficient hormonal approach to enhance growth, antioxidant control, in vitro micropropagation efficiency in broccoli.

Introduction

Broccoli (Brassica oleracea L. var. italica), one of the main cultivars of the Brassicaceae family, is a major horticultural commodity of great importance due to its high concentration of antioxidants, vitamins, and chemoprotective secondary metabolites, which are responsible for its growing presence in global markets [1, 2]. Indole-3-carbinol, which is an antitumour compound found in the crop, aids in the fight against breast and lung cancer. In addition to its dietary uses in high-value culinary industries, broccoli has a higher nutritional density than its related cole crops, such as cauliflower (B. oleracea var. botrytis) and cabbage (B. oleracea var. capitata) [3]. This polymorphic species, which includes diverse botanical forms such as kale, Brussels sprouts, and kohlrabi, exhibits wide genetic diversity and a variety of morphological differences within the species complex [4]. Broccoli is used in the fresh market, processed and functional food markets around the world. Its physiological importance is supported by a solid profile of glucosinolates and their hydrolysis products, i.e. sulforaphane and indole-3-carbinol, which account for the documented mechanisms of action of antioxidant, anti-inflammatory and chemopreventive activity against chronic pathologies [5, 6]. Broccoli has become a significant "superfood" in the nutritional science world because of its health-promoting properties [7]. Cultivation is widespread in Europe, North America and Asia, being a mainstay of world production of vegetables and agricultural commerce [8]. Furthermore, its extensive production throughout East Asia and South America is still part of the development of sustainable cropping systems, food security attempts, and economic stability of specialised agricultural regions [9].

Broccoli is increasingly used in processed commodities, nutraceutical preparations and dietary supplements, which has a major impact on enhancing the economic value of the global market [10]. The need for perennial production, combined with the susceptibility of the crop itself to abiotic stressors, requires the adoption of sustainable propagation and advanced cultivation protocols to guarantee the genetic fidelity, phytochemical uniformity and supply chain resilience [11]. This continuous demand in the market is mainly due to the high concentration of health-protective metabolites in the florets, although the traditional cultivation of this crop has been limited to temperate zones and is currently being threatened by climatic instability [12, 13]. The ever-increasing disparity of environmental limitations and year-long consumer needs highlights the urgency of developing robust and highly efficient propagation technologies, including in-vitro micropropagation, for achieving standardised plantlet production [14].

Broccoli can be commercially cultivated from seeds, but this approach also poses challenges because it is hard to scale up [15]. It is mainly because genetic separation leads to some phenotypic variability, making it challenging to produce a true-to-type homogeneous crop [16]. Moreover, the method of sexual reproduction relies on the ability to multiply elite F1 hybrid genotypes, which is further complicated by self-incompatibility and the biennial life cycle of B. oleracea [17]. Micropropagation is an alternative method that allows rapid asexual reproduction and is predominantly used for the promotion of desired genotypes while offering disease-free and genetically similar plantlets [18].

Plant growth regulators (PGRs) are fundamental components of in vitro culture systems, as their type, concentration, and interaction regulate cell division, organ differentiation, and morphogenic competence in cultured plant tissues [19]. Among PGRs, cytokinins and auxins have been extensively used to induce shoot length in vegetable crops, with cytokinins such as 6-benzylaminopurine (BAP) playing a central role in promoting shoot initiation, meristem activation, and chloroplast development in vitro [20]. The effectiveness of BAP-based media has been demonstrated in Brassica oleracea using hypocotyl and cotyledon explants [21], as well as in other vegetables, including tomato (Solanum lycopersicum) [22], potato (Solanum tuberosum L. cv. Arizona) [23], and cabbage (Brassica oleracea var. capitata) [24]. Gibberellic acid (GA₃), although not a primary morphogenetic regulator, is routinely incorporated into in vitro systems to support seed germination, Plant length, and uniform seedling establishment, and its positive influence has been reported in vegetables such as lettuce (Lactuca sativa) [25], cucumber (Cucumis sativus) [26], and Tomato (Lycopersicum esculentum Mill.) [27] when applied at appropriate concentrations in combination with cytokinins. Morphogenic responses are highly genotype-dependent in controlled environments in Brassica species, underscoring the need to optimise cytokinin–gibberellin combinations for individual cultivars to induce organogenic responses across genotypes reliably [28]. The present study aimed to evaluate the combined effect of BAP and GA₃ on in vitro seed germination and the early seedling establishment in broccoli (Brassica oleracea L. var. Italica) and establish an efficient micropropagation protocol. In addition, biochemical assays, chlorophyll content, antioxidant activity, enzyme activity (SOD, CAT, and POD), and RT-qPCR analysis of antioxidant-related genes (BoSOD1, BoAPX1, and BoCAT) were performed to investigate antioxidant defense responses to hormonal treatments during the early development of seedlings.

Material and methods

Seeds collection and sterilization

Certified seeds of broccoli (Brassica oleracea L. var. italica) were procured from the Regional Agricultural Research Institute, Bahawalpur, Pakistan (Latitude: 29.3864301° N; Longitude: 71.6533386° E). The experiment was conducted at the Tissue Culture Laboratory, Department of Horticultural Sciences, Faculty of Agriculture and Environment, The Islamia University of Bahawalpur. Aseptic cultivation required surface sterilisation of the seeds as per the modified protocol. The first stage of the seed preparation process involved placing the seeds in 70% (v/v) ethanol for 1 min. After that, the seeds were placed in the 20% solution of the commercial bleach (8% NaOCl) for 20 min. After the bleach treatment, the seeds were rinsed 5 times in sterile distilled water to remove the remaining rinse solution to prepare the seeds for inoculation [29].

Culture medium and plant growth regulators

Murashige and Skoog (MS) media were used for the seed germination basal medium, [30] and 100 ml of macro-nutrient, 10 ml of micronutrient, 10 ml of vitamin, 10 ml of iron, 30 g of sucrose, and 2 g of Myo-insitol, and 8 g of Agar were added as a gelling agent per 1 L of beaker. The medium was dissolved in distilled water, and the pH was adjusted to 5.8 with the digital pH meter (STARTER 3100-F, OHAUS®, USA) using 1 N HCl or 1 N NaOH before the agar was added (Fig. 1). The medium was then heated gently on a magnetic stirrer hotplate until the agar fully dissolved. Aliquots of the molten medium were dispensed into glass culture tubes, which were then sealed appropriately. The sterilization procedure was done by autoclave (HV-110, Hirayama Manufacturing Corporation, Japan) at 121 °C and 15 psi for 20 min. Broccoli seeds were washed 3 times with tap water, once with distilled water, treated with tween20 (2%), and then treated with sodium hypochloride (5%) to shake for 1 to 2 min, and sterilized with distilled water after adding 100 ml of Mercury Chloride (HgCl₂). Five treatments were established using pre-sowing seed soak treatments: T₀ (Control), where seeds were soaked in sterile distilled water; T₁ (25 ppm BAP + 25 ppm GA₃); T₂ (25 ppm BAP + 50 ppm GA₃); T₃ (50 ppm BAP + 25 ppm GA₃); and T₄ (50 ppm BAP + 50 ppm GA₃). Surface-sterilized seeds were aseptically soaked in the respective freshly prepared plant growth regulators (PGR) solutions or sterile water for 30 min, and inoculation was conducted under a laminar airflow cabinet (Airstream®, ESCO Lifesciences, Singapore) under aseptic conditions, following standard sterilization protocols to prevent microbial contamination during handling procedure. Following inoculation, sealed culture MS media test tubes were transferred to a controlled environment growth room and incubated at 25–28 °C under a 16-h photoperiod supplied by cool white, fluorescent lamps (TL-D 36 W, Philips, Netherlands). Plant length was recorded at various intervals (0, 4, 8, 12 and 16 days after inoculation) to observe the growth of seedlings. All other physiological, biomass, biochemical, antioxidant, and molecular analyses were performed on seedlings sampled at 16 days after inoculation of the experimental protocol.

Fig. 1.

Workflow of culture medium preparation, plant growth regulator (BAP and GA₃) treatments and in vitro seed germination of broccoli (Brassica oleracea L. var. italica)

Data collection and analysis

Morphological and physiological data were collected after 16 days of in vitro culture, except where noted. Ten seedlings were randomly sampled from each treatment for destructive analysis. The following parameters were evaluated:

Morphophysiological parameters

Measurement of survival percentage (%)

The viability and establishment of seedlings were calculated by the percentage of surviving seedlings at the end of the 16-day culture period. A seedling was deemed viable once the radicle and the cotyledons had begun to form and were free of any signs of necrosis or microbial contamination. Each treatment replicate’s survival percentage was measured by applying the Survival percentage method described by [31], and employing the standard equation:

Measurement of plant length (cm)

Plant length was used as an indicator of seedling growth under in vitro conditions [32]. The shoot length of the seedlings was measured using a digital calliper (Model CD-6″ CSX, Mitutoyo Corporation, Kawasaki, Japan) to ensure accuracy and precision from the shoot base at the level of the culture medium surface to the apical tip. These measurements were made at 4, 8, 12, and 16 days post-inoculation, allowing the growth dynamics during the culture period to be evaluated relative to the plant growth-promoter regulatory treatments.

Assessment of root length and shoot length (cm)

Root and shoot length were measured after 16 days of in vitro culture. Careful removal of seedlings from MS media, and the shoot length was measured from the apical meristem to the hypocotyl, and root length was taken as the distance between the apex of the root and the hypocotyl-root junction. Both parameters were measured in centimetres (cm), and they were applied to analyse the seedling growth responses under in vitro conditions [33].

Measurement of plant growth rate (GR, cm/day)

Plant growth rate was determined as the rate of increase in plant length during the 0–16 days post-inoculation period during early seedling development at different concentrations of BAP and GA₃. Non-destructive, interval measurements of length were conducted throughout the observation period, and the differential growth rate was determined for the period from 6 to 16 days post-inoculation. It was measured in centimetres and derived from the standard formula for absolute growth as postulated in [34].

where l₂ and l₁ are the plant lengths at day 16 (t₂) and day 6 (t₁), respectively.

Measurement of biomass (fresh and dry weight, mg)

Seedlings were separated into individual roots and shoots. Shoot Fresh Weight (SFW) and Root Fresh Weight (RFW) were taken. The samples were completely dried in an oven set at 60 °C for 48 h and subsequently used to determine Shoot Dry Weight (SDW) and Root Dry Weight (RDW). Also, Total Fresh Plant Weight (TFPW) and Total Dry Plant Weight (TDPW) were derived from the total sums of their respective tissue. Measurement of Biomass were determined based on the fresh and dry weight of plant tissue according to standard plant growth analysis procedures [35, 36].

Measurement of Root to Shoot Ratio (RSR)

Root-to-Shoot Ratio (RSR) was used to evaluate the biomass allocation strategy of broccoli seedlings under various concentrations of BAP and GA₃. Broccoli seedlings were aseptically removed from the culture medium, and root and shoot tissues were separated using sterile forceps after 16 days of in vitro culture. Fresh and dry biomass measurements were obtained as described above, and RSR was calculated for each replicate seedling as the ratio of the root dry weight to the shoot dry weight [37].

Determination of Shoot Mass Ratio (SMR) and Root Mass Ratio (RMR)

Biomass distribution of the plant between the roots and the shoots was quantitatively measured with the Shoot Mass Ratio (SMR) and Root Mass Ratio (RMR) parameters. These ratios illustrate the treatment conditions for which the underlying biomass allocation is attributed to control and treatment conditions. Once the shoot dry weight (SDW), root dry weight (RDW), and total dry plant weight (TDPW = SDW + RDW) were obtained, all SMR and RMR ratios were calculated for each seedling according to the widely accepted protocols [37].

Quantification of specific shoot length (cm/mg)

Seedling shoot length was evaluated as the first step in considering the growth performance and vigour of seedlings treated with different levels of BAP and GA₃. Seedlings were removed from MS medium after 16 days of in vitro culture, and the shoot length was measured with a digital calliper from the junction of the cotyledon and the hypocotyl to the tip of the longest leaf or cotyledon. The corresponding shoot dry weight for each seedling was obtained as described in the biomass measurement section. The ratio was used to calculate the specific shoot length index (SSL) in centimetres (cm) [38].

Measurement of water content (%)

The Water content in cultured media was determined by measuring the percentage of water held in the plant tissues. It is the moisture level within seedlings, an indicator of hydration and physiological responses to treatments [39]. This parameter was calculated based on the total fresh plant weight (TFPW) and total dry plant weight (TDPW) of individual seedlings as follows.

Assessment of Seedling Vigor Index (SVI) and Seedling Vigor Index-II (SVI-II)

The Seedling Vigor Indices (SV-I and SVI-II) were calculated to assess the physiological growth with the effect of BAP and GA₃ on broccoli seedlings. SVI-I was calculated with germination percentage and average seedling length (cm), which includes in vitro growth germination, and SVI-II was calculated using germination percentage and average seedling dry weight (mg), which is the ratio between germination potential and biomass growth. These were used to determine the differences in vigor potential and physiological strength of broccoli seedlings induced with various concentrations of PGR at the different time periods and calculated through the following formula [40, 41].

Biochemical analysis

Assessment of chlorophyll a, chlorophyll b, total chlorophyll, total soluble solids, titratable acidity and ripening index

Chlorophyll pigments were extracted from the leaves of Broccoli (Brassica oleracea L. var italica) in 80% (v/v) chilled acetone after treated seedlings were collected. Leaf tissue about 0.1 g was combined with 5 ml of acetone and centrifuged (50,156,058-Thermo Sorvall™ Scientific Legend Micro 17R) at 7000 revolutions per minute for ten minutes at a temperature of 4 °C. Finally, the supernatant was analysed spectrophotometrically with three various absorbance readings were used at range 663 nm, 645 nm and 652 nm. According to Arnon's equations [42], the chlorophyll a, b and total contents were quantified.

where A is absorbance, V the extract volume (mL), and W the tissue fresh weight (g). The pigment content was expressed as mg g⁻¹ FW. Chlorophyll quantification was performed to evaluate the photosynthetic efficiency and structural integrity of the photosynthetic apparatus under varying hormonal regimes, as cytokinins and gibberellins are known to regulate chloroplast development, chlorophyll biosynthesis, and photosystem II functionality in in vitro plantlets [43].

Total soluble solids content was analyzed by using digital refractometer (RX 5000, ATAGO, Japan), sap of fresh horticultural commodities was extracted by usinsg blender machine and apply 2 to 3 drops onto digital refractometer prism and expressed at.^OBrix [44]. The titratable acidity of plant tissue was measured with modified version of Hortwitz [45] method. Titratable acidity was evaluated by 5 mg extracted plant tissue of horticultural product with 15 ml of distilled water in a beaker with two to three drops of phenolphthalein indicator and titrated with 0.1 N NaOH until pale pink color appeared for 15 s and expressed in percentage (%). Ripening index can be measured by the division of TSS/TA ratio [45].

Antioxidant enzyme activity

Assessment of superoxide dismutase activity, catalase and peroxidase activity

Activity of superoxide dismutase was determined following a modified method of measurement by [46]. For this test, one must combine a 200 micro-liter sample of the enzymatic extract with 800 µL of distilled water, or 800 times more than the sample described. The reaction was exposed to UV light for 15 min under an aluminum foil cover. The absorbance was measured at 560 nm on spectrophotometer (IRMECO UV–Vis) and the enzyme activity was expressed in U/mg of proteins. The amount of catalase activity was estimated by adjusting for slight variations in the previously established protocol [46]. Each enzyme concentration was mixed with 400 µL of hydrogen peroxide solution, then inserted into the spectrophotometer to measure absorbance. Catalase activity was expressed as U/mg protein. Peroxidase (POD) activity was measured according to previously reported methods [46]. The solution contained 800 µl or milliliters of 50 micromolar phosphate buffer, having a solution approximate at an acidic level five labs. The enzyme extract was added, and the reaction was initiated. The absorbance was measured at 470 nm on an IRMECO UV–Vis spectrophotometer and was expressed as U/mg protein.

Non enzymatic antioxidant activity

Assessment of total phenolic content, total flavonoid content and DPPH radical-scavenging activity

The total phenolic content of broccoli were determined using the method as explained by Ainsworth [47]. A sample of fresh plant tissue (1 g) was homogenised with 80% Methanol (CH₃OH), centrifuged for 10 min at 4 °C, and then 100µL of the supernatant was mixed with 200 µL Folin-Ciocalteu reagent and 800 µL sodium carbonate. Absorbance was measured at 765 nm and expressed as mg GAE/g FW. The total flavonoid concentration in the extracts was calculated using a technique described in recent studies [48]. A small amount of the extract was mixed with a larger portion of water and a small additional amount of a nitrous acid solution. To proceed, 150 mL of a 10% solution is then added about 5 min later. Furthermore, 500 mL, which is a 1 molar solution of NaOH, is added after a six-minute incubation. The volume was increased to 2.5 ml with the use of a water filter. The concentrations were expressed as grams of fresh fruit per gram of quercetin (mg QE/g FW), and the DPPH radical scavenging activity was measured using the method of Brand-Williams [49]. 1 g of plant tissue was homogenized in a 5 mL extraction mixture containing CH₃OH, acetone, and HCl. The mixture was centrifuged, pellets removed, and 5 ml of 0.004% DPPH solution was added to the 50 µL supernatant. The absorbance was measured at 517 nm and expressed at 1 C 50 µg/100 ml.

RT-qPCR analysis

Gene expression analysis was performed using reverse transcription quantitative PCR (RT-qPCR) to assess transcriptional responses related to hormonal regulation and antioxidant activity in broccoli (Brassica oleracea L. var. italica). Total RNA was isolated from 16-day in vitro-grown seedlings subjected to different BAP and GA₃ treatments using the Plant RNA Purification Reagent (Invitrogen™, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Agarose gel electrophoresis was used to evaluate the quality of RNA, and the spectrophotometer, A260/A280 ratios was used to compare RNA concentration and purity. A 1 μg of total RNA was used to synthesise the first-strand complementary DNA (cDNA) using the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) as per the directions of the manufacturer. A CFX96 Real-Time PCR Detection System (Bio-Rad, USA) was used to perform quantitative PCR reactions with a 10 μL reaction volume in SYBR™ Green Master Mix (Bio-Rad, USA). PCR was initiated with a pre-condition high-temperature activation phase, followed by repetitive cycles of cyclic strand separation and concomitant primer annealing and elongation at optimal temperature and time parameters. The melt curve was performed from 65 °C to 95 °C to ensure amplification specificity. Relative gene expression levels were calculated using the 2^⁻ΔΔCq method, with actin used as the internal reference gene [50–52] The selected genes included the gene of primary interest in antioxidant-related genes, such as Cu/Zn superoxide dismutase (BoSOD1), ascorbate peroxidase (BoAPX1), catalase (BoCAT), and actin (BoACT2) as the internal control gene. The design of the primers was based on conserved coding sequences in the NCBI GenBank database. Each primer pair was expected to amplify only a single, specific product within the anticipated size range, and agarose gel electrophoresis and melt curve analysis were performed to verify specific amplification. Table 1 contains detailed information on gene names and GenBank accession numbers, Primer sequences, and the expected sizes of amplified products.

Table 1.

Biochemical parameter analysis

Treatment	Chlorophyll a (mg/g)	Chlorophyll b (mg/g)	Total Chlorophyll (mg/g)	Total Soluble Sugar (TSS) (mg/g)	Titratable Acidity (TA) (%)	Ripening Index (TSS/TA)
Control	5.35 ± 0.28d	1.81 ± 0.11d	7.16 ± 0.39d	3.5 ± 0.10c	0.63 ± 0.15a	5.75 ± 1.39c
25 ppm BAP + 25 ppm GA₃	8.6 ± 2.12c	2.86 ± 0.70c	11.46 ± 2.8c	4.07 ± 0.16ab	0.52 ± 0.06a	7.93 ± 1.28ab
25 ppm BAP + 50 ppm GA₃	16.33 ± 0.88a	5.2 ± 0.34a	21.53 ± 1.85a	4.3 ± 0.2a	0.47 ± 0.02a	9.05 ± 0.90a
50 ppm BAP + 25 ppm GA₃	12.3 ± 0.51b	4.1 ± 0.17b	16.4 ± 0.69b	4.0 ± 0.1ab	0.57 ± 0.09a	7.11 ± 1.25abc
50 ppm BAP + 50 ppm GA₃	11.3 ± 0.75b	3.76 ± 0.25b	15.06 ± 1.0b	3.8 ± 0.26bc	0.6 ± 0.04a	6.3 ± 0.71bc

Values are mean ± standard deviation with equal letters showing the least significant difference (LSD) (p value < 0.05), n = 3

Statistical analysis

The collected data were statistically analysed using analysis of variance (ANOVA), and differences among treatment means were determined using Fisher’s least significant difference (LSD) test at p ≤ 0.05. Interrelationships among the variance variables were first evaluated using Pearson's correlation analysis [53] and afterwards visualised using heatmap clustering, network plots and chord plots in Origin Pro 2025 [54]. Principal component analysis (PCA) was used to assess the overall treatment changes and identify which variables contributed most to each significant effect.

Results

Morphophysiological parameters

Assessment of survival percentage (%)

Survival percentage of broccoli seedlings grown in MS medium was significantly affected (p ≤ 0.05) by different concentrations of BAP and GA₃ treatments under in vitro conditions (Fig. 2). PGR-treated seedlings survived significantly better than the control treatment (T₀). The untreated seedlings had the lowest survival rate (23.50%), indicating low seedling growth on the untreated MS medium. The survival percentages of treated seedlings (T₁, T₃, and T₄) were significantly higher, 38.33%, 29%, and 35.40% than the control. Among other treated seedlings, T₂ had a significantly higher survival percentage (47%) than all other treatments and untreated seedlings. Germinated seedlings followed a similar trend, with T₂ having the greatest number of germinated seedlings (16), followed by T₁ (13), T₄ (12), T₃ (10), and the control (8). However, the application of plant growth regulators (BAP and GA₃) significantly improved the viability and growth of broccoli seedlings in MS medium under controlled conditions.

Fig. 2.

Impact of various concentrations of plant growth regulators (PGR) treatments on the survival percentage of broccoli seedlings under controlled environment conditions. Each value represents the average of three replicates, and vertical bars show the standard error of the mean and different lowercase letters indicate significant differences (p ≤ 0.05) according to the LSD test

Measurement of plant length (cm)

The plant length of broccoli seedlings was significantly (p ≤ 0.05) higher with various concentrations of plant growth regulators (PGR) during the in vitro culture period (Fig. 3). T₀ control showed the lowest plant length of 2.72 cm, but T₂ exhibited a significant increase in plant height of 61.8% (4.4 cm) as compared with the control. T₁ followed with 3.8 cm, whereas T₃ reached 3.27 cm. The higher hormone combination, T₄, with a plant length of 2.95 cm, was marginally higher than the control but not significantly different. Overall, the data revealed that the moderate concentration of BAP, combined with higher GA₃ levels in T₂ (25 ppm BAP + 50 ppm GA₃), significantly increased plant length in media as compared with the control.

Fig. 3.

The effect of various concentrations of plant growth regulators (BAP and GA₃) on plant length (cm) of broccoli seedlings during the post-inoculation period under in vitro conditions. The data are expressed as mean ± SD; different letters indicate least significant differences (LSD, p ≤ 0.05)

Assessment of root length and shoot length (cm)

Effect of various hormonal treatments on broccoli seedlings substantially increased the root length (cm) and shoot length (cm) in Murashige and Skoog (MS) medium as compared with the control (Fig. 4). Plant growth regulator (PGR) significantly increased root and shoot length in all treated plants, indicating a positive response in early seedling growth. The root length and shoot length of the control treatment (T₀) under in vitro conditions were 0.72 cm and 2.72 cm, respectively. T₂ had the greatest response among the hormone-treated groups, with a root length of 1.48 cm and a shoot length of 4.40 cm, indicating a higher growth response than the others. Treatment (T₁) showed a root length of 0.83 cm and a shoot length of 3.80 cm as compared with the control. Treatment (T₃) revealed root length (1.25 cm) and shoot length (3.27 cm). However, (T₄) root length was 1.00 cm, and shoot length was 2.95 cm, indicating a response like the control group. Collectively, it revealed that T₂ (25 ppm BAP + 50 ppm GA₃) improved overall root and shoot length in than the control.

Fig. 4.

Impact of various concentrations of plant growth regulators (BAP and GA₃) on root length (cm) and shoot length (cm) of broccoli seedlings grown in MS medium under in vitro conditions. Values represent mean ± SD, and lowercase letters indicate a statistically significant difference between treatments based on the LSD test (p ≤ 0.05)

Measurement of plant growth rate (PGR, cm/day)

The application of BAP and GA₃ significantly improved in plant growth rate of broccoli seedlings on MS medium (p ≤ 0.05; Fig. 5). Differences in growth rate (GR) were observed among treatments, with all PGR-treated groups showing markedly higher growth than the control. Plantlets under the control treatment (T₀) had a growth rate of 0.278 cm/day. Plant growth regulator substantially increased growth rates, with the highest rate recorded in T₂, and plantlets in the culture achieved a growth rate of 0.423 cm/day and which was a 52% increase over the control and was statistically significantly higher than all other treatments. There was moderate improvement in growth rate with T₄ (0.350 cm/day), but minimal improvement in T₁ and T₃ compared with the control group. Overall, these findings showed that moderate concentration of plant growth regulator (T₂: 25 ppm BAP + 50 ppm GA₃) was best to increase the level of plant growth rate in a controlled environment.

Fig. 5.

Impact of various concentrations of plant growth regulators (PGR) treatments on the plant growth rate of broccoli seedlings under controlled environment conditions. Each value represents the average of three replicates, and vertical bars show the standard error of the mean and different lowercase letters indicate significant differences (p ≤ 0.05) according to the LSD test

Measurement of biomass (fresh and dry weight, mg)

The accumulation of total biomass in broccoli seedlings was significantly (p ≤ 0.05) influenced by the combined application of BAP and GA₃ under in vitro culture (Fig. 6). Accumulated data showed distinct differences among treatments in total fresh and dry weights compared with the control. The control seedlings (T₀) which were not treated with any substances, had the least amount of biomass and thus served as the baseline for comparison. Use of plant growth regulators stimulated mass production at moderate concentrations. However, treatment T₂ (25 ppm BAP + 50 ppm GA₃) among all the other treatments displayed the most biomass accumulation with total weights of (527.67 mg fresh and 110.57 mg dry plants), indicating an increase of 63% and 127% above the control, respectively. T₁ was lower in BAP dosage and GA₃ and showed the next best improvement. On the other hand, treatments with high concentrations of cytokinin (T₃ and T₄) showed no improvement. PGR treatment with control displayed similar, but lower results. Similarly, T₂, the treatment with moderate BAP and high GA₃, resulted in the highest biomass weight was significantly greater than both the control group and other treatments.

Fig. 6.

Impact of various concentrations of plant growth regulators (BAP and GA₃) on fresh biomass weight (mg) and dry biomass weight (mg) of broccoli seedlings grown in MS medium under in vitro conditions. Values represent mean ± SD, and lowercase letters indicate a statistically significant difference between treatments based on the LSD test (p ≤ 0.05)

Measurement of Root to Shoot Ratio (RSR)

Broccoli plantlets grown under different treatments (T₀, T₁, T₂, T₃, T₄) in vitro have shown significant differences (p ≤ 0.05) in Root-to-Shoot ratio (RSR) (Fig. 7). Allocation patterns of shoot dry matter and root dry matter changed with the application of BAP and GA₃ together. Control (T₀) had the lowest RSR value (0.48 g/g), which suggests small biomass roots. The positive impact of the growth regulators on the BAP + GA₃ treatments in T₂ (25 ppm BAP + 50 ppm GA₃) was highest (0.91 g/g), which suggests an increase in the roots and shoots ratio. T₁ (0.70 g/g) and T₃ (0.54 g/g) both experienced slight increases, and T₄ (0.39 g/g) which was lower than the control, experienced a decline in RSR. Overall, the data shows that T₂ optimised the root to shoot dry biomass ratio as compared with the other treatments, indicating its hormonal combination was the best for balanced growth in vitro.

Fig. 7.

Impact of various concentrations of plant growth regulators (PGR) treatments on the root to shoot ratio of broccoli seedlings under controlled environment conditions. Each value represents the average of three replicates, and vertical bars show the standard error of the mean and different lowercase letters indicate significant differences (p ≤ 0.05) according to the LSD test

Determination of Root Mass Ratio (RMR) and Shoot Mass Ratio (SMR)

The distribution of dry matter between the root and shoot tissues varied (p ≤ 0.05) between treatments (T₁, T₂, T₃, T₄) and the control group under in vitro conditions. T₀ (control) had the lowest root mass ratio (RMR) of 0.32 g/g, whereas T₂ had a higher RMR of 0.48 g/g. T₁ and T₃ showed RMR values of 0.41 g/g and 0.35 g/g, respectively, while T₄ was the lowest among the PGR-treated groups with 0.28 g/g RMR (Fig. 8, A). The SMR was significantly higher than 2 g/g at higher cytokinin concentrations than in the other treatments. The control in T₄ showed an SMR of 0.68 g/g, which increased to 0.72 g/g in T₃, indicating that more dry matter was allocated to the shoot system, which was higher than the BAP levels in T₃. Similarly, lower SMR values were recorded in T₁ (0.59 g/g) and T₂ (0.52 g/g), consistent with their relatively greater root contribution. These results clearly demonstrate that T₂ (25 ppm BAP + 50 ppm GA₃) promoted a balanced and efficient distribution of dry matter between root and shoot tissues compared with the control and other treatments (Fig. 8B).

Fig. 8.

Impact of various concentrations of plant growth regulators (PGR) treatments on the root mass ratio (A) and shoot mass ratio (B) of broccoli seedlings under controlled environment conditions. Each number is the average of three replicates. Vertical bars indicate the standard error of the mean, and different lowercase letters are used to indicate significant difference (p ≤ 0.05) according to the LSD test

Quantification of seedling shoot length (cm/mg)

Specific shoot length (SSL) of broccoli seedlings responded significantly (p ≤ 0.05) to different combinations of BAP and GA₃ under in vitro culture (Fig. 9). The control (T₀) exhibited the highest SSL (0.0835 cm/g), which was the most efficient plant length per unit biomass in the absence of exogenous hormones. Slight changes were noted because of the application of plant growth regulators, showing the influence on the characteristics of shoot development and cell growth response. The seedlings grown at moderate hormone concentrations, especially in T₁ (25 ppm BAP + 25 ppm GA₃) and T₂ (25 ppm BAP + 50 ppm GA₃), showed comparable SSL (0.0808 and 0.0766 cm/g), a consistent relationship between shoot length and biomass accumulation. T₃ and T₄ had a slightly lower specific shoot length (0.0633 and 0.0579 cm/g) in SSL than the control group, indicating greater tissue accumulation per unit shoot length, and T₁ and T₂ had much higher SSL. These results collectively indicate that low concentrations of BAP and GA₃ achieved more optimal shoot elongation. Higher concentrations of cytokinin counteracted the elongation growth by compacting the structure.

Fig. 9.

Impact of various concentrations of plant growth regulators (PGR) treatments on the specific shoot length of broccoli seedlings under controlled environment conditions. Each value represents the average of three replicates, and vertical bars show the standard error of the mean and different lowercase letters indicate significant differences (p ≤ 0.05) according to the LSD test

Measurement of water content (%)

The water content in the seedlings of broccoli showed significant variation among in vitro culture treatments with different combinations of BAP and GA₃ (p ≤ 0.05) (Fig. 10). The control (T₀) had the greatest amount of moisture content (88.63%) among the treatments and maintained a better cellular hydration and turgor pressure without the hormones. The addition of the plant regulators changed this balance, showing an apparent hormonal effect on the water-osmotic balance and adjustment of the tissues. Although it is known that cytokinins create higher physiological strain, seedlings with moderate hormonal concentrations, particularly T₁ (25 ppm BAP + 25 ppm GA₃), had water content like the control (88.34%) and were under slight strain. However, there was a steady decline in water content after PGR concentrations from T₂ (86.31%), T₃ (84.10%) and T₄ (83.36%), reducing the decline. The comparison of the box plots and the control displayed significant differences in the higher hormone treatment, with a loss of water content in the replicates of the water content. Overall, the results indicate a shift in BAP and GA₃ concentrations sufficient to provide hydration to tissues, and higher cytokinin concentrations result in water loss from tissue metabolism driven by water and dense tissue metabolism. As shown in the box plot comparison, the control group had the highest water content, while the treatments with higher cytokinin concentrations showed a sharper decline. This highlights the regulatory effects of BAP and GA₃ on tissue water balance.

Fig. 10.

Effect of various concentrations of plant growth regulators (PGRs) on water content (%) of broccoli seedlings under in vitro conditions. The box indicates the interquartile range (IQR) of three biological replicates, the median is represented by a horizontal line, and the minimum and maximum values are represented by whiskers. Different lowercase letters show statistically significant differences between treatments based on the LSD test (p ≤ 0.05)

Assessment of Seedling Vigor Index (SVI) and Seedling Vigor Index-II (SVI-II)

Broccoli (Brassica oleracea L. var. italica) showed distinct (p ≤ 0.05) differences in seedling vigor indices (SVI-I and SVI-II) of SVI under in vitro conditions of various BAP and GA₃ combinations (Fig. 11 A-B). Control treatment (T₀) with (SVI-I = 3.09; SVI-II = 1152.96 showed physiological seedling vigor levels growing in the absence of hormones. Vigor indices were higher in all the plant growth regulator treatments than in the control, which showed an intensive increase in the seedling performance because of hormonal application. Treatment T₂ (25 ppm BAP + 50 ppm GA₃) had significantly higher seedling vigor indices (SVI-I = 3.32; SVI-II = 5276.53), and this treatment exhibited the strongest response among all treatments, which is the enhancement in the seedling growth along with a rise in biomass accumulation per seedling. PGR-treated groups showed moderate differences in seedling vigor T₁ (SVI -I = 2.45; SVI -II = 3072.03) and T₄ (SVI -I = 2.78; SVI -II = 2521.87) but relatively lower seedling vigor in T₃ (SVI -I = 2.27; SVI -II = 2334.67). Generally, differences in seedling growth among treatments suggest that the effects of BAP and GA₃ on the germination of broccoli seedlings were better with T₂ due to the most desirable impact in regulating seedling growth in the in vitro culture conditions.

Fig. 11.

Impact of various concentrations of plant growth regulators (PGR) treatments on the seedling vigor index I (A) and seedling vigor index II (B) of broccoli seedlings under controlled environment conditions. Each value represents the average of three replicates, and vertical bars show the standard error of the mean and different lowercase letters indicate significant differences (p ≤ 0.05) according to the LSD test

Biochemical analysis

Assessment of chlorophyll a, chlorophyll b, total chlorophyll, total soluble solids, titratable acidity and ripening index

Effect of different concentration of plant growth regulator treated group showed obtained increase in significant amount of chlorophyll content (chlorophyll a, b, total chlorophyll) parameters as well as biochemical parameters viz. total soluble solids (TSS), titratable acidity (TA) and ripening index (RI) of broccoli (Brassica oleracea L. var. italica) under controlled condition (Table 1). The combination of 25 ppm BAP and 50 ppm GA₃ (T₂) achieved the highest values for chlorophyll a, b, and total chlorophyll contents (16.33, 5.20 and 21.53 mg/g FW, respectively), which was found to be almost three-fold increase than the control (5.35, 1.81 and 7.16 mg/g FW). The increased improvement indicates that there is a synergistic action between cytokinin and gibberellin on the biogenesis and accumulation of chloroplasts and photosynthetic pigments. The T₂ treatment showed a significant increase in total soluble solids (4.3°Brix) and ripening index (9.05%) than the control (3.5°Brix and 5.75% respectively), suggesting the accumulation of sugar and improvement of metabolic activity. However, titratable acidity was markedly lower (0.47%) than in the control (0.63%), consistent with increased carbohydrate metabolism at advanced ripening. A combination of the two substances at moderate concentrations (25 ppm BAP + 50 ppm GA₃) augmented chlorophyll biosynthesis along with sugar metabolism, as well as improved the physiological quality of in vitro broccoli plantlets.

Antioxidant enzyme activity

Analysis of the activity of superoxide dismutase, catalase and peroxidase

The activity of Superoxide dismutase (SOD) is increased significantly across plant growth regulator (PGR) treatments as compared to the control. The maximum activity of the SOD was detected with BAP—25 ppm + GA of 50 ppm (T₂) with the increase of 2.04 fold (45.66 U/mg) over the control for the increased superoxide radical scavenging capacity at the best balance of hormone (Fig. 12A). The results showed that treatments of higher cytokinin or gibberellin concentrations (T₃ and T₄) increased the activity of superoxide dismutase moderately. It implies that if the levels are higher, it cannot be further induced by other antioxidant enzymes. The highest catalase (CAT) activity was recorded in T₂ (56.33 U/mg), which was seen to be nearly twofold from the control (27.66 U/mg) (Fig. 12B). Catalase (CAT) levels increase significantly with T₂ as an efficient ROS scavenging mechanism and better redox homeostasis, and relatively poor levels of activity during greater hormonal treatments (T₃ and T₄) indicate possible feedback inhibition. Collectively, the combined treatment of 25 ppm BAP + 50 ppm GA₃ effectively enhanced antioxidant defence capacity in broccoli plantlets, supporting their physiological resilience under in vitro conditions. Peroxidase (POD) activity also increased significantly with hormonal treatments, peaking in T₂ (33.67 U/mg) and T₃ (31.33 U/mg), showing 1.83-fold and 1.70-fold increase over the control (18.33 U/mg), respectively (Fig. 12C). This indicates that moderate levels of BAP and GA₃ can stimulate peroxidase-mediated hydrogen peroxide detoxification and cell wall lignification during in vitro morphogenesis.

Fig. 12.

Impact of various concentrations of plant growth regulators (PGR) treatments on the superoxide dismutase activity (A), catalase activity (B) and peroxidase activity (C) of broccoli seedlings under controlled environment conditions. Each value represents the average of three replicates, and vertical bars show the standard error of the mean and different lowercase letters indicate significant differences (p ≤ 0.05) according to the LSD test

Non enzymatic antioxidant activity

Assessment of total phenolic content, total flavonoid content and DPPH radical-scavenging activity

Total phenolic content increased significantly in all treatments compared to the control, but T₂ (25 ppm BAP + 50 ppm GA₃) treated seedlings exhibited higher phenol accumulation (17 mg GAE/g FW) than the control (10.33 mg GAE/g FW). Moderately phenolic antioxidant calculated in T₁ (13.33 mg GAE/g FW), and T₄ (14.66 mg GAE/g FW), but the lowest phenolic metabolite was in the untreated control (11 mg GAE/g FW) (Fig. 13A). This increment under T₂ indicates improved phenylpropanoid metabolism and phenolic biosynthesis, contributing to increased antioxidative power in broccoli plantlets in vitro. The concentration of flavonoids followed a similar trend to TPC, increasing in all treated seedlings. Total flavonoid content (TFC) was markedly higher in T₂ (20 mg QE/g FW) than in the control (10 mg QE/g FW). Moderate increases were recorded in T₁ (15.33 mg QE/g FW) and T₄ (16.33 mg QE/g FW). Treatments with the best hormone ratios showed a positive effect on flavonoid production. This necessary process participates in detoxifying reactive oxygen species (ROS) and maintaining overall redox balance (Fig. 13B). All treatments showed a constant elevation of DPPH radical-scavenging activity compared to the control. The T₂ treatment exhibited the highest scavenging activity (67.67%), which was ∼1.88 times higher than that of the control (36%), while T₄ (56.67%) and T₁ (50.67%) also showed high levels (Fig. 13C). The high DPPH radical scavenging activity in this work demonstrates that the non-enzymatic antioxidant system has been enhanced, likely due to cytokinin and gibberellin, which can stimulate antioxidant activity and improve cell survival in response to oxidative stress under in vitro conditions.

Fig. 13.

Impact of various concentrations of plant growth regulators (PGR) treatments on the total phenolic content (A), total flavonoid content (B) and DPPH scavenging activity (C) of broccoli seedlings under controlled environment conditions. Each value represents the average of three replicates, and vertical bars indicate the standard error of the mean. Different lowercase letters denote significant differences (p ≤ 0.05) according to the LSD test

RT-qPCR analysis

RT-qPCR analysis revealed clear treatment-dependent differences in the transcriptional responses of antioxidant-related genes in broccoli seedlings (Fig. 14). The amplification profiles of all reactions revealed a typical exponential rise followed by an MIQE phase, resulting in consistent and reproducible amplification across all treatments (Fig. 14A). Among the treatments, T₂ (25 ppm BAP + 50 ppm GA₃) reached the amplification threshold earlier than the other treatments, indicating increased transcript abundance, whereas the control (T₀) showed a delayed amplification. Melting curve analysis showed a single, sharp peak for each treatment, with melting temperatures ranging from 74 to 78 °C (Fig. 14B). A single melting peak with no secondary peaks was an indication that specific amplification had occurred and that primer-dimer formation had been avoided. The highest melt peak intensity was observed at T₂ followed by T₁, T₃ and T_4, with the control showing the lowest signal, which further supports the enhanced transcriptional activity under optimised cytokinin-gibberellin combinations. Agarose gel electrophoresis of the RT-qPCR products revealed a single band of the expected size in all treatments (Fig. 14C). The measured band sizes were very close to the predicted amplicon products of the target genes BoSOD1 (~ 168 bp), BoAPX1 (~ 180 bp), BoCAT (~ 165 bp) and the reference gene BoACT2 (~ 140 bp), confirming accurate primer targeting and amplification fidelity (Table 2). Band intensity was strongest in T₂, intermediate in T₁, T₃, and T₄, and weakest in the control, consistent with amplification and melt curve profiles. The gene-specific primers for RT-qPCR, their respective biological functions, GenBank accession numbers and expected sizes of the amplification products are given below (Table 2). The good agreement between the predicted amplicon sizes and the products obtained by gel electrophoresis further confirms the validity of the primers used for the expression analysis. Overall, the RT-qPCR results show that the combined application of T₂ (25 ppm BAP and 50 ppm GA₃) increased the transcriptional activity of antioxidant-related genes to a considerably greater extent than in the control and other treatments, indicating a positive regulatory effect of this hormonal combination on in vitro seedling growth and oxidative stress regulation.

Fig. 14.

RT-qPCR expression analysis of antioxidant-related gene expression in broccoli under BAP and GA₃ application. A Amplification curves, B melting curve profiles demonstrating specificity, and C agarose gel electrophoresis analysis of single amplicons of expected size from various treatment conditions and 100 bp DNA ladder (Thermo Fisher Scientific, USA)

Table 2.

Primer sequences and expected size of amplification products of target and reference genes used in RT-qPCR analysis of broccoli

Gene	Function	GenBank accession	Forward primer (5′–3′)	Reverse primer (5′–3′)	Amplicon size (bp)
BoSOD1	Cu/Zn superoxide dismutase	XM_013740439.1	TGGATGGTCCAGAGACTGAA	CCATGTTCCCAGAAGCACTA	168
BoAPX1	Ascorbate peroxidase	XM_013748912.1	GCTTCAGAGCTGCTCACATC	CACATGGCTCTCCGAGTTCT	180
BoCAT	Catalase	GQ500124	GCCGAGAAGAACCCTGATTA	GGGAGTTTTCACCTGTGAGG	165
BoACT2	Actin (reference gene)	XM_009125778.2	AGCTTCGTGTTGCACCTGAA	ACATGGCAGGGACATTGAAG	140

Correlation

A heat map of Pearson's correlation was performed statistically to examine the relationships among physiological, biochemical, and antioxidant parameters in broccoli under different levels of BAP and GA₃ under controlled conditions (Fig. 15). The correlations between shoot length (SL), root length (RL), plant length (PL), fresh biomass weight (FBW) and the percent of survival (SP) were positive (r > 0.85). Thus, it was clear that the higher concentration of plant hormone treatments improved the vegetative growth. Significant positive relationships (r > 0.9) were found between chlorophyll a (Chl a), b (Chl b) and total chlorophyll (T Chl) and plant growth rate (GR), root mass ratio (RMR) and water content (WC) due to photosynthetic efficiency was directly improved through plant growth regulator. Accordingly, non-enzymatic antioxidants representing total phenolic content (TPC), total flavonoid content (TFC) and radical scavenging activity (DPPH) were positively correlated with the response of the enzymatic antioxidants (SOD, CAT, POD). On the other hand, titratable acidity interacted negatively with total soluble sugars (TSS) and chlorophyll parameters (r < − 0.6). This suggests reduced acid metabolism in the fruit as maturity and pigment accumulation progress. The ripening index (RI) exhibits a moderately positive correlation with total soluble sugar and antioxidant traits. Subsequently, it indicates enhanced metabolic activity under prevalent PGR combinations. The correlation pattern showed that the combination of T₂ (25 ppm BAP + 50 ppm GA₃) had a more substantial synergistic effect on biochemical and physiological parameters than previously reported, with improved gene expression and enhanced chlorophyll content.

Fig. 15.

Pearson's correlation heatmap of correlation between morphological, physiological, biochemical, antioxidant and gene expression traits of broccoli (Brassica oleracea L. var. italica) under BAP and GA₃ treatments. Color scale is correlation coefficients between −1 (negative) and + 1 (positive); *—Significant correlation (p < 0.05). Abbreviations: SP, shoot length, PL: plant length, GR: plant growth regulator, RL: root length, SL: shoot length, FBW: fresh biomass weight, DBW: dry biomass weight, RSR: root to shoot ratio, SMR: shoot mass ratio, RMR: root mass ratio, SSL: specific shoot length, WC: water content, SVI-I: seedling vigor index I, SVI-II: seedling vigor index II, Chl a: Chlorophyll a, Chl b: Chlorophyll b, T Chl: total chlorophyll, TSS: total soluble solids, TA: titratable acidity, RI: ripening index, SOD: superoxide dismutase activity, CAT: catalase activity, POD: peroxidase activity, TPC: total phenolic content, TFC: total flavonoid content, DPPH: DPPH scavenging activity

Chord analysis

A chord diagram was performed to evaluate the multi-dimensional among the broccoli physiological, biochemical, and antioxidant traits on broccoli (Brassica oleracea L. var. italica) under different concentrations of BAP and GA₃ (Fig. 16). The diagram shows the degree of association and interdependence among measured parameters, with the thickness of each chord indicating the degree of association and the width of each segment indicating the degree of variability. The highest associations were observed with enzyme antioxidants SOD, POD, and CAT, suggesting that they are important parameters that maintain redox balance and reduce oxidative damage induced by hormonal treatments. The total phenolic content (TPC), total flavonoid content (TFC), radical scavenging activity (DPPH), and other non-enzymatic antioxidants also showed stronger correlations with chlorophyll pigments and biomass parameters, highlighting the importance of enhanced antioxidative defence in conjunction with metabolites. There were significant interactions for photosynthetic pigments (chlorophyll a, chlorophyll b, total chlorophyll) with total soluble sugar and survival indices (SVI-I and SVI-II). It indicates that physiological vigor is improved by applying optimum PGR treatment. In comparison, titratable acidity showed a weak and inverse relationship with other parameters. It suggests that organic acid metabolism decreases with advancing maturity, along with sugar accumulation. The findings of the chord analysis indicate that the integrated hormonal treatment T₂ (25 ppm BAP + 50 ppm GA₃) provided a balanced network of positive relationships among various traits in terms of morphology, biochemistry, and antioxidant capacity, which were responsible for the synergistic effect of PGRs in improving plant physiological and stress tolerance in broccoli.

Fig. 16.

A chord diagram showed the multivariate correlations of the growth, physiology, and vigour metrics of the broccoli seedlings under different treatments of BAP and GA₃. The thickness and density of the connecting bands show the strength and direction of the correlations. Abbreviations: All the abbreviations are defined above

Network analysis of trait interactions

A network plot was constructed to show the association between various morphological, biochemical, and antioxidant traits of broccoli (Brassica oleracea L. var. italica) under different BAP and GA₃ treatments (Fig. 17). The network model provides a means of visualizing correlation data in a node–edge format, where individual parameters are represented as nodes, and connecting edges signify the presence of significant correlation. A strong association was revealed among the growth traits, biochemical parameters. Such a strong association was noticed between the shoot length, root length, biomass accumulation, and chlorophyll pigments. These parameters were core for the network, displaying that they predominantly mediate the physiological response of broccoli to hormones supplementation. Besides, the antioxidant traits, namely superoxide dismutase (SOD), catalase (CAT), peroxidase acitvity (POD), total phenolic content (TPC), total flavonoid content (TFC), and radical scavenging activity (DPPH), showed a high co-association with the photosynthesis and vigor indices (SVI-I and SVI-II), confirming their universal role in oxidative balance and metabolic regulation in vitro. Interestingly, titratable acidity (TA) and shoot-to-mass ratio (SMR) were distantly located from the central network cluster as they were poorly or negatively correlated to most of the other parameters. These traits function independently or inversely versus growth and antioxidant pathways as suggested by this separation. The water content (WC) and seedling vigor indices had strong correlations with various antioxidant enzymes, indicating their role in maintaining the water regime and reducing cellular damage. Hence, a combination of BAP and GA₃ (T₂) was the best treatment. Further, this treatment causes improving morphological and physiological traits of walnut seedlings. these treatment improves the morphological and physiological traits of broccoli seedlings, enabling nursery growers to achieve the highest profits by producing high-quality seedlings.

Fig. 17.

Network representation depicting the relationships between growth and physiological, biochemical and antioxidant parameters in broccoli seedlings under various BAP and GA₃ treatments. Node size is used to represent relative importance and edge thickness, and colour is used to represent the strength and direction of correlation. Abbreviations: All the abbreviations are defined above

Principal Component Analysis (PCA)

Principal Component Analysis (PCA) was done to study the interplay among morphophysiological, biochemical and antioxidant character of Brassica oleracea L. var. italica with various BAP and GA₃ treatments (Fig. 18). The total variance was explained by the first two principal components (PC1 and PC2) accounting for 90.7% of the total variance (PC1 73.2% and PC2 17.5%). The biplot showed grouping patterns of the treatments. When an exogenous combination of hormones was used, the traits were distributed. The T2 treatment (25 ppm BAP + 50 ppm GA₃) scored on the positive pole of PC1 with strong correlations with most of the growth and antioxidant traits like chlorophyll pigments, total soluble sugar, SVI indices, and enzymatic activities (SOD, POD and CAT). The ability of the plant to perform and the coordination of metabolism of T₂ was markedly improved. On the other hand, the control (T₀) and higher-concentration treatments (T₃ and T₄), located at the negative end of PC1, were weakly or negatively correlated with the main physiological variables. Traits such as titratable acidity and shoot-to-mass ratio showed very high loadings in the negative direction, indicating an inverse relationship with plant growth and pro-oxidative potential. The water content of leaves (WC) and specific leaf length (SSL) showed a positive projection along the second principal coordinate (PC2), suggesting moderate to strong independent variances linked with tissue hydration and morphological parameters. The PCA suggested the different dimensionality involvement of BAP and GA₃ on the physiology of broccoli plants and the most suitable and efficient treatment was T₂ for higher growth vigour, photosynthetic capabilities and antioxidant potential.

Fig. 18.

Principal component analysis (PCA) biplot showing the relationships between treatments (T₀—T₄) and the measured growth, physiological, biochemical and antioxidant parameters. The results show that PC1 and PC2 account for the highest proportion of variance (73.2% and 17.5%, respectively). Vectors represent the contribution and direction of individual variables. Abbreviations: All the abbreviations are defined above

Discussion

This research paper has developed an effective and repeatable in vitro regeneration environment of Brassica oleracea L. var. italica in which exogenously applied the moderate level of cytokinin and high levels of gibberellin concentration (25 ppm BAP + 50 ppm GA₃) was most effective in improving the survival, growth, and biomass of seedlings. These results highlight the importance of hormonal balance in regulating morphogenesis, cell elongation, and biomass partitioning, supporting the basic principle that the cytokinin/gibberellin balance controls morphology in early seedlings of Brassica species.

The significant increase in survival under the betaprotective treatment (T₂) demonstrates that the interaction between BAP and GA₃ is synergistic during the heterotrophic stage of seedling growth. Gibberellins simulate endosperm weakening and activate α-amylase, facilitating metabolic preparedness to radicle protrusion [55]. At the same time, cytokinins like BAP induce cell cycle re-entry and nucleic acid metabolism of meristematic areas promoting early shoot meristem activation. The fact that the survival (47% vs. 23.5%) increased nearly twice (in control), therefore, indicates a hormonally regulated stimulation of root and shoot primordium. Similar synergies have been observed in Maize and Rice [56, 57], and it has been established that the moderate levels of cytokinin compensate the inhibitory effects of residual abscisic acid and promote rapid tissue differentiation induced by GA [58, 59].

The simultaneous increase in plant length and plant growth rate was seen during T₂ and this was a reflection of physiologically integrated response to the cell elongation by the GA₃ and meristem proliferation by the BAP. GA₃ provokes elongation, through the up-regulation of expansions and cell-wall-loosening enzymes, and BAP maintains the ability of mitotic activity and chloroplast biogenesis [60]. The 61.8% growth in length of the plants and 52 percent increase in the rate of growth compared to the control indicate the possibility of increased cell elongation and internode growth. High total biomass (63% higher fresh and > 120% higher dry weight) is an additional confirmation that the hormonal ratio maximized photosynthetic tissues development and assimilate deposition—a finding that agrees with [61], who have reported maximum dry-matter yield of tomato seeds with a similar cytokinin-to-gibberellin ratio.

Horticultural crop exhibited a coordinated physiological response to optimised hormonal balance as evidenced by the development of root and shoot biomass. Researcher [62] found that photosynthetic efficiency and carbohydrate partitioning at moderate concentrations of jasmonic acid and methyl jasmonate enhanced root and shoot fresh and dry weights in B. oleracea. Similarly, [63] found that in micropropagation of kale, the optimal concentration that enhanced shoot biomass was 2.5 mg L⁻¹ BAP, while higher concentrations suppressed growth, attributed to a hormonal imbalance. Environmental control also affects biomass distribution [64] in Chinese broccoli, where short-term mild stress from cooling roots (10 °C) maintained stability in root and shoot FW and DW, indicating adaptive efficiency. Collectively, these investigations support the concept that adjusting the ratios of cytokinin and gibberellin, moderate climatic conditions, and mild stress, stimulate positive integrated ratios of root and shoot biomass through enhanced coupling of cell division, cell elongation, assimilate deposition, and environmental factors. This observation corresponds to the positive biomass response reported in the broccoli in vitro culture in the present study.

Root to shoot ratio (RSR = 0.91 g/g in T₂) and mass-allocation indices (RMR = 0.48 g/g; SMR = 0.52 g/g) indicated even allocation of assimilates between the root and shoot tissue. This balance contrasts with the skewed shoot bias commonly caused by a high concentration of cytokinins, which may stifle the root morphogenesis through the auxin antagonism [65]. The established proportionality indicates that acceptable levels of BAP allowed sufficient cross-talking of auxin, which allowed the differentiation of the roots and the shoots regenration [66, 67]. This is necessary in transplantable micro-propagules that have stable autotrophic competence and has also been highlighted in genotype-specific regeneration of B. oleracea [68].

Despite slight reduction in water content with higher cytokinin contents, moderate treatments retained > 86% tissue hydration, so structural densification and not physiological desiccation explained decreased relative water percentage. GA₃ speeds up the vascular differentiation and the cuticular maturation, which makes the water transport more efficient and reduces the extraneous water [69, 70]. As a result, seedlings exhibited greater tissue integrity and dry-matter concentration an aspect which correlates with better acclimatization capability in micro-propagated Brassica seedlings [71].

The biochemical composition of the vegetative crop significantly improved due to the combined use of BAP and GA₃. appeared best under treatment T₂ within 25 ppm BAP + 50 ppm GA₃. The increased levels of chlorophyll a, b, and total chlorophyll in the leaves indicates the cytokinins and gibberellins are acting synergistically to delay the chlorophyll degradation by modulating the activity of chlorophyllase and pheophytinase, where the photosynthetic efficiency is not lost. Like post-harvest and in-vitro studies on Brassica rapa and Brassica oleracea [72], PGR helps stabilize chlorophyll and up regulate sugar metabolism. The increased total soluble solids and ripening index and decreased titratable acidity showed a faster rate of carbohydrate accumulation and metabolic turnover [73]. The effect of hormones affecting sugar metabolism and senescence has been widely observed in leafy vegetables [74]. In summary, the data showed cytokinin-gibberellin synergy. The cytokinin-gibberellin synergy in bromocryptine can be used to control the food supply to different groups of seed cells including both organs.

The substantial total phenolic content, total flavonoid content and DPPH radical-scavenging activity recorded on 25 ppm BAP + 50 ppm GA₃ (T₂) treatment shows strong hormonal influence on the synthesis of secondary metabolites in Brassica oleracea L. var. italica. The elevated TPC (17 mg GAE/g FW) suggests upregulation of the phenylpropanoid pathway. This mechanism has previously been reported in in vitro broccoli and other crucifers, in which PGRs enhance phenolic accumulation and antioxidant potential [75]. The increase in TFC and DPPH scavenging ability suggests improved redox homeostasis through enhanced synthesis of their flavonoid antioxidant. Flavonoid antioxidant critically detoxifies reactive oxygen species (ROS) [76]. Research on in vitro-cultivated broccoli tissues has observed similar phenolic enrichment and radical scavenging, suggesting that GA₃ and BAP treatments cause metabolic flux towards the biosynthesis of antioxidant compound [77]. T₂’s value of 67.67% DPPH Activity shows that the non-enzymatic defence of the cell is enhanced. Like the earlier evidence found that the phenolic and flavonoid is related to strengthening the efficiency of the inhibition of free-radical [78]. Consequently, teratogenesis was not observed in supplemented in vitro cultures of broccoli pentaploids with moderate cytokinin gibberellin synergy.

The hormonal control of gene expression in B. oleracea is supported by the significant increase in shoot number observed with the treatment T₂ (25 ppm BAP + 50 ppm GA₃). The increased expression of antioxidant-related genes (BoSOD1, BoAPX1 and BoCAT) under this treatment reflects a concerted cytokinin gibberellin response, in confirmed with the previous reports showing that exogenous cytokinins and gibberellins regulate growth and stress-associated transcriptional networks in Brassica species. The Cq values obtained and amplification curves are larger in T₂, indicating faster transcriptional activation of growth and antioxidant-related genes, consistent with Brassica species in which exogenous hormones alter GA-biosynthetic or signalling transcripts during development [79]. The assay specificity was confirmed by melt-curve analysis, consistent with validated cabbage (Brassica oleracea) qPCR protocols under abiotic stress [80]. Improved expression in T₂ may indicate better hormone interaction, which enhanced pigment, sugar, and antioxidant enzyme responses. This shows a coordinated molecular and physiological response to optimal cytokinin-gibberellin application.

Multivariate tests (correlation heatmap, chord, and network topologies) showed that plant growth rate (GR), fresh and dry biomass weight (FBW and DBW), and the vigor indices were major indicators of physiological traits. They have strong positive intercorrelations, which prove that morphological elongation was directly converted into biomass productivity. This is further supported by negative correlations between water content and dry-weight parameters that indicate the developmental shift in water-hydrated, soft tissues to metabolically active, lignified tissues. PCA evaluate that treatment T₂ along the major hormone explaining more than 70 of the variances, which validated it as the necessary for the overall performance of the seedlings. Such an integrative reaction is consistent with known PGR-mediated signal pathways in which gibberellins, cytokinins, and downstream transcriptional regulators (e.g., DELLA, ARR-B families) coordinate coordinated morphogenesis and metabolic investment in tissues in development [81].

This in-vitro system provides a high-quality, fast, and independent-of-season propagation pathway for top broccoli genotypes, compared to traditional seed propagation, which is limited to genetic segregation and flowering after 2 years. T₂ treatment is proven to be effective and reproducible with several growth, physiological, and molecular parameters suggesting its reliability for in vitro propagation applications. These results extend the physiological knowledge about Brassicaceae family and provide useful implications for improving plant growth regulators (PGR) in other difficult cruciferous and temperate vegetable crops under in vitro conditions.

Conclusion

This study assessed the effects of different concentrations of BAP and GA₃ on the growth, vigour, and biomass accumulation of broccoli seedlings in vitro. The combination of plant growth regulators altered several critical parameters, including survival percentage (SP), plant growth rate (GR), biomass weight (FBW: fresh biomass weight, DBW: dry biomass weight), and, most importantly, seedling vigour (SVI-I, SVI-II). Among the treatments, T₂ (25 ppm BAP + 50 ppm GA₃) was the most effective with broccoli seedlings have improved in plant length, increased vegetative development and increased biomass ratio. This indicates that BAP and GA₃ have a significant promoting effect on seedling growth in controlled environment. Seedlings treated with plat growth rate (T₂) showed not only the improvement in the morphology of shoots and roots but also the increase of Chlorophylls (a, b and T Chl: total chlorophyll), Total soluble solids (TSS) and enzymes (SOD: superoxide dismutase, CAT: catalase and POD: peroxidase), with the highest value registered at this concentration, and the decrease of Titratable Acidity (TA). RT-qPCR analysis was performed to find out if the seen increases in antioxidant metabolites were related with transcriptional regulation of key antioxidant genes. The increased expression levels of BoSOD1, BoAPX1 and BoCAT detected under treatment T₂ were consistent with the increased TPC, TFC and DPPH activity and could indicate that antioxidant enhancement occurred at biochemical and gene expression levels. Gene specific primers were designed from known GenBank sequences which allowed these transcriptional changes to be detected accurately. Together, these results showed that the enhanced antioxidant performance under T₂ is evidence of the regulation of biochemical processes at the molecular level driven by hormones. This research shows that broccoli and other similar vegetable species that exhibit low seedling vigour under controlled conditions require the development of effective, optimised protocols for various concentrations of plant growth regulator (PGR) required for broccoli in tissue culture.

Authors’ contributions

Conceptualization, original draft writing, reviewing, and editing: Tariq Aziz Khan, Muntaha Munir, Qasim Ali, Hussam F Najeeb Alwadi. Formal analysis, investigations, funding acquisition, reviewing, and editing: Abdul Wahid Shurooq, Jaafar halwas Hidahdah, Bilal Ahmad Khan, Hafiz Muhammad Zohaib,^{}Ikram Ullah. Resources, data validation, data curation, and supervision: Gehan M. Elossaily, Al-Djazouli Ouchar Mahamat, Adil Khan, Abdel-Rhman Z. Gaafar.

Funding

This work is financially supported by the Ongoing Research FundingProgram (ORF-2026-686), King Saud University, Riyadh, Saudi Arabia.

Data availability

All data generated or analyzed during this study are included in this published article.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.