Genetic Transplantation: Salmonella enterica Serovar Typhimurium as a Host To Study Sigma Factor and Anti-Sigma Factor Interactions in Genetically Intractable Systems

Abstract

In Salmonella enterica serovar Typhimurium, σ²⁸ and anti-sigma factor FlgM are regulatory proteins crucial for flagellar biogenesis and motility. In this study, we used S. enterica serovar Typhimurium as an in vivo heterologous system to study σ²⁸ and anti-σ²⁸ interactions in organisms where genetic manipulation poses a significant challenge due to special growth requirements. The chromosomal copy of the S. enterica serovar Typhimurium σ²⁸ structural gene fliA was exchanged with homologs of Aquifex aeolicus (an extreme thermophile) and Chlamydia trachomatis (an obligate intracellular pathogen) by targeted replacement of a tetRA element in the fliA gene location using λ-Red-mediated recombination. The S. enterica serovar Typhimurium hybrid strains showed σ²⁸-dependent gene expression, suggesting that σ²⁸ activities from diverse species are preserved in the heterologous host system. A. aeolicus mutants defective for σ²⁸/FlgM interactions were also isolated in S. enterica serovar Typhimurium. These studies highlight a general strategy for analysis of protein function in species that are otherwise genetically intractable and a straightforward method of chromosome restructuring using λ-Red-mediated recombination.

Many organisms possess flagellar organelles that enable them to move about in liquid environments. The cells are able to direct their movement through chemical gradients as a result of intricate interactions between individual flagella and a chemosensory system, a process known as chemotaxis (3, 46). Motility is advantageous, since it allows cells to seek and acquire nutrients and to escape from adverse environmental conditions (3, 46). In addition, in many pathogenic organisms, flagella are important for adhesion, invasion, colonization, and biofilm formation on host cells and thereby contribute to virulence (17, 19). Flagellin monomers that constitute the flagella have also been shown to induce immune responses in mammalian hosts and the activation of plant defense mechanisms (33).

Flagellar gene regulation and assembly have been extensively characterized in Salmonella enterica serovar Typhimurium (1, 25). These studies revealed important regulatory mechanisms evolved by the organism to build these complex supramolecular structures. The assembly of the flagellum coincides with the cocoordinated regulation and expression of over 50 genes (25). The flagellar genes are expressed in a transcriptional hierarchy involving three promoter classes, classes 1, 2, and 3 (21). The class 1 operon responds to global regulatory signals and encodes transcriptional activators that interact with the housekeeping sigma factor σ⁷⁰ and RNA polymerase (RNAP) to transcribe class 2 promoters. The class 2 genes encode proteins required for the structure and assembly of the hook-basal body (HBB) and regulatory proteins including FliA (σ²⁸), required for class 3 promoter transcription, and the anti-σ²⁸ factor FlgM. The class 3 genes encode proteins that are required for filament assembly, motor force generation, and chemotaxis. The HBB anchors the flagellum to the bacterial membranes and includes a channel that enables the flagellar type III secretion system to secrete flagellar protein subunits out of the cytoplasm (26). Prior to completion of the HBB structure, FlgM binds σ²⁸, and class 3 promoters are not transcribed. When the HBB is completed, FlgM is secreted from the cell; this frees σ²⁸, and class 3 genes are expressed (18). This σ²⁸/FlgM regulatory checkpoint is thought to prevent production of class 3 gene products until they can be assembled into the flagellar structure (15).

Genetic and biochemical studies of σ²⁸/FlgM interactions have contributed to the understanding of flagellar regulation. Nuclear magnetic resonance studies with FlgM revealed that the protein was unstructured in solution but that, upon binding to σ²⁸, the C-terminal domain gained structure (9). These studies showed that the C-terminal domain of FlgM is important for interactions with σ²⁸ (9). Mutations in σ²⁸ that were insensitive to FlgM inhibition mapped throughout the protein. Based on these studies, a model suggesting that FlgM binds to σ²⁸ in a multipartite manner to inhibit σ²⁸ interaction with RNAP was proposed (4). In addition, it was shown that FlgM could inhibit σ²⁸ activity by destabilizing the σ²⁸-RNAP holoenzyme complex (4, 5).

Recently, a cocrystal structure of A. aeolicus σ²⁸/FlgM has been solved, and these studies defined the important domains in σ²⁸ and FlgM interactions (41). Further, these studies provide insights into the mechanism of FlgM inhibition through destabilization of the σ²⁸-RNAP holoenzyme complex (41). Because the overall amino acid homologies of A. aeolicus σ²⁸ and FlgM to S. enterica serovar Typhimurium are low, it is difficult to extrapolate whether the important interacting amino acids identified in S. enterica serovar Typhimurium are significant in A. aeolicus σ²⁸/FlgM interactions. Hence, we sought to isolate mutants that specifically affect A. aeolicus σ²⁸/FlgM interactions. A. aeolicus is a motile extreme thermophile, and unlike S. enterica serovar Typhimurium, it is difficult to propagate and requires special growth conditions (11). As a result, genetic studies with A. aeolicus are challenging. To corroborate the structural studies of A. aeolicus σ²⁸/FlgM interaction with an in vivo analysis, we utilized S. enterica serovar Typhimurium as a host cell system to genetically characterize the flagellar regulatory proteins of A. aeolicus. The availability of genetic and molecular tools and the extensive characterization of the flagellar regulon in S. enterica serovar Typhimurium present this organism as an ideal model system.

We also sought to test whether S. enterica serovar Typhimurium could be used as a general host to study σ²⁸ proteins from organisms that are genetically intractable. For this reason, we included the σ²⁸ homolog rspD from Chlamydia trachomatis in these studies. C. trachomatis is an obligate intracellular pathogen and is the causal agent of different human diseases such as trachoma, genital infections, and sexually transmitted diseases (37). Chlamydia are also difficult to propagate, and construction of stable transformants has been difficult (43). Although C. trachomatis is nonmotile, its σ²⁸ homolog was shown to recognize the fliC promoter of Escherichia coli in vitro (39). In this study, we present a genetic characterization of σ²⁸ from A. aeolicus and C. trachomatis in S. enterica serovar Typhimurium and an isolation of A. aeolicus σ²⁸/FlgM through complementation and mutagenesis experiments.

MATERIALS AND METHODS

Strains.

Bacterial strains, plasmids, and primers used in this study are listed in Table 1.

TABLE 1.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primer	Genotype description, or sequence (5′→3′)a	Source or referenceb
Strains
S. enterica serovar Typhimurium
TH6238	motA5461::MudJ
TH8059	motA5461::MudJ fliA6088 (A. aeolicus GTG-fliA+)
TH8120	motA5461::MudJ flgM6095 (A. aeolicus flgM+)
TH8122	motA5461::MudJ fliA6088 flgM6095
TH8194	motA5461::MudJ ΔflgM5794::FRTc
TH8196	motA5461::MudJ fliA6088 ΔflgM5794::FRT
TH8197	motA5461::MudJ ΔflgM5794::FRT ΔfliA5805::tetRA
TH4098	fliC5050::MudJ fljBe,n,xvh2
TH8061	fliC5050::MudJ fljBe,n,xvh2 fliA6090 (A. aeolicus GTG-fliA+)
TH8123	fliC5050::MudJ fljBe,n,xvh2 flgM6095
TH8125	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6095
TH8198	fliC5050::MudJ fljBe,n,xvh2 ΔflgM5794::FRT
TH8200	fliC5050::MudJ fljBe,n,xvh2 fliA6090 ΔflgM5794::FRT
TH8201	fliC5050::MudJ fljBe,n,xvh2 ΔflgM5794::FRT ΔfliA5805::tetRA
MST4190	leuBCD485 trp::[Spcr PlacT7-RNAP lacI]	S. Maloy
TH9031	leuBCD485 trp::[Spcr PlacT7-RNAP lacI] motA5461::MudJ fliA6325 (C. trachomatis L2 GTG-fliA+) ΔflgM5794::FRT/pJK627
TH9032	leuBCD485 trp::[Spcr PlacT7-RNAP lacI] motA5461::MudJ fliA6325 ΔflgM5794::FRT/pET15b
TH9033	leuBCD485 trp::[Spcr PlacT7-RNAP lacI] motA5461::MudJ fliA6325/pET15b
TH9040	leuBCD485 trp::[Spcr PlacT7-RNAP lacI] fliC5050::MudJ fljBe,n,xvh2 fliA6325 ΔflgM5794::FRT/pJK627
TH9041	leuBCD485 trp::[Spcr PlacT7-RNAP lacI] fliC5050::MudJ fljBe,n,xvh2 fliA6325 ΔflgM5794::FRT/pET15b
TH9042	leuBCD485 trp::[Spcr PlacT7-RNAP lacI] fliC5050::MudJ fljBe,n,xvh2 fliA6325/pET15b
TH8604	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6237 (A. aeolicus flgM A→G −6 bp from ATG)
TH8605	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6238 (A. aeolicus flgM A→C −5 bp from ATG)
TH8606	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6239 (A. aeolicus flgM A→G −4 bp from ATG)
TH8607	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6240 (A. aeolicus flgM ATG→GTG M1V)
TH8608	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6241 (A. aeolicus flgM AAG→AGG K19R)
TH8609	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6242 (A.aeolicus flgM Δ bp +55-56)
TH8610	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6243 (A. aeolicus flgM ΔA bp +177 from ATG)
TH8611	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6244 (A. aeolicus flgM AAA→AAG K64K, ΔA bp +199 from ATG)
TH8612	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6245 (A. aeolicus fliA CCT→TCT P4S)
TH8613	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6246 (A. aeolicus fliA ACA→TCA T27S)
TH8614	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6247 (A. aeolicus fliA ATA→ATG 129M)
TH8615	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6248 (A. aeolicus fliA AGA→GGA R149G)
TH8616	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6249 (A. aeolicus fliA ACG→ATG 1175M)
TH8617	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6250 (A. aeolicus fliA GAA→GGA E189G)
TH8618	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6251 (A. aeolicus fliA GAA→GGA E199G)
TH9607	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6245 ΔflgM5794::FRT
TH9608	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6246 ΔflgM5794::FRT
TH9609	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6247 ΔflgM5794::FRT
TH9610	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6248 ΔflgM5794::FRT
TH9611	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6249 ΔflgM5794::FRT
TH9612	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6250 ΔflgM5794::FRT
TH9647	fliC5050::MudJ fljBe,n,xvh2 flgM6095 fliA6251 ΔflgM5794::FRT
TH3467	proAB47/F′128 (pro-lac) zzf-3833::Tn10dTc[del-25] (T-POP)	34
TH4387	fliA5059::Tn10dTc fljBe,n,xvh2
TH7953	flgM6085::tetRA/pKD46
TH8009	ΔfliA5805::tetRA/pKD46
TH8010	ΔfliA5805::tetRA motA5461::MudJ/pKD46
TH8011	ΔfliA5805::tetRA fliC5050::MudJ fljBe,n,xvh2/pKD46
TH8349	fliC5050::MudJ fljBe,n,xvh2 fliA6090 flgM6085::tetRA/pKD46
TH8350	fliC5050::MudJ fljBe,n,xvh2 flgM6095 ΔfliA5805::tetRA/pKD46
TH8142	fliA6088 (A. aeolicus GTG-fliA+)
TH8982	fliA6325 (C. trachomatis L2 GTG fliA+)
TH9065	ΔfliA5647::FRT/pBAD24
TH9066	ΔfliA5647::FRT/pMC147
TH9067	ΔfliA5647::FRT/pJK558
TH9068	ΔfliA5647::FRT/pJK629
E. coli
DH5α	φ80dlacZΔM15 endA1 hsdR17 (rK−mK−) supE44 thi-1 recA1 gyrA (Nalr (lacZYA-argF) U169)	New England Biolabs
Plasmids
pMC147	(pBAD24-fliA S. enterica serovar Typhimurium)
pJK558	(pBAD24-fliA A. aeolicus)
pJK629	(pBAD24-rspD C. trachomatis)
pJK627	(pET15b-rsbW C. trachomatis L2)
pKD46	(pBAD- λ-Red (γ β exo)	8
pBAD24	(Para cloning vector pBR322 ori, Apr)	14
pET15b		Novagen
pMS531	(S. enterica serovar Typhimurium fliA)	42
pLF28	(PBAD-rspD C. trachomatis)	39
pET28a-rsbW	C. trachomatis L2	T. P. Hatch
Primers
FliAdeltetR	CTCATTTAACGCAGGGCTGTTTATCGTGAATATAGGTCGCGCATGATCGCACCC GAAAAGTttaagacccactttcaca
FliAdeltetA	CTTTTCGGGTGCGATCATGCGCGACCTATATTCACGATAAACAGCCCTGCGTTA AATGAGTctaagcacttgtctcctg
FlgMAUGtetR	AGCTGGCCGCTACAACGTAACCCTCGATGAGGATAAATAAttaagacccactttcacatt
FlgMAUGtetA	TGCTAACGGGTTTCAAAGGTGAGGTACGGTCAATGCTCATctaagcacttgtctcctg
AAGTG	TAATCATGCCGATAACTCATTTAACGCAGGGCTGTTTATCgtgaaaaacccttacagcaacc
AA28R	CGTTGTGCGGCACTTTTCGGGTGCGATCATGCGCGACCTAtagaggattagagagcatttc
AAFLGM1	AGCTGGCCGCTACAACGTAACCCTCGATGAGGATAAATAAatggtgaacaggattcaactc
AAFLGM2	CATCTGGTCAAGTATTTCTGACAAACGAGTCATACGCTTAcgtaaaaaactctatcagtcc
CTFLIAGTG	TAATCATGCCGATAACTCATTTAACGCAGGGCTGTTTATCgtgaagactcacgatctcgc
CTFLIASTOP	CGTTGTGCGGCACTTTTCGGGTGCGATCATGCGCGACCTAaagcagactggacaatgtac
AQAA1	AAGAATTCATGAAAAACCCTTACAGCAACC
AQAA2	ACAAAGCTTATAGAGGATTAGAGAGCATTTC
FliA#3	GGCGCTACAGGTTACATAAG
FliA#4	TAGTCTATACGTTGTGCGGC
FlgM5′UP	GAACCGTCGATTCTGATG
FlgN reverse	GTCTTCAGGTCATTCAG

^aIn primer sequences, lowercase indicates homology to the tetRA element.

^bAll strains were constructed for this study unless otherwise noted.

^cFRT, FLP recognition target scar (8).

Media and standard genetic and molecular techniques.

Media, growth conditions, phage P22 transduction methods, and motility assays were as described previously (10, 13). Tetracycline-sensitive (Tc^s) plates were made as described by Maloy (28). Antibiotics in rich media were used at the following concentrations (in μg/ml): ampicillin (Ap; 100), kanamycin (50), tetracycline (15), and spectinomycin (100). PCR and DNA cloning were performed as described previously (35). DNA primers (Integrated DNA Technologies, Coralville, IA) used in this study are listed in Table 1. PCRs were performed with Taq (Promega, Madison, WI), Accuzyme (Bioline, Randolph, MA), or ThermalAce (Invitrogen, Carlsbad, CA). All enzymes used for DNA cloning were from New England Biolabs (Beverly, MA). DNA sequencing was performed using BigDye v3.1 (Applied Biosystems, Foster City, CA), and the reactions were analyzed using a 3730XL sequencer at the DNA sequencing facility of the Department of Biochemistry, University of Washington, Seattle, WA.

λ-Red-mediated insertion of the tetRA element.

The fliA coding region in S. enterica serovar Typhimurium was replaced by allelic exchange with a tetRA element using λ-Red-mediated recombination (8, 32, 48). In addition, a tetRA element was inserted just before the ATG start codon of flgM. This tetRA element includes the coding sequences of tetR and tetA from transposon Tn10dTc and confers tetracycline resistance (47). The PCR primers for amplification of the tetRA element were flanked by 40-bp sequences of homology for recombination on the chromosome. Primers FliAdeltetR, FliAdeltetA, FlgMAUGtetR, and FlgMAUGtetAwere used for the construction of ΔfliA5805::tetRA and flgM6085::tetRA, respectively. The PCRs containing genomic DNA of TH3467, DNA primers, dNTPs, and Taq polymerase were amplified as follows; 3 min at 95°C for 1 cycle, 30 s at 95°C, 30 s at 49°C, 2 min at 72°C for 30 cycles, and 10 min at 72°C for 1 cycle. A 1,990-bp product was purified using a QIAquick PCR purification kit (QIAGEN, Valencia, CA). S. enterica serovar Typhimurium strain TH4702 containing a λ-Red plasmid pKD46 that has a temperature-sensitive replicon (8) was grown under inducing conditions in LB plus Ap (100 μg/ml) plus arabinose at 0.2% at 30°C until the optical density at 600 nm reached 0.6 to 0.8. The cells were washed twice in equal volumes of cold sterile water and concentrated 250-fold. Fifty μl of cells was electroporated with 100 to 200 ng of purified PCR fragment using 0.1-cm cuvettes at 200 Ω, 1.6 kV, and 25 μF. Subsequently, one ml of LB was added, and cells were incubated for 1 hour at 37°C. Approximately 0.5 ml of cells was plated on LB plates containing tetracycline and incubated at 37°C. Tc^r colonies were purified on LB plates without antibiotics and incubated at 42°C. Tc^r colonies were screened for Ap^s to confirm the loss of the pKD46 plasmid. To confirm that the tetRA integrated into the correct region on the chromosome, Tc^r and Ap^s colonies were screened by PCR using primers within the tetRA element and in sequences flanking fliA or flgM, respectively.

λ-Red-mediated replacement of the tetRA element.

The fliA and flgM genes were replaced in S. enterica serovar Typhimurium with homologs from A. aeolicus and C. trachomatis using λ-Red-mediated replacement of the tetRA element as described below. The fliA homologs from A. aeolicus (fliA) and C. trachomatis (rspD) were PCR amplified using genomic DNA from A. aeolicus (kind gift from K. O. Stetter) and pLF28 (39), respectively. Primer sets to amplify the fliA homologs are as follows: for A. aeolicus, AAGTG and AA28R; for C. trachomatis, CTFLIAGTG and CTFLIASTOP. PCR amplification was performed as described above, except the annealing temperature used was 45°C. The PCR products were purified, electroporated into strain TH8350 (ΔfliA::tetRA) as described above except for subsequent plating of the cells onto Tc^s medium (28), and incubated at 42°C overnight. Colonies were purified once on Tc^s medium at 42°C and then on LB plates at 37°C. The constructs were screened for the loss of the tetRA element by PCR, and the region was subsequently PCR amplified for DNA sequencing to confirm the replacement of S. enterica serovar Typhimurium fliA with the fliA homologs of A. aeolicus and C. trachomatis. The coding region of flgM in S. enterica serovar Typhimurium was replaced with the homolog from A. aeolicus as described for fliA using A. aeolicus genomic DNA, primers AAFLGM1 and AAFLGM2, and TH8349.

Isolation of A. aeolicus fliA and flgM mutants using error-prone PCR and λ-Red-mediated replacement of the tetRA element.

The coding regions of fliA and flgM from A. aeolicus were mutagenized by error-prone PCR with genomic DNA from TH8125, primers FliA#3 and FliA#4 (for σ²⁸), FlgM5′UP and FlgN reverse (for flgM), dNTPs, and 5 units of Promega Taq per reaction. The PCR amplifications were performed as described above. Electrocompetent cells of strains TH8350 (for fliA) and TH8349 (for flgM) were prepared as described above, and transformants were selected on Tc^s medium and incubated at 42°C. Colonies were further purified on Tc^s medium at 42°C and then on LB medium at 37°C. The colonies were screened for Lac⁺ on MacConkey medium. The fliA or flgM regions from the Lac⁺ isolates were DNA sequenced.

Plasmid constructions.

The fliA coding sequences from S. enterica serovar Typhimurium, A. aeolicus, and C. trachomatis were cloned under the arabinose promoter to construct pMC147, pJK558, and pJK629 as follows. A 770-bp EcoRI fragment blunted with Klenow fragment containing S. enterica serovar Typhimurium fliA from pMS531 was ligated into pBAD24 digested with NcoI and blunted with Klenow fragment to generate pMC147. A. aeolicus fliA was PCR amplified using A. aeolicus genomic DNA and primers AQAA1 and AQAA2. The PCR product was digested with BspHI and HindIII and ligated into pBAD24 digested with NcoI and HindIII to generate pJK588. A 515-bp NcoI-PstI fragment from pLF28 containing C. trachomatis rspD was ligated into pBAD24 digested with NcoI-PstI to generate pJK629. A 500-bp NcoI-HindIII fragment from pET-rsbW C. trachomatis L2 containing His-tagged rsbW from C. trachomatis (gift from T. P. Hatch) was ligated into pET15b digested with NcoI-XhoI to generate pJK627.

β-Galactosidase assays.

β-Galactosidase assays were performed as described by Maloy (27). Cells were grown in LB or LB plus Ap (100 μg/ml) plus 1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) (in strains containing plasmids) at 37°C until mid-log phase. Assays were performed in triplicate, and the values were normalized as percentages of the wild-type (WT) value.

Western blot analysis.

Cells were grown in LB until mid-log phase, and 1 ml of cells was centrifuged and resuspended in sodium dodecyl sulfate sample buffer. The samples were run on a 10% Tricine-sodium dodecyl sulfate polyacrylamide gel and electrotransferred in CAPS buffer onto polyvinylidene difluoride membranes (29, 38). The membrane was probed with rabbit anti-FliC antibodies (Salmonella H antiserum i rabbit, catalog number 228241; Difco) purified as described previously (15) and developed using an ECL-Plus kit (Amersham Biosciences, Piscataway, NJ).

Software programs.

Amino acid alignments were performed using Clustal W (6). The sequence alignments were edited using Jalview alignment editor (7). Aquifex aeolicus σ²⁸/FlgM cocrystal analysis used coordinates PDB ID 1SC5 from the RCSB protein database (www.rcsb.org/pdb/) and RasMol v. 2.7 (2, 36). The analysis of helix interactions was done with PDBsum (23). The analysis of residue contacts was determined on PDB ID 1SC5 using CSU (contact of structural units) software (40).

RESULTS

A. aeolicus and C. trachomatis σ²⁸ restore motility to an S. enterica serovar Typhimurium σ²⁸ mutant.

Given the similarities in the critical domains of σ²⁸ (see alignments in Fig. 1), we tested whether σ²⁸ homologs of A. aeolicus and C. trachomatis would complement an S. enterica serovar Typhimurium σ²⁸ mutant. The genes encoding σ²⁸ of S. enterica serovar Typhimurium (fliA_SeT), A. aeolicus (fliA_Aa), and C. trachomatis (rspD_Ct) were cloned under the arabinose-inducible promoter (P_araB) and introduced into the S. enterica serovar Typhimurium fliA mutant strain TH4387. The plasmid-containing strains were assessed for motility on plates containing 0.2% arabinose (Fig. 2A). Levels of complementation for motility by P_araB-A. aeolicus fliA⁺ andP_araB-C. trachomatis rspD⁺ were 39% and 58%, respectively, of the level for P_araB-S. enterica serovar Typhimurium fliA⁺ (Fig. 2A). Similar results were previously observed with A. aeolicus fliA⁺ from E. coli. (44). Interestingly, a P_araB-C. trachomatis rspD⁺ plasmid did not restore motility in E. coli with a fliA deletion (39). Although E. coli and S. enterica serovar Typhimurium possess nearly identical flagellar systems (25), the dramatic differences in complementation for motility with P_araB-C. trachomatis rspD⁺ demonstrates that differences in the flagellar regulons between the two species can be uncovered.

FIG. 1.

(A) Clustal W amino acid alignments of σ²⁸ homologs. The GenInfo Identifier numbers of the σ²⁸s used in the alignments are as follows: Yersinia pestis KIM (gi22126347), Salmonella enterica serovar Typhimurium LT2 (gi16765294), Yersinia enterocolitica (gi1706832), Proteus mirabilis (gi6959882), Escherichia coli K-12 (gi33347603), Ralstonia solanacearum (gi17549609), Pseudomonas syringae (gi28869183), Bordetella pertussis (gi33571813), Vibrio cholerae (gi15642066), Aquifex aeolicus (gi15606452), Bacillus subtilis (gi1350863), Chlamydia trachomatis (gi15604780), and Helicobacter pylori (gi15645646). Conserved amino acid regions as described by Lonetto et al. (24) are marked in black at the top of the alignments. The σ²⁸ domains from previous structural studies by Sorenson et al. (41) are noted below. (B) Clustal W amino acid alignments of FlgM homologs. The GenInfo Identifier numbers of the FlgM used in the alignments are as follows: Yersinia enterocolitica (gi6166171), Escherichia coli K-12 (gi1651526), Yersinia pestis KIM (gi22126396), Salmonella enterica serovar Typhimurium LT2 (gi16764528), Proteus mirabilis (gi1857441), Bordetella pertussis (gi33572120), Bacillus subtilis (gi729520), Vibrio cholerae (gi15642203), Pseudomonas syringae (gi28869129), Ralstonia solanacearum (gi17548561), Helicobacter pylori (gi18075990), and Aquifex aeolicus (gi15605866). The σ²⁸ binding domain in S. enterica serovar Typhimurium FlgM is highlighted at the bottom of the alignments. The shading scheme for amino acid homologies was determined using Blosum62 (7).

FIG. 2.

(A) Motility assay of S. enterica serovar Typhimurium fliA-defective strain TH4387 with the following plasmids: vector (pBAD24), P_araB-σ²⁸ S. enterica serovar Typhimurium (S.t.) (pMC147), P_araB-σ²⁸ A. aeolicus (A.a.) (pJK558), and P_araB-σ²⁸ C. trachomatis (C.t.) (pJK629). (B) Western analysis of total cellular proteins from S. enterica serovar Typhimurium hybrid strains fliA (σ²⁸) from A. aeolicus and C. trachomatis probing with anti-FliC antiserum. Lane 1, TH437 (S. enterica serovar Typhimurium wild-type strain LT2); lane 2, TH6827 (ΔfliA5805::tetRA); lane 3, TH8142 ((fliA6068 [A. aeolicus fliA]); lane 4, TH8982 ((fliA6325 [C. trachomatis rspD]). Fourfold more cellular lysate was loaded in lanes 2 to 4 than in lane 1.

The coding region of chromosomal S. enterica serovar Typhimurium fliA was replaced with either the fliA from A. aeolicus or the rspD from C. trachomatis by targeted replacement of a tetRA element using a λ-Red recombination system (Fig. 3A; also see reference 8 and Materials and Methods). Therefore, σ²⁸-mediated gene expression in these hybrid strains remained under the regulation of the S. enterica serovar Typhimurium flagellar regulon. These σ²⁸ hybrid strains were weakly motile (data not shown). Because motility was weak, we analyzed whether the hybrid strains expressed the σ²⁸-dependent flagellar filament protein FliC. Western blot analysis using anti-FliC serum on cellular lysates showed the presence of FliC protein in S. enterica serovar Typhimurium hybrid strains with A. aeolicus σ²⁸ or C. trachomatis σ²⁸ (Fig. 2B, lanes 3 and 4, respectively). However, the levels of FliC protein were reduced in the σ²⁸ hybrid strains by fourfold relative to the level for WT S. enterica serovar Typhimurium (Fig. 2B). Although motility was reduced in the σ²⁸ hybrid strains, the presence of FliC protein and the ability to transcribe class 3 flagellar promoters (see below) indicate the conservation of σ²⁸ function. Together, these results indicate that σ²⁸ from diverse species can interact with the heterologous host transcriptional machinery for flagellar biogenesis.

FIG. 3.

(A) λ-Red-mediated replacement of the tetRA element. Donor PCR products from coding sequences of fliA (σ²⁸) or flgM from A. aeolicus were flanked by 40-bp sequences of homology for recombination in the chromosome. The donor PCR products were electroporated into S. enterica serovar Typhimurium strains with tetRA elements inserted in the fliA or flgM genes. The tetRA element includes the coding sequences of tetR and tetA from transposon Tn10dTc and confers tetracycline resistance. The recombination was mediated by λ-Red (plasmid pKD46) (8), resulting in the loss of the tetRA element and replacement with the coding sequences of fliA or flgM from A. aeolicus by selection on tetracycline-sensitive medium (28). (B) Isolation of A. aeolicus fliA (σ²⁸) and flgM mutants using error-prone PCR and λ-Red-mediated replacement of the tetRA element. Replacement of the tetRA element were performed as described for panel A, except the donor PCR products of coding sequences from fliA (σ²⁸) or flgM were generated by error-prone PCR (as indicated by the sunburst symbol).

Regulation of σ²⁸ activity by the cognate negative regulator FlgM is species specific.

To investigate the interactions of cognate sigma factor and anti-sigma factor activities between species, hybrid S. enterica serovar Typhimurium strains were constructed by use of λ-Red (Fig. 3A; also see Materials and Methods). The fliA⁺ gene (σ²⁸) of S. enterica serovar Typhimurium was replaced with the σ²⁸ homologs from A. aeolicus and C. trachomatis, fliA⁺ and rspD⁺, respectively. Further, the negative regulatory gene flgM⁺ of S. enterica serovar Typhimurium was replaced with A. aeolicus flgM⁺. We assayed σ²⁸-mediated gene expression in the hybrid strains using lac gene transcriptional fusion reporters to two σ²⁸-dependent promoters, motA and fliC. The motA and fliC genes encode vital components of the flagellum; MotA is required for flagellar rotation, and FliC is the main structural component of the flagellar filament (25).

Relative β-galactosidase levels of motA-lac and fliC-lac expression in WT S. enterica serovar Typhimurium increased 3- and 1.7-fold, respectively, in the absence of the S. enterica serovar Typhimurium FlgM (Fig. 4, compare lanes 2 and 3 in both panels). Likewise, in S. enterica serovar Typhimurium strains with A. aeolicus σ²⁸, in the absence of A. aeolicus FlgM, motA-lac and fliC-lac expression was increased around 2.5-fold (Fig. 4, compare lanes 6 and 7). This is in support of structure studies on A. aeolicus σ²⁸/FlgM interaction which suggest that FlgM binding to σ²⁸ inhibits its interaction with core RNAP (41). Interestingly, in the presence of S. enterica serovar Typhimurium FlgM, A. aeolicus σ²⁸-mediated levels of motA-lac and fliC-lac expression were similar to that of an S. enterica serovar Typhimurium flgM deletion strain, indicating the absence of negative regulation on A. aeolicus σ²⁸ activity (Fig. 4, compare lanes 7 and 8). In S. enterica serovar Typhimurium σ²⁸ strains, the relative levels of β-galactosidase activity in the S. enterica serovar Typhimurium flgM deletion strain were similar to those of strains containing A. aeolicus FlgM (Fig. 4, compare lanes 3 and 4), suggesting that A. aeolicus FlgM has no effect on S. enterica serovar Typhimurium σ²⁸ activity. These findings show inhibition of A. aeolicus σ²⁸ activity by its cognate negative regulator FlgM but not by S. enterica serovar Typhimurium FlgM. Similarly, S. enterica serovar Typhimurium σ²⁸ activity is inhibited by its cognate negative regulator FlgM but not by A. aeolicus FlgM. Collectively, these studies indicate that the anti-σ²⁸ FlgM factors interactionswith σ²⁸, and their negative regulation on σ²⁸ activities are species specific.

FIG. 4.

β-Galactosidase activities of lac gene transcriptional fusion reporters to σ²⁸-dependent genes motA and fliC in S. enterica serovar Typhimurium. The σ²⁸ coding sequences were replaced by λ-Red recombination with coding sequences from either σ²⁸ from A. aeolicus (fliA) or C. trachomatis (rspD). The flgM coding sequence was replaced with A. aeolicus flgM. C. trachomatis RsbW, putative negative regulator of RspD, was encoded in trans by plasmid pJK627. (A) MotA-lac β-galactosidase activities were compared relative to those of the following isogenic WT σ²⁸ strains (WT = 100%): TH6238, black bars; TH8196, gray bars; TH9033, white bars. Lane 1, ΔfliA, ΔflgM (TH8197); lane 2, S. enterica serovar Typhimurium (S.t.) fliA, S. enterica serovar Typhimurium flgM (TH6238); lane 3, S. enterica serovar Typhimurium fliA, ΔflgM (TH8194); lane 4, S. enterica serovar Typhimurium fliA, A. aeolicus (A.a.) flgM (TH8120); lane 5, ΔfliA, ΔflgM (TH8197); lane 6, A. aeolicus fliA, A. aeolicus flgM (TH8122); lane 7, A. aeolicus fliA, ΔflgM (TH8196); lane 8, A. aeolicus fliA, S. enterica serovar Typhimurium flgM (TH8059,); lane 9, ΔfliA, ΔflgM (TH8197); lane 10, C. trachomatis (C.t.) rspD, C. trachomatis rsbW (TH9031); lane 11, C. trachomatis rspD, ΔflgM (TH9032); lane 12, C. trachomatis rspD, S. enterica serovar Typhimurium flgM (TH9033). (B) FliC-lac β-galactosidase activities were compared relative to those of the following isogenic WT σ²⁸ strains (WT = 100%): TH4098, black bars; TH8125, gray bars; TH9040, white bars. Lane 1, ΔfliA, ΔflgM (TH8201); lane 2, S. enterica serovar Typhimurium fliA, S. enterica serovar Typhimurium flgM (TH4098); lane 3, S. enterica serovar Typhimurium fliA, ΔflgM (TH8198); lane 4, S. enterica serovar Typhimurium fliA, A. aeolicus flgM (TH8123); lane 5, ΔfliA, ΔflgM (TH8201); lane 6, A. aeolicus fliA, A. aeolicus flgM (TH8125); lane 7, A. aeolicus fliA, ΔflgM (TH8200); lane 8, A. aeolicus fliA, S. enterica serovar Typhimurium flgM (TH8061); lane 9, ΔfliA, ΔflgM (TH8201); lane 10, C. trachomatis rspD, C trachomatis. rsbW (TH9040); lane 11, C. trachomatis rspD, ΔflgM (TH9041); lane 12, C. trachomatis rspD, S. enterica serovar Typhimurium flgM (TH9042).

Hybrid strains of S. enterica serovar Typhimurium containing C. trachomatis rspD⁺ (C. trachomatis σ²⁸) were constructed in motA-lac and fliC-lac backgrounds. C. trachomatis RsbW, the putative negative regulator of RspD (39), was encoded in trans by plasmid pJK627. However, there was no difference in the relative β-galactosidase levels in the presence of RsbW or in its absence (Fig. 4, lanes 10 and 11, respectively). S. enterica serovar Typhimurium FlgM also did not negatively regulate C. trachomatis σ²⁸ activity (Fig. 4, lanes 12). C. trachomatis RsbW is 36% identical and 58% similar to homolog RsbW in Bacillus subtilis. In B. subtilis, anti-sigma factor RsbW and anti-anti-sigma factor RsbV, as well as other regulatory proteins, regulate σ^B activity but differ mechanistically from anti-σ²⁸ FlgM homologs (16). The lack of anti-σ²⁸ activity by C. trachomatis RsbW in S. enterica serovar Typhimurium suggests that additional factors for C. trachomatis σ²⁸ inhibition may be required or that σ²⁸ inhibition may be independent of RsbW.

Isolation of fliA mutants defective in A. aeolicus σ²⁸/FlgM interactions.

We sought to isolate mutants defective in A. aeolicus σ²⁸/FlgM interactions using a genetic screen. S. enterica serovar Typhimurium strain TH8125 contains A. aeolicus fliA⁺ and A. aeolicus flgM⁺ genes as well as a σ²⁸-dependent fliC-lac reporter construct. TH8125 is white (Lac⁻) on MacConkey lactose (Mac-lac) medium, and the same strain deleted for A. aeolicus flgM is red (Lac⁺). Therefore, a phenotypic screen was used to identify mutants of TH8125 defective in A. aeolicus σ²⁸/FlgM interactions (red on Mac-lac). Error-prone PCR was used to mutagenize A. aeolicus fliA (σ²⁸) and A. aeolicus flgM genes. The mutagenized gene products were electroporated into S. enterica serovar Typhimurium strain TH8125 that had a tetRA insertion in either A. aeolicus fliA or A. aeolicus flgM. Subsequent recombination of fliA and flgM was achieved by use of λ-Red (Fig. 3B). The loss of tetracycline resistance, indicative of replacement with the mutagenized gene products, was selected on tetracycline-sensitive medium (28). The transformants were subsequently screened on Mac-lac medium, and red (Lac⁺) colonies were sequenced for putative mutations in either A. aeolicus fliA or A. aeolicus flgM.

In the A. aeolicus fliA mutagenesis screen, 300 Tc^s colonies were isolated, of which 28 were Lac⁺ on Mac-lac medium. Twelve Lac⁺ mutants were sequenced, and seven contained missense mutations in A. aeolicus fliA (Fig. 5A and Table 2).Since the remaining five had multiple mutations in A. aeolicus fliA and are difficult to interpret, they were excluded from the study. β-Galactosidase assay results for A. aeolicus σ²⁸ mutants compared to those for WT (TH8125) demonstrated an increase in activity in the presence of A. aeolicus FlgM (Fig. 5B). The relative activity of A. aeolicus σ²⁸ mutants ranged from 1.3- to 2.9-fold higher than that for WT (TH8125) (Table 2).

FIG. 5.

(A) Summary of mutations isolated in A. aeolicus fliA. Domain regions correspond to regions shown in Fig. 1. Mutations resulting in single amino acid changes are listed in Table 2. (B) β-Galactosidase activities of fliC-lac in hybrid S. enterica serovar Typhimurium strains with A. aeolicus fliA mutants isolated defective for σ²⁸/FlgM interactions. β-Galactosidase activities were compared to those of TH8125. Dark gray bars indicate the presence of FlgM; light gray bars indicate the absence of FlgM. Lane 1, WT (TH8125, TH8200); lane 2, P4S (TH8612, TH9607); lane 3, T27S (TH8613, TH9608); lane 4, I29M (TH8614, TH9609); lane 5, R149G (TH8615, TH9610); lane 6, T175M (TH8616, TH9611); lane 7, E189G (TH8617, TH9612); lane 8, E199G (TH8618, TH9647).

TABLE 2.

Summary of mutants isolated in A. aeolicus fliA

Strain	Mutation relative to the start codon	Comments	Change in % of codon frequency from WT to mutant	Relative activity (P value) compared toa:
				TH8125 in the presence of FlgMb	TH8200 in the absence of FlgMc
TH8125		WT		1
TH8200		ΔflgM			1
TH8612	C→T +10 bp	CCT→TCT P4S, domain σ2	7.8 to 8.5	2.8 (<0.001)	1.2 (>0.05)
TH8613	A→T +79 bp	ACA→TCA T27S, domain σ2	4.7 to 5.9	1.7 (0.012)	1.6 (<0.001)
TH8614	A→G +87 bp	ATA→ATG, 129M, domain σ2	4.2 to 23.6	1.4 (0.006)	1.6 (0.003)
TH8615	A→G +445 bp	AGA→GGA, R149G, domain σ3-4 linker	2.2 to 6.3	1.3 (0.032)	0.8 (0.042)
TH8616	C→T +524 bp	ACG→ATG, T175M, domain σ3-4 linker	17.1 to 23.6	2.9 (<0.001)	1.6 (0.013)
TH8617	A→G +566 bp	GAA→GGA, E189G, domain σ4	55 to 14.5	1.3 (0.030)	1.1 (>0.05)
TH8618	A→G +596 bp	GAA→GGA, E199G, domain σ4	55 to 14.5	1.4 (0.016)	1.2 (>0.05)

^aRelative β-galactosidase activities were calculated from Fig. 5B.

^bP values were determined using two-tailed t tests on β-galactosidase activities compared to TH8125.

^cP values were determined using two-tailed t tests on β-galactosidase activities compared to TH8200.

To examine whether the mutants were more active due to increased activity of σ²⁸, β-galactosidase assays were performed in the absence of A. aeolicus FlgM (TH8200) (Fig. 5B). The relative activity of A. aeolicus σ²⁸ mutants compared to WT (TH8200) ranged from 0.8- to 1.6-fold higher (Table 2). Mutants T27S, I29M, and T175M had more σ²⁸ activity than WT (TH8200) in the absence A. aeolicus FlgM, suggesting that their ability to bypass FlgM inhibition was due to increased σ²⁸ activity and that they are not defective for FlgM interaction. Mutants I29M and T175M had changes in codon frequency that may have resulted in increased levels of σ²⁸ expression (Table 2). The codon frequency change of mutant T27S was nominal (Table 2), suggesting that an increased σ²⁸ activity is not due to increased translation. The increased activity could be attributed to increased stability, as was found for the H14D mutants of S. enterica serovar Typhimurium σ²⁸ that were able to bypass FlgM inhibition (4).

Mutation R149G had more σ²⁸ activity than WT (TH8125) in the presence of FlgM but had less σ²⁸ activity in the absence of FlgM (TH8200) (Fig. 5B and Table 2). This class of mutant was also found in the S. enterica serovar Typhimurium σ²⁸ defective for FlgM interaction (4). Although they had more σ²⁸ activity in the presence of FlgM, they were implied to have less σ²⁸ activity in the absence of FlgM, due to amino acid substitutions that increased the turnover of σ²⁸ (4).

Mutants P4S, E189G, and E199G have σ²⁸ activity levels similar to that of WT (TH8200) in the absence A. aeolicus FlgM and more σ²⁸ activity than WT (TH8125) in the presence of A. aeolicus FlgM, suggesting they are defective for FlgM interaction (Fig. 5B and Table 2). Residue E189 is buried within the σ²⁸ structure, where there are extensive contacts with the other interacting domains (41). This mutation may be involved in stabilizing the σ²⁸ structure in a manner that renders it resistant to FlgM inhibition through allosteric effects. In contrast, P4 lies at the N terminus of σ²⁸, is not buried within the σ²⁸, and appears too distant to make contacts with FlgM (41). Nonetheless, the P4S mutation could involve a conformational change to alter inhibition by FlgM or modify σ²⁸ protein stability or interaction with RNAP.

The E199G mutation found in A. aeolicus σ²⁸ corresponds to location E203 of S. enterica serovar Typhimurium (4). An S. enterica serovar Typhimurium σ²⁸ E203D mutant exhibited 10-fold less affinity to S. enterica serovar Typhimurium FlgM and was the most attenuated for the destabilizing of the S. enterica serovar Typhimurium σ²⁸-RNAP holoenzyme by S. enterica serovar Typhimurium FlgM (4). By analogy to S. enterica serovar Typhimurium σ²⁸, the A. aeolicus σ²⁸ E199 position is an important contact for FlgM in inhibition of σ²⁸ interaction, with RNAP likely to be involved in the “stripping” of σ²⁸ from the σ²⁸-RNAP holoenzyme complex by FlgM (4, 41). The E199G mutation is located in the conserved region 4 of the σ⁷⁰ family of transcription factors (31). Interestingly, many mutations isolated in S. enterica serovar Typhimurium defective in σ²⁸/FlgM interactions mapped to σ²⁸ region 4 (4, 20). This domain is also a target for transcriptional regulation in many other systems (12). Anti-sigma factors Rsd, SpoIIAB, and FlgM bind to region 4 of the sigma factors to inhibit its interaction with RNAP (12).

Previous structural studies showed that when FlgM is bound to σ²⁸, it could occlude the interaction of this domain with the β-flap of RNAP that is important for proper recognition of the −35 promoter element (22, 30, 41, 45). Further, studies suggest FlgM helix H3′ interacts with region 4 (where E199 of A. aeolicus σ²⁸ is located) on the σ²⁸-RNAP holoenzyme complex, and either by a conformational change in the interaction with FlgM or through enzyme “breathing,” region 4 is released for binding by helix H4′ of FlgM. This inhibits region 4 interaction with the RNAP β-flap and the subsequent dissociation of σ²⁸ from RNAP (4, 41). E199 in σ²⁸ lies within the face of the helix in s₄, where it interacts with H3′ helix of FlgM (41). Isolation of E199G in A. aeolicus σ²⁸ that is resistant to FlgM inhibition supports this model.

Isolation of flgM mutants defective in A. aeolicus σ²⁸/FlgM interactions.

Three hundred Tc^s clones were isolated from the A. aeolicus flgM mutagenesis screen, of which 25 were Lac⁺ on Mac-lac indicator medium. Twelve Lac⁺ colonies were sequenced, and eight had either single base pair changes or deletions in FlgM (Fig. 6 and Table 3). The remaining four had multiple mutations, and they were excluded from the study. All strains with A. aeolicus flgM mutations were assayed for σ²⁸ activity by use of β-galactosidase assays to compare the levels of fliC-lac expression with a strain harboring wild-type A. aeolicus flgM (Table 3).

FIG. 6.

Summary of mutations isolated in A. aeolicus flgM. rbs, ribosome binding site.

TABLE 3.

Summary of mutations isolated in A. aeolicus flgM

Strain	Mutation relative to the start codon	Commentsa	Change in % of codon frequency from WT to mutant	% fliC-lac β-galactosidase activity relative to WT	Relative activityb
TH8125		WT		100	1
TH8200		ΔflgM		395	4.0
TH8604	A→G −6 bp	RBS		116	1.2
TH8605	A→C −5 bp	RBS		316	3.2
TH8606	A→G −4 bp	RBS		95	0.95
TH8607	A→G +1 bp	ATG→GTG M1V	26.3 to 26.4	168	1.7
TH8608	A→G +56 bp	AAG→AGG K19R, rare codon	11.7 to 1.2	116	1.2
TH8609	ΔA +55-56 bp	Frameshift after codon 18		395	4.0
TH8610	ΔA +177 bp	Frameshift after codon 59		374	3.7
TH8611	ΔA +199 bp	Frameshift after codon 67		437	4.4

^aRBS, ribosome binding site.

^bRelative activity calculated from β-galactosidase activities in column 5.

Of the mutations characterized, several were found in the ribosome binding site, one altered in the start codon, and another introduced a rare codon; all mutations presumably lowered the levels of FlgM, thereby enabling increased σ²⁸ activity (Fig. 6 and Table 3). Three mutations resulted in frameshifts in FlgM after codon positions 18, 59, and 67. Frameshift mutation after codon 67 suggests that the last 21 amino acids in FlgM are important for inhibition of σ²⁸ activity. Previous studies of FlgM show the C terminus is important for σ²⁸ interaction (9, 41). Alternatively, the resulting frameshift mutation could destabilize FlgM protein; therefore, additional biochemical methods are needed to support the in vivo findings.

We found a bias in favor of A. aeolicus flgM null mutant isolation, because the screen was based on the loss of anti-σ²⁸ activity. Previous isolations of FlgM mutants of S. enterica serovar Typhimurium defective in interaction with S. enterica serovar Typhimurium σ²⁸ indicated a bias against flgM null alleles. This is because S. enterica serovar Typhimurium strains carrying flgM null alleles and remaining fliA⁺ are sick, and excess σ²⁸ activity is lethal in S. enterica serovar Typhimurium. The FlgM mutants obtained were predominantly single amino acid substitution mutants that retained some anti-σ²⁸ activity (5, 9). Since it was easy to isolate flgM null alleles of A. aeolicus in a strain expressing A. aeolicus σ²⁸, we conclude that excess A. aeolicus σ²⁸ activity, unlike excess S. enterica serovar Typhimurium σ²⁸ activity, does not inhibit cell growth.

DISCUSSION

We have demonstrated the use of S. enterica serovar Typhimurium as an in vivo heterologous system to assess the sigma factor activities of homologs from other genetically intractable species, such as A. aeolicus and C. trachomatis. We demonstrate that the λ-Red technology provides a simple method to replace S. enterica serovar Typhimurium genes with functional homologues from bacterial species that are normally genetically intractable. Chromosomal replacement of both the A. aeolicus and C. trachomatis fliA⁺ genes complemented an S. enterica serovar Typhimurium fliA mutant for motility and production of FliC flagellin. While complementation by A. aeolicus fliA⁺ was not as robust as that with C. trachomatis fliA⁺, these assays were done without the aid of a rare-codon tRNA plasmid that was required to obtain large amounts of A. aeolicus FliA from expression in E. coli for crystallization (41). Indeed, by not using a rare-codon tRNA plasmid in these studies, the sensitivity of our genetic selection allowed for the isolation of a class of A. aeolicus fliA mutants with increased efficiency of translation. In addition, we isolated mutations in A. aeolicus of the class expected to be defective for σ²⁸/FlgM interactions: the increase in class 3 transcription was only in the presence of FlgM and not in the absence of FlgM.

We found that FlgM inhibition of S. enterica serovar Typhimurium and A. aeolicus σ²⁸-dependent class 3 transcription was species specific. A. aeolicus FlgM would inhibit only A. aeolicus σ²⁸ activity and not S. enterica serovar Typhimurium σ²⁸ activity; S. enterica serovar Typhimurium FlgM would inhibit only S. enterica serovar Typhimurium σ²⁸ activity and not A. aeolicus σ²⁸ activity. We also tested the possibility that RsbW was a negative regulator of C. trachomatis σ²⁸, as had been suggested previously (39). However, we found that RsbW did not inhibit C. trachomatis σ²⁸ in S. enterica serovar Typhimurium. Either RsbW does not inhibit C. trachomatis σ²⁸ activity or other factors are required for such an activity to be observed.

The ability to replace the S. enterica serovar Typhimurium fliA and flgM genes with homologous genes of genetically intractable organisms allowed us to use standard Salmonella genetic methods to study interactions of sigma and anti-sigma factors from bacterial species that are otherwise difficult to analyze genetically. It also provided an additional benefit in that plasmid artifacts are avoided when such genes are expressed from the normal S. enterica serovar Typhimurium chromosomal location. We also demonstrate the ability to use λ-Red recombination to replace any gene to be targeted for mutagenesis with the tetRA element. The tetRA element is an excellent tool for targeted mutagenesis because of the ability to select for inheritance of (Tc^r) and replacement of (Tc^s) the tetRA element. This general strategy could be employed with any bacterial species where the λ-Red system can be expressed and is functional, and a selectable/counterselectable marker(s), such as tetRA or sacB linked to a drug-resistance gene, can be used to perform targeted mutagenesis.