Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 May 15.
Published in final edited form as: Infect Genet Evol. 2025 Jul 8;133:105795. doi: 10.1016/j.meegid.2025.105795

Plasmid diversity in Klebsiella pneumoniae ST307 co-producing KPC plus NDM recovered during the COVID-19 pandemic

Sonia Alejandra Gomez a,b, Florencia Martino a,b, María Belén Sanz a,b, Jenny Escalante c, Juan Manuel de Mendieta a, Celeste Lucero a, Paola Ceriana a, Fernando Pasteran a, Alejandra Corso a, María Soledad Ramirez c,*,1, Diego Faccone a,b,1
PMCID: PMC13175049  NIHMSID: NIHMS2170836  PMID: 40639556

Abstract

The prevalence of carbapenemase-producing Klebsiella pneumoniae increased significantly during COVID-19 in Argentina, rising from 20 % in 2019 to 30 % in 2021. Additionally, there was a notable increase of K. pneumoniae ST307 co-producing KPC and NDM. We aimed to reveal the genetic structure of the plasmids harbored in six isolates of K. pneumoniae ST307 co-producing KPC and NDM and to expression levels of both carbapenemases in a cell. The isolates were collected between November 2020 and September 2021 and were selected according to: (i) diversity of allelic variant combinations: blaKPC-2 plus blaNDM-1 (n = 2), blaKPC-2 plus blaNDM-5 (n = 2), blaKPC-3 plus blaNDM-1 (n = 2); (ii) different hospitals and jurisdictions; and (iii) differences in pulsotype by Xba-I-PFGE. The isolates were studied by whole genome sequencing (Illumina NextSeq 550 and with GridION) and with a transcriptional analysis using quantitative real time-PCR. The isolates carried between two and four plasmids with sizes from 3.7 to 250 Kb. Twenty plasmids with nine replicons were identified including three distinct hybrid replicon combinations. blaKPC-2 was found in three plasmid backbones [IncM1, IncFIB(pQil)/IncFII(K), and IncFIB/H1B] while the rest were associated with a single plasmid type: blaNDM-1 (IncC), blaNDM-5 (IncFIB/H1B) and blaKPC-3 (IncR). The basal expression level of KPC-2 was statistically higher than that of NDM-1/5. Our results show that the dissemination of NDM and KPC in K. pneumoniae ST307 was driven through diverse plasmids, highlighting the capacity of this high-risk clone to acquire, maintain and spread multiple carbapenemases.

Keywords: Klebsiella pneumoniae, ST307, KPC, NDM, Plasmid, AMR

1. Introduction

The rise and widespread dissemination of extreme or multi drug resistant carbapenemase producing Enterobacterales (CPE) has posed a significant epidemiological challenge to healthcare systems globally, jeopardizing the effectiveness of antimicrobial treatments (Patel et al., 2020). The broad dissemination of carbapenemases has been attributed mainly to the spread of successful antimicrobial resistant high risk clones and to the movement of antimicrobial resistance (AMR) genes among or between diverse clones (Peirano et al., 2020). AMR high risk clones are characterized by showing a broad geographical distribution, carrying several AMR determinants, persistence for long periods in the host, increased pathogenicity and fitness and for causing severe or recurrent infections (Peirano et al., 2020). Examples of these clones in the pre COVID-19 era were the Escherichia coli ST131 and Klebsiella pneumoniae Clonal Group (CG) 258 (e.g. ST11, ST258). In particular, K. pneumoniae is a relevant human pathogen recognized by the World Health Organization (WHO) and the US Centers for Disease Control and Prevention (CDC) as a priority pathogen due to the ability to acquire and spread antimicrobial resistance genes (Wyres et al., 2020).

Hospital-onset infections that are difficult to treat are often caused by AMR K. pneumoniae. This species is intrinsically resistant to penicillins and demonstrates a strong ability to acquire resistance to a wide range of antimicrobials. Despite its clinical significance, comprehensive knowledge about K. pneumoniae’s ecology, population structure, and pathogenicity remains limited, highlighting the need for further research in these areas (3). Over the past decade, K. pneumoniae has emerged as a major clinical and public health threat owing to increasing prevalence of healthcare-associated infections caused by multidrug-resistant strains producing extended-spectrum β-lactamases and/or carbapenemases (1). A parallel phenomenon of severe community-acquired infections caused by ‘hyper-virulent’ K. pneumoniae has also emerged, which are associated with the acquisition of additional virulence factors (4). These distinct clinical challenges combining resistance and virulence have stimulated renewed interest in K. pneumoniae research, with particular emphasis on leveraging genomics to better understand and address these issues.

Recently, there has been a notable increase in the prevalence of K. pneumoniae ST307, a trend that follows years of sporadic reports from various countries. This high-risk clone is now emerging as a critical concern in the global landscape of antimicrobial resistance (2, 4). Subsequently, multidrug-resistant (MDR) outbreaks have were reported in clinical settings, linked to genes like blaKPC-3, blaNDM-1, blaOXA-48, and blaCTX-M-15, alongside resistance to newer drugs such as ceftazidime/avibactam (Heiden et al., 2020). Furthermore, K. pneumoniae ST307 lineages have been found to carry additional resistance and virulence factors, integrative conjugative elements, and phages (2, 4). Previous studies showed that ST307 emerged around 1994 disseminating globally and consisted of two deep-branching lineages. One lineage contained the gyrA S83I and parC S80I mutations in the quinolone resistance determinant regions (QRDR) with a global distribution (Peirano et al., 2020). The other lineage contained an additional gyrA D87N mutation and was mainly described in United States (Peirano et al., 2020). In addition, genomic studies on early K. pneumoniae ST307 isolates showed that this clone was characterized by the acquisition of IncFIB-like plasmids encoding the extended spectrum beta-lactamase (ESBL) CTXM-15 that confers resistance to cephalosporins, and that probably aided in the global spread (Peirano et al., 2020).

In April 2021, the National and Regional Reference Laboratory in Antimicrobial Resistance (NRRLAR) in Argentina warned about the emergence and spread of Enterobacterales co-producing KPC plus NDM carbapenemases. This increase was dominated by carbapenem-resistant K. pneumoniae that grew from 20 % in 2019 to 30 % in prevalence in 2021 (Faccone et al., 2023). A similar behavior was observed in the Latin American and Caribbean region (Thomas et al., 2022). In a previous work, we described the phenotypical and molecular characterization of 82 CPE that co-produced multiple carbapenemases. Notably, nearly half of these isolates (49.4 %) were as K. pneumoniae ST307 carrying both blaKPC and blaNDM genes (Faccone et al., 2023).

Here, we aimed to investigate the molecular characteristics of the carbapenemase-carrying plasmids co-harbored in K. pneumoniae ST307 isolates. Additionally, we aimed to determine whether the success of ST307 in our country was driven by the spread of epidemic plasmids. To achieve this, we analyzed the complete plasmid sequences of six representative, and partially characterized, K. pneumoniae ST307 isolates co-producing KPC plus NDM carbapenemases. These isolates, detected during the COVID-19 pandemic, were distinct from one another in their combination of carbapenemase variants, hospital origins, jurisdictions, and pulsed-field gel-electrophoresis (PFGE) profiles.

2. Materials and methods

2.1. Bacterial isolates and carbapenemase confirmation

Six K. pneumoniae ST307 isolates were selected from an 82 CPE collection referred to the NRRLAR for molecular characterization between March 2020 and September 2021, as described in Faccone et al. (2023). Briefly, the six strains positive for blaKPC and blaNDM genes were selected considering i) allelic variant combinations of carbapenemases: blaKPC-2 plus blaNDM-1 (n = 2); blaKPC-2 plus blaNDM-5 (n = 2); and blaKPC-3 plus blaNDM-1 (n = 2), (ii) different hospitals/jurisdictions and (iii) different XbaI-PFGE-profiles (five different pulsotypes) (Table 1). The two isolates with identical PFGE patterns (pulsotype A) were selected because they harbored different blaNDM alleles, isolated in hospitals over 400 km away from each other, and were obtained six months apart. Finally, the isolates were recovered from different samples such as blood (n = 2), broncho-alveolar lavage (n = 1), tracheal aspirate (n = 1), catheter (n = 1), and screening (n = 1) samples from patients with or without comorbidities.

Table 1.

Epidemiological and molecular data of the isolates studied.

ID Species Htal. Code City Isolation Date Diagnosis / comorbidities Sample XbaI-PFGE MLST CBP combination
M27083 K. pneumoniae H23 SANTA FE Aug 6th 2020 NA Broncho alveolar lavage A 307 blaKPC-2 + blaNDM-1
M25821 K. pneumoniae H2 CABA Nov 10th 2020 COVID-19 pneumonia Catheter C 307 blaKPC-2 + blaNDM-1
M25910 K. pneumoniae H11 CABA Nov 17th 2020 NA Rectal swab AA 307 blaKPC-3 + blaNDM-1
M25979 K. pneumoniae H17 PBA Feb 5th 2021 VAP Tracheal aspirate A 307 blaKPC-2 + blaNDM-5
M25992 K. pneumoniae H1 CABA Feb 6th 2021 Catheter related infection / chronic renal failure Blood S 307 blaKPC-2 + blaNDM-5
M27284 K. pneumoniae H22 PBA Jun 11th 2021 MSSA bacteriemia Blood AH 307 blaKPC-3 + blaNDM-1
Open in a new tab

abbreviations: CABA, Buenos Aires City; PBA, Buenos Aires Province; CBP, carbapenemase; H, hospital; VAP, ventilator associated pneumonia, MSSA, methicillin susceptible Staphylococcus aureus, NA, not available

Susceptibility testing was performed with Sensititre TM (Thermo Scientific), following the instructions of the manufacturer. Results were interpreted according to CLSI 2024 M100 breakpoints. Tigecycline and colistin susceptibility were analyzed using the FDA and EUCAST breakpoints, respectively.

2.2. Plasmid profile by S1 nuclease-PFGE

Plasmid content and estimated sizes were determined by S1 endonuclease digestion of genomic DNA followed by pulsed-field gel electrophoresis (S1-PFGE). DNA fragments were resolved in 1 % agarose gel applying a switch time of 2.2 to 54.2 s during 20 h at 14 °C using a CHEF-DR® III System (Bio-RadTM, Hercules, CA, United States). Gel images were obtained with Gel Doc XR+ Molecular Imager (BioRad). The estimation of plasmid number and size was calculated with Image Lab™ Software, version 6.0 (BioRad).

2.3. Whole genome sequencing by Illumina and Oxford Nanopore technology and bioinformatic analysis

The six isolates were sequenced by short and long read sequencing at SeqCenter (Pittsburg, PA). Briefly, genomic DNA was extracted using the Wizard Promega kit (Promega, Madison, WI USA) according to manufacturer instructions. SeqCenter used NextSeq 550 Illumina technology (San Diego, CA, USA) for short read sequencing and R10.4.1 flowcells run on a GridION or PromethION platform for long read sequencing. Hybrid assemblies were done with Unicycler (v0.4.8-beta).

Annotation was done with Prokka v1.12 (Seemann, 2014), and manual curation of the automated annotation was done with Artemis (Carver et al., 2012). AMRfinderPlus, CARD and PlasmidFinder were used to identify resistance genes, chromosomic mutations and plasmid incompatibility groups, respectively. Mobile elements and blaNDM-1 immediate environment were analyzed manually in silico and with PATRIC v 3.6.3, BLASTn, and ISfinder. OriTFinder was used to determine OriT site, relaxase gene, gene encoding type IV coupling protein (T4CP), and gene cluster for bacterial type IV secretion system (T4SS). The Artemis Comparison Tool (ACT) was used for DNA sequence comparisons.

The genetic relationship between isolates was analyzed by calculating a pairwise single nucleotide polymorphism (SNP) distance matrix using Snippy, built from an alignment using snp-dists (version 0.6.3, https://github.com/tseemann/snp-dists). A maximum likelihood tree (ML) was constructed using RAxML (V8.2.11) under GTR model with gamma distribution to model site heterogeneity (GTRGAMMA), using 1000 bootstrap replicates. The average nucleotide identity between isolates was calculated with ANI calculator (https://www.ezbiocloud.net) (Yoon et al., 2017).

Gene copy number was estimated with the ccne program (Chen et al., 2022). This program uses rpoB housekeeping gene as reference to compare the count of reads that mapped to the antimicrobial resistance gene versus the count of reads that mapped with rpoB. Plasmid copy number (PCN) was obtained from the depth value estimated with Unicycler v0.5.1 assembler.

2.4. Transcriptional analysis using quantitative real time-PCR

Overnight cultures of strains were diluted 1:10 in LB broth and incubated with agitation at 200 rpm for 18 h at 37 °C. RNA was extracted from each sample using the Direct-zol RNA Kit (Zymo Research, Irvine, CA, USA) as indicated by the manufacturer. RNA extraction was not possible for M27284, possibly due to the mucous nature of this isolate. Total RNA extractions were performed using three independent biological replicates for each tested isolate. To ensure that there was no DNA contamination, a DNase treatment (Thermo Fisher Scientific, Walthman, MA, USA) and a subsequent gyrA and rpoB real time PCR were performed before transcription. The extracted DNase-treated RNA was used to synthesize cDNA using the manufacturer’s protocol provided with the iScriptTM Reverse Transcription Supermix for qPCR reagents (Bio-Rad, Hercules, CA, USA). The cDNA concentrations were adjusted to 50 ng/μL as determined by OD260 using a NanoDrop spectrophotometer (Thermo Scientific,Waltham, MA, USA), and 2 μL were used to conduct qPCR using the qPCRBIO SyGreen Blue Mix Lo-ROX following the manufacturer’s protocol (PCR Biosystems, Wayne, PA, USA). The transcriptional analysis of blaNDM1–5 and blaKPC2–3 was conducted using specific primers (NDM1–5 F: ACAAGATGGGCGGTATGGAC, R: AATGAGCTGCACAGTGGGAA, KPC2–3 F: ACTCGAAGAGGACTTTGGCG, R: GAAAGTCAGGCTGTGTTGCG). At least three independent cDNA replicates were tested using the CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Data are presented as NRQ (normalized relative quantities) calculated using the qBASE method (Hellemans et al., 2007), with gyrA and rpoB genes as normalizers. Differences were determined by ANOVA followed by Tukey’s multiple comparison test (P < 0.05) using GraphPad Prism (GraphPad software version 10.0.0, San Diego, CA, USA).

2.5. Nucleotide accession numbers

The sequences studied here were submitted to GenBank under the BioProject PRJNA1139777.

3. Results and discussion

3.1. Epidemiological and phenotypic characteristics of the isolates

To understand the nature of the carbapenemase-containing plasmids co-inhabiting K. pneumoniae ST307, six isolates, showing notable differences, were selected for genomic analysis based on the selection criteria outlined in the Materials and Methods section and detailed in Table 1.

Phenotypic analysis of the six isolates revealed non-susceptibility (intermediate + resistance) to all β-lactam antibiotics, aminoglycosides, fluoroquinolones and trimethoprim-sulfamethoxazole but susceptibility to fosfomycin (Supp. Table S1). Susceptibility to other tested drugs varied: three of the six isolates were susceptible to tigecycline and colistin, while two were susceptible to nitrofurantoin (Supp. Table S1). Notably, isolate M25821 demonstrated susceptibility to six drugs: fosfomycin, tigecycline, minocycline, nitrofurantoin, chloramphenicol and gentamicin (Supp. Table S1).

The SNP analysis among the six K. pneumoniae ST307 isolates ranged between 50 and 326 polymorphisms (Supp. Table S3), supporting the variability expected in the sample selection.

3.2. Resistance determinants of the isolates

The chromosome-encoded resistance mechanisms identified in the isolates are detailed in Supp. Table S2. All isolates exhibited the same mutations in the quinolone-resistance-determining regions of the gyrA (Ser83Ile) and parC (Ser80-Ile) genes (Supp. Table S2), which are distinctive of a particular lineage of global distribution already described by G. Peirano and cols. (Peirano et al., 2020). Moreover, this particular lineage was reported recently by colleagues in Argentina (González-Espinosa et al., 2024). Furthermore, the intrinsic K. pneumoniae β-lactamase blaSHV and fosA5 genes were present in all isolates, despite their observed susceptibility to fosfomycin. It is noteworthy that fosfomycin resistance typically occurs when there is high-level expression of fosA, which encodes a glutathione S-transferase, under the control of two promoters, P1 and P2 (Kieffer et al., 2020). Analysis of the upstream sequence of the fosA5 gene in the six ST307 isolates revealed the presence of the P1 promoter but not the P2 promoter. The absence of the P2 promoter likely explains the observed susceptibility to fosfomycin in these isolates.

In terms of polymyxin resistance, three isolates (M25910, M25821 and M27284) were resistant to colistin, however all six isolates exhibited the same mutations in PhoP (D191Y) and PhoQ (V24G) system (Supp. Table S2), while K. pneumoniae M25821 showed an additional mutation in MgrB (L24H). This mutation is known to confer colistin resistance by affecting the mgrB-encoded protein, which spans the inner membrane and negatively regulates PhoP phosphorylation, which is essential for bacterial outer membrane lipid biosynthesis (Yap et al., 2022). In addition, all six isolates harbored the intrinsic efflux pump OqxA/B, which can contribute to antimicrobial resistance.

The plasmid resistome displayed considerable diversity, as summarized in Table 2 and Supp. Table S3. Some plasmids, such as IncM1, carried only the carbapenemase gene, while others, like pM27083_179, carried between three and 13 additional resistance genes, including blaCMY-6 or blaCTX-M-15, the methylases rmtC or rmtB, the plasmid-mediated quinolone-resistance determinants qnrB1 or qnrS1, among others.

Table 2.

Plasmid features of K. pneumoniae ST307 clinical isolates containing KPC and NDM.

Strain ID Plasmid ID Plasmid Size Replicon type Acquired AMR genes Close Genetic Environment of NDM and KPC
M27083 pM27083_251 251,533 bp IncFIB / IncHI1B bla KPC-2 Tn4401a: ISKpn7-blaKPC-2-ISKpn6-ISKpn31
pM27083_189 189,402 bp IncFIB (K) / IncFII (K) blaCTX-M-15; blaTEM-1; blaOXA-1; dfrA14; aph (6)-Id; aph(3″)-Ib; aac(6′)-Ib-cr; aac(3)-IIe; qnrB1; sul2; ΔcatB3
pM27083_179 179,754 bp IncC blaNDM-1; blaOXA-9; blaTEM-1; aph(6)-Id; aph (3″)-Ib; aadA2; aac(6′)-Ib; aadA1; aac(6′)-IIa; dfrA1; dfrA46; sul1; sul2 ISAba125-blaNDM-1-ble-trpF-dsbD-cutA-groS-groL-ISKpn13
pM27083_7 7734 bp Col(pHAD28) None
M25821 pM25821_238 238,849 bp IncFIB (K) / IncFII (K) blaCTX-M-15; blaTEM-1; blaOXA-1; dfrA14; aph (6)-Id; aph(3″)-Ib; aac(6′)-Ib-cr; qnrB1; sul2; ΔcatB3
pM25821_168 168,553 bp IncC blaNDM-1; aac(6′)-Ib; sul1; sul2 ISKpn14-blaNDM-1-ble-trpF-dsbD-cutA-groS-groL-IS91-IR-IS4321L-rhs-IS110
pM25821_77 77,141 bp IncM1 bla KPC-2 NTE: ISKpn27-blaKPC-2-ISKpn6-like
M25910 pM25910_206 206,321 bp IncFIB / IncHI1B None
pM25910_154 154,458 bp IncC blaNDM-1; blaCMY-6; rmtC; aac(6′)-Ib3; sul1; sul2 rmtC-ISKpn14-blaNDM-1-ble-trpF-dsbD-cutA-groS-groL-insA/IS91-wapA
pM25910_80 80,613 bp IncR blaKPC-3; aac(3)-IVa; aph(4)-Ia; aadA1; aadA2; aac(6′)-Ib; cmlA1; sul3 Tn4401a: ISKpn7-blaKPC-2-ISKpn6
pM25910_3 3771 bp Col (pHAD28) None
M25979 pM25979_249 249,264 bp IncFIB /IncHI1B blaNDM-5;blaCTX-M-15; blaOXA-1; aac(6′)-Ib- cr; aac(3)-IIa; ΔcatB3; rmtB; aadA2; sul1; dfrA12; mph(A) IS26-rmtB-Na+/H+ antiporter-groL3-IS26-blaNDM-5-ble-trpF-dsbD3-hp-ISKpn18
pM25979_176 176,591 bp IncFIB (K) / IncFII (K) blaTEM-1; dfrA14; aph(3″)-Ib; aph(6)-Id; sul2; mph(A); aac(3)-IIa
pM25979_84 84,276 bp IncM1 bla KPC-2 NTE: ISKpn27-blaKPC-2-ISKpn6-like
M25992 pM25992_249 249,062 bp IncFIB/IncHI1B blaNDM-5; blaTEM-1; rmtB; aph(6)-Id; aadA2; aph(3″)-Ib; aac(3)-IIe; qnrS1; sul1; sul2; dfrA12; mph(A) IS26-Tn3 tnpA -IS26- ISkpn11 - tmrB - aac3-Vb - IS26 - groL2 - Na+/H+ antiporter-rmtB1 - blaTEM - Tn3 tnpR-tnpA-IS6-acr-MDR efflux pump-mphA-IS26- blaNDM-5-ble-trpF-dsbD3-IS91 tnpA -ISkpn18
pM25992_106 106,787 bp IncFIB (pQil) / IncFII (K) blaKPC-2; blaTEM-1; blaOXA-9-like* Tn4401a: ISKpn7-blaKPC-2-ISKpn6-ISKpn31
pM25992_3 3991 bp Col (pHAD28) None
M27284 pM27284_154 154,458 bp IncC blaNDM-1; blaCMY-6; rmtC; aac(6′)-Ib; sul1; sul2 rmtC-ISKpn14-blaNDM-1-ble-trpF-dsbD-cutA-groS-groL-insA/IS91 - wapA
pM27284_79 79,415 bp IncR blaKPC-3; aadA2; aph(4)-Ia; aadA1; aac(3)-IVa; sul3; aac(6′)-Ib, cmlA1 Tn4401a: ISKpn7-blaKPC-2-ISKpn6
pM27284_3 3771 bp Col (pHAD28) None
Open in a new tab
*

blaOXA-9-like has a premature stop codon mutation; NTE, non-Tn4401 element.

Five out of six isolates exhibited non-susceptibility to chloramphenicol (Suppl. Table S1). Notably, three resistant isolates -M27083, M25979 and M25821- carried a truncated catB3 gene due to the insertion sequence IS26. In two of these isolates, ΔcatB3 was situated on IncFIB(K)/IncFII(K) plasmids, pM27083_189 and pM25821_238, while in the third isolate, it was found on an IncFIB/IncHI1B plasmid, pM25979_249, as shown in Table 2. The catB3 gene encodes chloramphenicol acetyltransferase, which leads to drug inactivation (Puangseree et al., 2024). In two isolates, M25910 and M27284, chloramphenicol resistance was associated with the presence of the cmlA1 gene on the two IncR plasmids (Table 2). The cmlA1 gene encodes an inner membrane pump that actively effluxes chloramphenicol using the proton motive force (George and Hall, 2002). Furthermore, the elevated chloramphenicol MIC ≥16 μg/ml observed in the isolates M27083, M25979, and M25992, could be attributed to the expression of the K. pneumoniae intrinsic AcrAB-TolC multidrug efflux system (Lv et al., 2021).

The analysis of the aminoglycoside susceptibility profile showed that five isolates were resistant to amikacin and gentamicin, while one strain, M25821, showed resistance to amikacin and susceptibility to gentamicin (Table 2). These phenotypes could be explained first, because four strains harbored rmtB or rmtC genes, which confer high level resistance to both drugs. Second, although both M27083 and M25821 harbored several aminoglycoside-modifying enzymes, M25821 did not harbor any gene known to confer resistance to gentamicin (Table 2).

3.3. Plasmids characterization

Prior to sequencing, a plasmid profile analysis was conducted using S1-nuclease PFGE to estimate the number and size of plasmids in each strain (Supp. Fig. S1). The S1-PFGE gel showed that each isolate harbored between two and four plasmids of ca. 70 to 240 Kb. Of note, small plasmids below 30 Kb cannot be seen by S1-PFGE.

The hybrid assemblies rendered circular contigs for chromosome and plasmids sequences as described in Table 2 and Supp. Table S2. Briefly, three to four plasmids, ranging in size from 3771 bp to 251,533 bp, were detected in each isolate. These results correlated perfectly with those obtained in the preliminary plasmid profile with S1-PFGE regarding the number of bands and estimated size and, the number of circular sequences and molecular weight in each strain studied (Table 2 and Supp. Fig. S1).

The analysis of the plasmid content identified 20 circular plasmids represented by nine different replicon types (Table 2). Among these, five isolates harbored eight plasmids that had multiple replicon types namely, IncFIB(pQil)/IncFII(K), IncFIB(K)/IncFII(K) and IncHI1B/IncFIB, which are further described below. Plasmids that belonged to the replicon types IncC, IncR, and IncM displayed more conserved structures than the other groups in terms of the carbapenemase type and allele carried, as well as plasmid sequence coverage and percentage identity, as detailed below (Table 2 and Supp. Tables S4). Additionally, the isolates carried small Col plasmids of ca. 3 Kb that were present in M25821, M25910, M27284 and M25992 without resistance genes. Three of these small plasmids were nearly identical, ranging in size from 3771 to 3991 bp, while pM27083_7 in isolate M27083 was larger, measuring 7734 bp (Table 2).

Considering the plasmid diversity found, we further analyzed the phylogenetic tree of the ST307 isolates together with the plasmid replicon and carpabenemase content (Supp. Table S3). The results showed closely related isolates sharing some identical plasmids, but also closely related isolates that harbored different replicons and carbapenemase encoding genes, suggesting the promiscuous nature of this clone in terms of plasmid acquisition. This was also observed previously in an outbreak caused by ST307 producing NDM-1 and OXA-48 in Germany (Heiden et al., 2020). The authors also suggest the role of ST307 disseminating resistance plasmids to other K. pneumoniae STs and even to other bacterial species within the hospital.

3.4. IncC plasmids

The four IncC plasmids identified in the isolates all carried blaNDM-1. Two IncC1 plasmids, found in isolates M25910 and M27284, were identical between them in size and gene content (Table 2). These plasmids, pM25910_154 and pM27284_154, were 154,458 bp long, differing only by three SNPs: two nucleotide changes in hypothetical proteins and one S175N amino acid change in an IS4321 transposase (IS110 family). Considering their high similarity, only pM25910_154 plasmid sequence was used for further comparisons. The other two IncC plasmids, pM25821_168 and pM27083_179, differed in size, coverage and gene content between them and when compared against pM25910_154 plasmid, retaining high percentage of identity but less than 90 % of coverage (Table 2 and Supp. Tables S4). In particular, pM27083_179, the largest of the four, differed from the others in terms of resistance gene content, in the presence of four genes conferring resistance to aminoglycosides, aac(6′)-Ib, aac(6′)-IIa, aph(6)-Id and aph(3″)-Ib, and two allelic variants of dfrA, that confer resistance to trimethoprim (Table 2). In all four plasmids, the close environment of blaNDM-1 shared the typically conserved gene sequence blaNDM-1-ble-trpF-dsbD-cutA-groS-groL, and differed among them in the presence or absence of rmtC, ISKpn14 and IsAba125 upstream of blaNDM-1 (Table 2)(Martino et al., 2019).

In terms of horizontal transference or conjugation, these IncC plasmids contained the necessary predicted genes for self-transmission such as a predicted origin of transfer site (oriT), relaxase, type IV coupling protein (T4CP) and tra gene clusters that code for the bacterial type IV secretion system (T4SS), as reported previously for this particular replicon (Rozwandowicz et al., 2018).

The IncC plasmids reported here were compared by pairwise analysis with the blaNDM-1-IncC1 plasmids reported in 2014 in our country. The comparisons revealed high identity (>97 %) but variable coverage that ranged between 62 and 89 % (Suppl. Tables S4) (Martino et al., 2019). Notably, the plasmids reported in 2014 were isolated from a single patient infected and colonized by five distinct Enterobacterales species, all sharing the same IncC plasmids carrying blaNDM-1, blaCMY-6, rmtC, aac (6′)-Ib, and sul1 resistance genes. These findings, suggest that blaNDM-1-bearing IncC1 plasmids are actively circulating in our country, undergoing continuous evolution, and reflecting a well-established and active circulation of plasmids in our country, emphasizing their role in the spread of antimicrobial resistance (Martino et al., 2019).

3.5. IncM1 plasmids

Two isolates, M25979 and M25821, harbored the blaKPC-2 gene within IncM1 plasmids, specifically pM25979_84 and pM25821_77, with sizes of 84,276 bp and 77,141 pb, respectively. The distinctive characteristic of these plasmids was that blaKPC-2 was the only resistance gene detected. This gene was embedded in a Tn3-derived non-Tn4401 element (NTEKPC-I), which has been previously described in our country (De Belder et al., 2018). These IncM1 plasmids were predicted to be mobilizable or conjugative as they harbored a predicted oriT and relaxase, a type IV coupling protein and a cluster of tra genes. The two plasmids were almost identical (99 % nucleotide identity) between them. Of note, pM25979_84 additionally harbored a hypothetical protein followed by hin (DNA-invertase, UniProt P03013) and xerC_6 genes. Both plasmids contained a mer operon (merR, merT and merP), as well as several mobile genetic elements, including two Tn3 transposons, two ISApu insertion sequences, ISKox3, xerD and the sequence hin-TnAs2-IS4321. The closest related plasmid detected in the database was plP69 obtained from an E. coli BM21 (MN626603.1), which shared 79 % of coverage with 99.98 % of nucleotide identity (Supp. Tables S4).

3.6. IncR plasmids

The two IncR plasmids, pM27284_79 and pM25910_80, carried the blaKPC-3 gene, a relatively uncommon blaKPC allele in Argentina, embedded within the Tn4401a element. These plasmids were nearly identical and shared approximately 40 % coverage with 100 % sequence identity with KPC-2-bearing plasmid (CP020110.1) detected in a K. pneumoniae ST258 recovered during an outbreak in Ecuador, as shown in Supplementary Tables S4. Additional resistance genes present in these plasmids can be found in Table 2. These IncR plasmids had a predicted oriT site but absence of tra operons and a predicted relaxase and T4CP genes. As a consequence, these plasmids were predicted to be non-mobilizable, as previously reported (Rozwandowicz et al., 2018).

3.7. IncF plasmids

3.7.1. Hybrid IncFIB (pQil) / IncFII (K) plasmid

K. pneumoniae M25992 harbored an IncFIB(pQil)/IncFII(K) hybrid plasmid, named pM25992_106. This plasmid contained three resistance genes, blaKPC-2 in a Tn4401a element, blaOXA-9-like, and blaTEM-1 β-lactamases (Table 2). The blaOXA-9-like gene had a mutation that generated a premature stop codon, yielding a 111 amino acid polypeptide. In addition, pM25992_106 contained several mobile elements, including insertion sequences such as IS26, Tn3 and Tn5403 transposons, and a xerC tyrosine recombinase-coding gene. The closest plasmid found in the GenBank database to pM25992_106 was pC265_2 (CP067868), a blaKPC-2-containing plasmid that shared 84 % coverage and 99.95 % nucleotide identity (Suppl. Fig. S4). The pC265_2 plasmid was recovered from a clinical isolate of K. pneumoniae CG258 in Houston, USA, in 2016 (Shropshire et al., 2022). This IncFIB(pQil)/IncFII(K) plasmid was predicted to be mobilizable or conjugative, since it harbored a MOB region, oriT and relaxase, T4CP and T4SS genes.

3.7.2. Hybrid IncHI1B/IncFIB

Four isolates harbored a plasmid with two replicons IncHI1B and IncFIB, as detailed in Table 2. The isolates M25992 and M25979, harbored blaNDM-5 in plasmids of similar size, pM25992_249 (249,062 bp) and pM25979_249 (249,264 bp), respectively. The isolate M27083 harbored the plasmid pM27083_251, with blaKPC-2 as the only resistance gene, located within the Tn4401a transposon. Interestingly, M25910 harbored another plasmid, pM25910_206, with no resistance genes at all.

The two blaNDM-5–containing plasmids, pM25992_249 and pM25979_249, shared 96 % coverage and 100 % identity, suggesting a potential common origin (Supp. Fig. S3). These plasmids carried six and seven complete copies of IS26, respectively, known to mobilize fragments of DNA flanked by this insertion sequence, and resulting the formation of IS26-bounded resistance gene cluster or MDR region (He et al., 2016). In particular, the immediate environment upstream blaNDM-5 in pM25992_249 and pM25979_249 have a truncated ISaba125 followed by an IS26 upstream (Table 2). Downstream, blaNDM-5 showed the typical gene order ble-trpF-dsbD3 in both plasmids. The same close environment of blaNDM-5 with IS26 has been reported previously (Li et al., 2022). In addition, these isolates also coded for an rRNA methyltransferases, rmtB, in the close environment of blaNDM-5.

When comparing the three carbapenemase-containing plasmids against pM25910_206 (the plasmid mentioned with no AMR genes), they shared >93 % of coverage and > 98 % identity, differing only in the resistance gene region (Fig. 1). The fragment containing blaNDN-5 gene in pM25979_249 and blaKPC-2 gene in pM27083_251, were inserted at same position (105,796 bp) in pM25910_206, resulting in the truncation of a lipopolysaccharide kinase gene, which was complete in pM25910_206.

Fig. 1.

Fig. 1.

Open in a new tab

IncHI1B/IncFIB-like plasmid comparison using ACT tool. A. Comparison of the complete IncHI1B/IncFIB-like plasmid sequences. Plasmid order (up to down): pM25979_249 (blaNDM-5); pM25992_249 (blaNDM-5); pM25910_206 (no AMR gene); and pM27083_251 (blaKPC-2). B. Zoom of the recombination region showing the truncation of the lipopolysaccharide kinase lnaA family gene (light pink arrow) by carbapenemase containing regions. Red blocks indicate similar DNA regions (>95 % identity). Blue blocks link regions that are inverted with respect to each other (>95 % identity).

Of note, the sequence of isolate recovery began with M27083 (pM27083_251 harboring blaKPC-2 gene) in August-2020 in Santa Fe Province. This was followed by M25910 (pM25910_206 without AMR genes) in November 2020 in Buenos Aires City (CABA), and then in February-2021 both M25979 and M25992 NDM-5-harboring isolates were isolated in CABA and Buenos Aires Province. These findings suggest the ongoing circulation of IncHI1B/IncFIB plasmids and highlight their active evolution, characterized by the acquisition and loss of key antimicrobial resistance genes.

A BLAST comparison of the four plasmids, showed high coverage and identity with pNDMMAR (229 Kb; CP064821; unpublished) (Suppl. Tables S4) and the well-characterized pNDM-MAR (267 Kb, JN420336) plasmids (Villa et al., 2012). The plasmid pNDM-MAR, an IncHI1B/IncFIB reference plasmid, harbored several antimicrobial resistance genes, like blaNDM-1 and blaCTX-M-15 β-lactamases, and qnrB1 among others. pNDM-MAR is a multi-replicon plasmid showing a principal replication gene repHI1B and an auxiliary repB IncFIB–6.1 (Alonso et al., 2002; Fan et al., 2022; Villa et al., 2012).

3.7.3. Hybrid IncFIB (K) / IncFII (K) plasmids

Three isolates harbored IncFIB(K)/IncFII(K) hybrid plasmids, none of these containing carbapenemase-coding genes. Two plasmids, pM27083_189 and pM25821_238, harbored the ESBL blaCTX-M-15, among other antimicrobial resistance genes (Table 2). These plasmids shared >74 % of coverage and > 99.9 % of identity among them (Suppl. Tables S4). The isolate M25979 harbored the plasmid pM25979_176, containing seven antimicrobial resistance genes, including blaTEM-1 and mph(A) (Table 2). These plasmids were predicted to be non-mobilizable due to the absence of an oriT.

Beyond the increasing number of hybrid plasmids described, IncFII (K) replicons are often associated with other replicons, being the most frequent association with FIB replicons (Bi et al., 2018). The IncFII(K) plasmids are mostly reported in K. pneumoniae clinical isolates, suggesting a key role in the dissemination of antimicrobial resistance genes in the hospital environment, including ESBLs like blaCTX-M-15, and carbapenemases, mainly blaKPC-2 (Bi et al., 2018).

3.8. Differential expression of NDM-1/5 and KPC-2/3

Given that these isolates co-produce both a serine carbapenemase (KPC) and a metallo-carbapenemase (NDM), we assessed the basal expression levels of blaNDM-1, blaNDM-5, blaKPC-2 and blaKPC-3. The results obtained showed a statistically higher level of expression of KPC-2 vs NDM-1/5 in four isolates, with expression levels ranging from 2- to 4-fold higher (Fig. 2). No statistical difference was seen in the expression levels of NDM-1 and KPC-3 in isolate M25910 (1 ± 0.155 vs 0.9 ± 0.1). Of note, the transcription level of KPC-2 in the isolate M25979, showed a very high expression level (>300 fold, p < 0.0001) compared with the expression level of NDM-5 (14.9 ± 1.6 vs 0.05 ± 0.009). This disparity in enzyme expression levels could have implications for the phenotypic resistance profile and the dominance of one carbapenemase over the other in contributing to resistance. The phenotypic impact of a higher expression of KPC above NDM is difficult to determine, as both enzymes share the same antimicrobial substrate, with the exception of aztreonam. In this study, all six isolates studied demonstrated simultaneous positive synergy tests between imipenem and EDTA discs that confirmed the expression of the metallo-enzyme (e.g. NDM), and between imipenem and phenyl-boronic acid discs, that indicated the presence of KPC. These results show that both mechanisms were expressed and were phenotypically detected.

Fig. 2.

Fig. 2.

Open in a new tab

qRT-PCR of blaNDM1–5 and blaKPC2–3 of Klebsiella pneumoniae strains. For qRT-PCR assays three independent samples were used. The data are the mean ± SD of normalized relative quantities (NQR) obtained from transcript levels. Statistical significance (P < 0.05) was determined by two-way ANOVA followed by Tukey’s multiple-comparison test, one asterisks: P < 0.05; two asterisks: P < 0.01, and three asterisks: P < 0.001.

Furthermore, we analyzed the correlation between KPC and NDM estimated gene copy number and the carbapenemase-containing plasmid copy number (Suppl. Table S5). Notably, gene copy number and carbapenemase-plasmid copy number were similar, contrasting with the uneven predominance of KPC-2 expression level versus NDM-1/5 (Fig. 2).

More studies are required to determine whether the differential expression level of these enzymes could have an impact on the infection outcome or affect treatment efficacy. Moreover, it is not yet known whether the expression level of KPC and NDM is additionally influenced or modulated by the ST307 clone itself. Understanding this interplay could provide valuable insights into optimizing therapeutic strategies for infections caused by these co-carbapenemase-producing isolates. In addition, the differential expression levels in other dominant clones that produce KPC and NDM should also be analyzed for comparison.

The in silico analysis of the promoters of NDM-5 in M25979 and M25992 showed a complete promoter composed of the ribosome binding site, +1, −10 and −35 sites. Consequently, these observations suggest that the structure of the promotor should not be affecting the level of expression of NDM-5. Moreover, no blaNDM-1 promoter regions were found altered or mutated. In turn, the promoter region of blaKPC genes were conserved, with P1, P2 and P3 promoters in Tn4401a, but only P1 in NTEKPC-I, as previously described (De Belder et al., 2018). These findings alone are insufficient to fully explain the varying expression patterns of expression in each isolate. Carbapenem MIC values obtained by Sensititre TM are restricted to defined ranges (Supplementary Table S1), therefore, the evaluation of the impact of the differential expression levels was limited (MIC range in Sensititre TM: meropenem 0.5- ≥ 16 μg/ml, imipenem 0.5- ≥ 8 μg/ml). Previous studies have analyzed the expression levels of KPC and NDM in terms of selective pressure, gene copy number, plasmid copy number, promotor composition and MIC levels (Chen et al., 2022; Rodríguez-Beltrán et al., 2021; Roth et al., 2011). However, to the best of our knowledge, these factors have not yet been investigated in isolates producing both carbapenemases simultaneously. Further studies are essential to identify additional variables that may influence the differential expression of two carbapenemases and their potential impact on antimicrobial resistance and clinical outcomes.

4. Conclusions

In recent years, carbapenemase-producing K. pneumoniae ST307 high-risk clone has increasingly established itself in Argentina, demonstrating a concerning ability to harbor two types of carbapenemases (Faccone et al., 2023; González-Espinosa et al., 2024). The observed diversity of carbapenemase-bearing plasmids in these isolates highlights the adaptability of ST307, positioning it as a potential dominant clone capable of acquiring and disseminating a wide variety of epidemic and non-epidemic plasmids. As an example, four of six isolates harbored the well-conserved broad-host-range plasmid IncC with blaNDM-1. In turn, five isolates harbored one or two narrow-host-range epidemic plasmid IncF with hybrid replicons (IncHI3B/IncFIB-like, IncFIB(K)/IncFII(K), IncHI3B/IncFIB-like, IncFIB (pQil)/IncFII(K)) and diverse enzymatic content. This trait is particularly notable when contrasted with K. pneumoniae ST258 high-risk clone, which was primarily responsible for the widespread dissemination of KPC in Argentina (Gomez et al., 2011); ST258 typically disseminates KPC in a strict association with a specific plasmid (pKpQIL) that carries blaKPC gene within the Tn4401 transposon (Papagiannitsis et al., 2016).

The advantages of harboring two distinct carbapenemases within a single bacterial cell remain unclear. Some researchers propose that the carbapenemase plasmids may enhance fitness by providing alternative metabolic pathways that improve survival when competing against the native microbiome (Muñoz-Cazalla et al., 2024). Others propose that positive epistasis between co-infecting plasmids reduces the cost of plasmid carriage, thereby improving plasmid stability (San Millan et al., 2014). Regardless of the underlying mechanisms involved, the establishment and dissemination of serin- plus metallo-carbapenemase-producing K. pneumoniae ST307 significantly restrict treatment options, presenting a major challenge for the clinical settings.

The main limitation of our study is the reduced number of isolates analyzed. In this sense, our previous work had shown the raise and success of ST307 disseminating KPC and NDM in Argentina. Thus, we aimed to reveal what were the carbapenemase plasmids co harbored in ST307 and their molecular characteristics. The careful selection of the strains based on the preliminary phenotypic, epidemiological y and molecular data, made it possible to show the broad overview and great diversity of the carbapenemase-harboring plasmids.

In summary, this research adds knowledge to the understanding of the mechanisms underlying the emergence and dissemination of carbapenemases co-harbored in the K. pneumoniae high-risk clone ST307. Our findings emphasize the need for continuous surveillance as well as the promotion of containment and mitigation strategies to prevent its endemic potential.

Supplementary Material

1
2
3

Acknowledgements

We would like to thank Stella Cristaldo for her valuable technical support.

Funding

The authors’ work was supported by NIH SC3GM125556 to MSR, and by the National Agency for the Promotion of Research, Technological Development and Innovation (ANPCyT), PICT-2021-00115 to SAG and by the annual budget assigned by the Ministry of Health to Servicio Antimicrobianos (NRRLAR). The content is solely the authors’ responsibility and does not necessarily represent the official views of the National Institutes of Health or the Department of Veterans.

Declaration of competing interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

MARIA SOLEDAD RAMIREZ reports financial support was provided by National Institutes of Health. Sonia Alejandra Gomez reports financial support was provided by National Agency for the Promotion of Research Technological Development and Innovation. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.meegid.2025.105795.

Footnotes

CRediT authorship contribution statement

Sonia Alejandra Gomez: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Florencia Martino: Writing – review & editing, Visualization, Validation, Software, Methodology, Investigation, Formal analysis, Data curation. María Belén Sanz: Writing – review & editing, Visualization, Software, Methodology, Investigation, Formal analysis, Data curation. Jenny Escalante: Visualization, Software, Methodology, Investigation, Formal analysis, Data curation. Juan Manuel de Mendieta: Writing – review & editing, Visualization, Validation, Software, Methodology, Investigation, Formal analysis. Celeste Lucero: Writing – review & editing, Visualization, Validation, Methodology, Investigation, Formal analysis. Paola Ceriana: Writing – review & editing, Visualization, Methodology, Investigation, Formal analysis. Fernando Pasteran: Writing – review & editing, Visualization, Validation, Supervision, Resources, Data curation, Conceptualization. Alejandra Corso: Writing – review & editing, Validation, Supervision, Resources, Investigation, Formal analysis, Data curation, Conceptualization. María Soledad Ramirez: Writing – review & editing, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Funding acquisition, Formal analysis, Conceptualization. Diego Faccone: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Software, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Data availability

I have shared the link to the data files in the main text

References

  1. Alonso G, Vílchez G, Bruzual I, Rodríguez-Lemoine V, 2002. Characterization of plasmid MIP233 (IncHI3) of the H complex. Res. Microbiol 153, 149–153. 10.1016/s0923-2508(02)01300-1. [DOI] [PubMed] [Google Scholar]
  2. Bi D, Zheng J, Li J-J, Sheng Z-K, Zhu X, Ou H-Y, Li Q, Wei Q, 2018. In silico typing and comparative genomic analysis of IncFIIK plasmids and insights into the evolution of replicons, plasmid backbones, and resistance determinant profiles. Antimicrob. Agents Chemother 62, e00764–18. 10.1128/AAC.00764-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Carver T, Harris SR, Berriman M, Parkhill J, McQuillan JA, 2012. Artemis: an integrated platform for visualization and analysis of high-throughput sequence-based experimental data. Bioinforma. Oxf. Engl 28, 464–469. 10.1093/bioinformatics/btr703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen H, Li N, Wang F, Wang L, Liang W, 2022. Carbapenem antibiotic stress increases blaKPC −2 gene relative copy number and bacterial resistance levels of Klebsiella pneumoniae. J. Clin. Lab. Anal 36, e24519. 10.1002/jcla.24519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. De Belder D, Lucero C, Rapoport M, Rosato A, Faccone D, Petroni A, Pasteran F, Albornoz E, Corso A, Gomez SA, 2018. Genetic diversity of KPC-producing Escherichia coli, Klebsiella oxytoca, Serratia marcescens, and Citrobacter freundii isolates from Argentina. Microb. Drug Resist. Larchmt. N 24, 958–965. 10.1089/mdr.2017.0213. [DOI] [PubMed] [Google Scholar]
  6. Faccone D, Gomez SA, de Mendieta JM, Sanz MB, Echegorry M, Albornoz E, Lucero C, Ceriana P, Menocal A, Martino F, De Belder D, Carbapenemase Working Group, Corso A, Pasterán F, 2023. Emergence of hyper-epidemic clones of enterobacterales clinical isolates co-producing KPC and metallo-beta-lactamases during the COVID-19 pandemic. Pathog. Basel Switz 12, 479. 10.3390/pathogens12030479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fan L-P, Yu Y, Huang S, Liao W, Huang Q-S, Du F-L, Xiang T-X, Wei DD, Wan L-G, Zhang W, Liu Y, 2022. Genetic characterization and passage instability of a novel hybrid virulence plasmid in a ST23 hypervirulent Klebsiella pneumoniae. Front. Cell. Infect. Microbiol 12, 870779. 10.3389/fcimb.2022.870779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. George AM, Hall RM, 2002. Efflux of chloramphenicol by the CmlA1 protein. FEMS Microbiol. Lett 209, 209–213. 10.1111/j.1574-6968.2002.tb11133.x. [DOI] [PubMed] [Google Scholar]
  9. Gomez SA, Pasteran FG, Faccone D, Tijet N, Rapoport M, Lucero C, Lastovetska O, Albornoz E, Galas M, KPC Group, Melano RG, Corso A, Petroni A, 2011. Clonal dissemination of Klebsiella pneumoniae ST258 harbouring KPC-2 in Argentina. Clin. Microbiol. Infect 17, 1520–1524. 10.1111/j.1469-0691.2011.03600.x. [DOI] [PubMed] [Google Scholar]
  10. González-Espinosa F, Di Pilato V, Magariños F, Di Conza J, Rossolini GM, Gutkind G, Radice M, Cejas D, 2024. Genomic characterization of carbapenemase-producing Klebsiella pneumoniae ST307 revealed multiple introductions in Buenos Aires, Argentina. J. Glob. Antimicrob. Resist 37, 176–178. 10.1016/j.jgar.2024.03.017. [DOI] [PubMed] [Google Scholar]
  11. He S, Chandler M, Varani AM, Hickman AB, Dekker JP, Dyda F, 2016. Mechanisms of evolution in high-consequence drug resistance plasmids. mBio 7, e01987–16. 10.1128/mBio.01987-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Heiden SE, Hübner N-O, Bohnert JA, Heidecke C-D, Kramer A, Balau V, Gierer W, Schaefer S, Eckmanns T, Gatermann S, Eger E, Guenther S, Becker K, Schaufler K, 2020. A Klebsiella pneumoniae ST307 outbreak clone from Germany demonstrates features of extensive drug resistance, hypermucoviscosity, and enhanced iron acquisition. Genome Med. 12, 113. 10.1186/s13073-020-00814-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J, 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 8, R19. 10.1186/gb-2007-8-2-r19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kieffer N, Poirel L, Mueller L, Mancini S, Nordmann P, 2020. ISEcp1-mediated transposition leads to fosfomycin and broad-spectrum cephalosporin resistance in Klebsiella pneumoniae. Antimicrob. Agents Chemother 64, e00150–20. 10.1128/AAC.00150-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li Y, Zhang R, Wang S, 2022. A natural novel mutation in the blaNDM-5 promoter reducing carbapenems resistance in a clinical Escherichia coli strain. Microbiol. Spectr 10, e0118321. 10.1128/spectrum.01183-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lv F, Cai J, He Q, Wang W, Luo Y, Wang X, Mi N, Zhao Z, Li G, Luo W, 2021. Overexpression of efflux pumps mediate pan resistance of Klebsiella pneumoniae sequence type 11. Microb. Drug Resist 27, 1405–1411. 10.1089/mdr.2020.0395. [DOI] [PubMed] [Google Scholar]
  17. Martino F, Tijet N, Melano R, Petroni A, Heinz E, De Belder D, Faccone D, Rapoport M, Biondi E, Rodrigo V, Vazquez M, Pasteran F, Thomson NR, Corso A, Gomez SA, 2019. Isolation of five Enterobacteriaceae species harbouring blaNDM-1 and mcr-1 plasmids from a single paediatric patient. PloS One 14, e0221960. 10.1371/journal.pone.0221960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Muñoz-Cazalla A, de Quinto I, Álvaro-Llorente L, Rodríguez-Beltrán J, Herencias C, 2024. The role of bacterial metabolism in human gut colonization. Int. Microbiol 10.1007/s10123-024-00550-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Papagiannitsis CC, Di Pilato V, Giani T, Giakkoupi P, Riccobono E, Landini G, Miriagou V, Vatopoulos AC, Rossolini GM, 2016. Characterization of KPC-encoding plasmids from two endemic settings, Greece and Italy. J. Antimicrob. Chemother 71, 2824–2830. 10.1093/jac/dkw227. [DOI] [PubMed] [Google Scholar]
  20. Patel B, Hopkins KL, Freeman R, Pople D, Brown CS, Robotham JV, 2020. Carbapenemase-producing Enterobacterales: a challenge for healthcare now and for the next decade. Infect. Prev. Pract 2, 100089. 10.1016/j.infpip.2020.100089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Peirano G, Chen L, Kreiswirth BN, Pitout JDD, 2020. Emerging antimicrobial-resistant high-risk Klebsiella pneumoniae clones ST307 and ST147. Antimicrob. Agents Chemother 64, e01148–20. 10.1128/AAC.01148-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Puangseree J, Prathan R, Srisanga S, Chuanchuen R, 2024. Molecular basis of the persistence of chloramphenicol resistance among Escherichia coli and Salmonella spp. from pigs, pork and humans in Thailand. PloS One 19, e0304250. 10.1371/journal.pone.0304250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Rodríguez-Beltrán J, DelaFuente J, León-Sampedro R, MacLean RC, San Millán Á, 2021. Beyond horizontal gene transfer: the role of plasmids in bacterial evolution. Nat. Rev. Microbiol 19, 347–359. 10.1038/s41579-020-00497-1. [DOI] [PubMed] [Google Scholar]
  24. Roth AL, Kurpiel PM, Lister PD, Hanson ND, 2011. Bla(KPC) RNA expression correlates with two transcriptional start sites but not always with gene copy number in four genera of Gram-negative pathogens. Antimicrob. Agents Chemother 55, 3936–3938. 10.1128/AAC.01509-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rozwandowicz M, Brouwer MSM, Fischer J, Wagenaar JA, Gonzalez-Zorn B, Guerra B, Mevius DJ, Hordijk J, 2018. Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae. J. Antimicrob. Chemother 73, 1121–1137. 10.1093/jac/dkx488. [DOI] [PubMed] [Google Scholar]
  26. San Millan A, Heilbron K, MacLean RC, 2014. Positive epistasis between co-infecting plasmids promotes plasmid survival in bacterial populations. ISME J. 8, 601–612. 10.1038/ismej.2013.182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Seemann T, 2014. Prokka: rapid prokaryotic genome annotation. Bioinforma. Oxf. Engl 30, 2068–2069. 10.1093/bioinformatics/btu153. [DOI] [PubMed] [Google Scholar]
  28. Shropshire WC, Dinh AQ, Earley M, Komarow L, Panesso D, Rydell K, Gómez-Villegas SI, Miao H, Hill C, Chen L, Patel R, Fries BC, Abbo L, Cober E, Revolinski S, Luterbach CL, Chambers H, Fowler VG, Bonomo RA, Shelburne SA, Kreiswirth BN, van Duin D, Hanson BM, Arias CA, 2022. Accessory genomes drive independent spread of Carbapenem-resistant Klebsiella pneumoniae clonal groups 258 and 307 in Houston, TX. mBio 13, e0049722. 10.1128/mbio.00497-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Thomas GR, Corso A, Pasterán F, Shal J, Sosa A, Pillonetto M, de Souza Peral RT, Hormazábal JC, Araya P, Saavedra SY, Ovalle MV, Jiménez Pearson MA, Chacón GC, Carbon E, Mazariegos Herrera CJ, del Velásquez SCG, Satan-Salazar C, Villavicencio F, Touchet NM, Busignani S, Mayta-Barrios M, Ramírez-Illescas J, Vega ML, Mogdasy C, Rosas V, Salgado N, Quiroz R, El-Omeiri N, Galas MF, Ramón-Pardo P, Melano RG, 2022. Increased detection of Carbapenemase-producing Enterobacterales bacteria in Latin America and the Caribbean during the COVID-19 pandemic. Emerg. Infect. Dis 28, e220415. 10.3201/eid2811.220415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Villa L, Poirel L, Nordmann P, Carta C, Carattoli A, 2012. Complete sequencing of an IncH plasmid carrying the blaNDM-1, blaCTX-M-15 and qnrB1 genes. J. Antimicrob. Chemother 67, 1645–1650. 10.1093/jac/dks114. [DOI] [PubMed] [Google Scholar]
  31. Wyres KL, Lam MMC, Holt KE, 2020. Population genomics of Klebsiella pneumoniae. Nat. Rev. Microbiol 18, 344–359. 10.1038/s41579-019-0315-1. [DOI] [PubMed] [Google Scholar]
  32. Yap PS-X, Cheng W-H, Chang S-K, Lim S-HE, Lai K-S, 2022. MgrB mutations and altered cell permeability in colistin resistance in Klebsiella pneumoniae. Cells 11, 2995. 10.3390/cells11192995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yoon S-H, Ha S-M, Lim J, Kwon S, Chun J, 2017. A large-scale evaluation of algorithms to calculate average nucleotide identity. Antonie Van Leeuwenhoek 110, 1281–1286. 10.1007/s10482-017-0844-4. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS2170836-supplement-1.pptx (703.9KB, pptx)
2
NIHMS2170836-supplement-2.xlsx (34.2KB, xlsx)
3
NIHMS2170836-supplement-3.docx (11.5KB, docx)

Data Availability Statement

I have shared the link to the data files in the main text

RESOURCES