IL-6 exacerbates calcium oxalate kidney stones by promoting inflammatory responses and crystal adhesion via p38 MAPK signaling activation

Abstract

Kidney stones (KS) represent a complex and globally prevalent disease; however, the mechanisms underlying their formation are not fully understood. Inflammatory responses and crystal aggregation are recognized as critical factors in KS pathogenesis. Interleukin-6 (IL-6) is widely recognized as an inflammatory mediator; however, its precise contribution to calcium oxalate (CaOx) KS formation has not been fully elucidated. This study aimed to explore the detailed mechanism through which IL-6 influences CaOx KS formation. To achieve this, a rat model for CaOx nephrolithiasis was developed by administrating drinking water containing 1% ethylene glycol (EG). Concurrently, an in vitro model of cellular injury was established by treating human renal proximal tubular epithelial cells (HK-2) with calcium oxalate monohydrate (COM) crystals. Employing various molecular biology and immunological techniques, the specific role of IL-6 in the formation of CaOx stones was comprehensively examined. The data indicated significantly elevated IL-6 expression in both in vivo and in vitro models of CaOx KS. Increased IL-6 exacerbated inflammatory responses during stone formation, triggered activation of the p38 MAPK signaling pathway, and promoted higher expression levels of osteopontin (OPN) and CD44. These molecular alterations enhanced adhesion between renal tubular epithelial cells (RTECs) and crystals, consequently facilitating crystal aggregation, nucleation, and accelerating overall stone formation. In summary, the study illustrates that IL-6 accelerates CaOx KS development through activation of the p38 MAPK signaling pathway, amplifying inflammation, and promoting crystal-cell adhesion. Thus, IL-6 emerges as a promising therapeutic target for interventions in CaOx nephrolithiasis.

Introduction

Kidney stones (KS) represent a prevalent chronic disease worldwide, characterized by high rates of incidence and recurrence. Among the five main types of nephrolithiasis, calcium oxalate (CaOx) stones constitute the largest proportion. Current understanding of their pathogenesis primarily focuses on two mechanisms: alterations in urine composition and inflammatory oxidative stress (OS) pathways. Epidemiological studies indicate that the prevalence of KS in China is around 6.4%, suggesting roughly one in seventeen adults are affected. Importantly, men aged 31 to 60 years demonstrate a significantly higher prevalence compared to women [1–3]. In North America, KS prevalence ranges from roughly 7% to 13%, whereas Europe reports figures between 5% and 9% [4]. Despite proactive therapeutic measures, the recurrence rate of KS remains as high as 50% [5]. This limitation arises because mechanical lithotripsy or surgical interventions alone cannot fully address underlying inflammatory responses and adhesive interactions between renal tubular cells and crystals. Therefore, identifying precise and effective molecular targets is essential for preventing KS recurrence.

As a critical inflammatory cytokine, IL-6 plays an essential role in inflammation. Prior studies using mouse models with EG-induced CaOx KS revealed a significant positive correlation between elevated IL-6 levels and the OS marker 8-OHdG. Moreover, inhibiting IL-6 release reduced renal inflammatory injury and demonstrated notable effectiveness against uric acid stone formation [6]. Nonetheless, the precise mechanisms behind these observations remain uncertain. Mitogen-activated protein kinases (MAPKs) represent a group of serine/threonine kinases primarily consisting of three subfamilies: extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38 MAPK. MAPKs transduce extracellular signals to the nucleus, orchestrating cellular responses to diverse stimuli. Recent findings identified significantly elevated p38 MAPK expression in rat models of KS, indicating its involvement in the pathogenesis of nephrolithiasis [7, 8].

OPN is a non-collagenous acidic glycoprotein closely associated with calculous disease pathogenesis. OPN, serving as an inflammatory biomarker, is associated not only with OS and inflammatory damage but also promotes renal epithelial cell-crystal adhesion through its phosphorylated form, enhancing CaOx crystal aggregation and thereby accelerating stone formation [9, 10]. CD44, a type I transmembrane glycoprotein, functions as a crucial cell surface adhesion molecule, mediating cellular adhesion, migration, and inflammation. Experimental models exhibiting increased CD44 expression further confirm its pivotal involvement in CaOx KS pathogenesis [11, 12].

Building upon these insights, we hypothesized that IL-6 mediates inflammation and tissue injury related to CaOx KS via the p38 MAPK signaling pathway, thereby influencing the progression of nephrolithiasis. This investigation confirmed that IL-6 activates the p38 MAPK signaling pathway, upregulates OPN and CD44 expression, amplifies inflammatory responses, and enhances crystal adhesion to cells, ultimately promoting CaOx stone formation. These findings emphasize promising therapeutic targets to elucidate pathogenic mechanisms and improve therapeutic strategies for CaOx nephrolithiasis.

Materials and methods

Animal experiments

All animal procedures in this study received approval from the Animal Ethics Committee of Guangxi Medical University. Six-week-old male Sprague-Dawley (SD) rats, free from specific pathogens and weighing 160–200 g, were utilized. Animals were maintained under standardized laboratory conditions and acclimated for one week prior to the experimental procedures.

Each experimental subgroup consisted of six rats, organized as follows:

(1) Blank control group (RC group): Rats received normal drinking water for 28 consecutive days and intraperitoneal (IP) injections of equal volumes of normal saline at designated time points.

(2) CaOx KS group (EG group): Rats received drinking water containing 1% EG (CAS: 107-21-1) for 28 consecutive days to induce stone formation, along with IP injections of normal saline at designated times.

(3) IL-6 purified protein intervention group (RI group): Rats received IP injections of recombinant rat IL-6 protein (MCE, Cat# HY-P7103A) at 100 µg/kg [13], administered twice, 14 days apart. The total duration was 28 days.

(4) p38 MAPK inhibitor intervention group (RS group): Rats received IP injections of p38 MAPK inhibitor SB203580 (MCE, Cat# HY-112349) at 5 mg/kg [14], administered twice, 14 days apart. The total duration was 28 days.

(5) Combined IL-6 and p38 MAPK inhibitor intervention group (R + I+S group): Rats received combined IP injections of recombinant rat IL-6 (100 µg/kg) and p38 MAPK inhibitor SB203580 (5 mg/kg), administered simultaneously at two time points 14 days apart, for a total experimental period of 28 days.

At the conclusion of the experiments, rats were euthanized via pentobarbital sodium overdose. Kidney tissues were harvested and stored at -80 °C for downstream analyses.

Cell culture

The human renal proximal tubular epithelial cells (HK-2) was sourced from a government-certified cell repository in Shanghai, China. Cells were cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS) under standard conditions. Cells reaching approximately 80% confluence were dissociated with trypsin, resuspended, counted, and evenly seeded into 10-cm culture dishes. Cultures were allowed to stabilize before intervention. Recombinant human IL-6 protein (MCE, Cat# HY-P7044), SB203580 (MCE, Cat# HY-112349), and COM crystals (Shyuanye, Cat# S66467-500 g) were dissolved in medium for subsequent use.

Cellular grouping and intervention

An in vitro model of COM-induced HK-2 cell injury was established using COM concentrations of 0, 0.5, 1.0, 1.5, and 2.0 mM for 24 h, determining 1.0 mM as optimal for further experiments. The groups were:

(1) Blank control group (CC group): Cells cultured under standard conditions without intervention.

(2) CaOx intervention group (COM group): Cells at 80%-90% confluence treated with 1.0 mM COM for 24 h. Cells were harvested after intervention.

(3) IL-6 purified protein intervention group (CI group): Cells at 80%-90% confluence treated with 20 ng/mL [15] recombinant human IL-6 for 24 h, harvested after intervention.

(4) p38 MAPK inhibitor intervention group (CS group): Cells at 80%-90% confluence treated with 20 µmol/L [16] p38 MAPK inhibitor (SB203580) for 24 h, harvested after intervention.

(5) IL-6 combined with p38 MAPK inhibitor group (C + I+S group): Cells at 80%-90% confluence were pretreated with 20 µmol/L p38 MAPK inhibitor for 2 h, followed by addition of recombinant human IL-6 protein (20 ng/mL) for an additional 24 h, then harvested.

(6) CaOx + IL-6 intervention group (COM + I group): Cells treated initially with 1 mM COM for 24 h, followed by recombinant human IL-6 (20 ng/mL) for an additional 24 h, then harvested.

(7) CaOx + p38 MAPK inhibitor intervention group (COM + S group): Cells pretreated with 20 µmol/L p38 MAPK inhibitor for 24 h, followed by addition of 1 mM COM for an additional 24 h, then harvested.

(8) CaOx + IL-6 + p38 MAPK inhibitor group (COM + I + S group): Cells pretreated simultaneously with recombinant human IL-6 (20 ng/mL) and 20 µmol/L p38 MAPK inhibitor for 24 h, followed by addition of 1 mM COM for an additional 24 h, then harvested.

Gene regulation

To inhibit IL-6 expression, specific siRNA plasmids were constructed and purchased (Sea Star Biotechnology Company). siRNA plasmids were dissolved in DEPC-treated water. For transfection, 5 µL of siRNA was mixed with 15 µL of serum-free medium and incubated for 5 min. Separately, 5 µL of Lipofectamine 3000 transfection reagent (Living, Cat# C1055) was mixed with 15 µL of serum-free medium (Biosharp, Cat# BL1524B). Diluted siRNA and transfection reagent were gently combined, incubated for 20 min to form complexes, and added to HK-2 cells cultured in serum-free medium. Cells were incubated under standard conditions for 6–8 h, then the medium was replaced with fresh complete medium for an additional 24 h. Following recovery, the medium was removed, and cells underwent COM intervention (1 mM) for 24 h before subsequent analyses.

Cell–crystal adhesion

Prior to experimental treatment, the culture medium was aspirated, and 3 mL of Hank’s Balanced Salt Solution (HBSS, Solarbio, Cat# H1025) was applied to the cells. Samples were agitated on an orbital shaker at 150 rpm for 2-minute cycles, repeated four times. HBSS was then replenished, and the samples were immediately observed and recorded using an inverted microscope. The residual crystal area was quantified using ImageJ software (version 1.53s, USA).

Von Kossa staining

Paraffin-embedded kidney sections were deparaffinized, rehydrated, and rinsed. Sections were incubated with 5% silver nitrate under UV illumination for 10 min, followed by thorough washing. Residual silver was removed using 5% sodium thiosulfate for 2 min. After counterstaining with nuclear fast red or hematoxylin, sections were dehydrated, cleared, and coverslipped. Calcium deposits appeared black or dark brown under microscopy, facilitating evaluation of renal histopathology and crystal deposition.

Quantitative real-time reverse transcription PCR (qPCR)

Total RNA was isolated from both cultured HK-2 cells and rat kidney outer medulla tissues using RNAiso Plus reagent (TAKARA, Cat# 9108). Complementary DNA (cDNA) was synthesized employing the PrimeScript™ FAST RT reagent Kit with gDNA Eraser (TAKARA, Cat# RR092A) to remove potential genomic DNA contamination. Quantitative real-time PCR (qPCR) was conducted using the TB Green^® Premix Ex Taq™ II FAST reagent kit (TAKARA, Cat# CN830A) on a SYBR Green-based detection platform (Gentier, China). Relative expression levels of target genes were normalized to the geometric mean of GAPDH or β-actin and quantified using the 2^−∆∆Ct method. Primer sequences are provided in Table 1.

Table 1.

Primer pairs used for reverse transcription polymerase chain reaction

Gene	Forward primer sequence(5′→3′)	Reverse primer sequence(5′→3′)
GAPDH-Human	GTCAAGGCTGAGAACGGGAA	AAATGAGCCCCAGCCTTCTC
GAPDH-Rat	CCCCTTCATTGACCTCAACTA	TGGTGGTGAAGACACCAGTAGA
β-Actin-Rat	AAATGAGCCCCAGCCTTCTC	GACTCATCGTACTCCTGCTTGCTG
IL-6-Human	GGTACATCCTCGACGGCATCT	GTGCCTCTTTGCTGCTTTCAC
IL-6-Rat	GTGGCTAAGGACCAAGACCA	GGTTTGCCGAGTAGACCTCA
p38 MAPK-Human	AGATAAGCAGGGGGTGTCCC	ATATTTGGTCCGTGGGCTGC
p38 MAPK-Rat	TTACCGATGACCACGTTCAGTTTC	AGCGAGGTTGCTGGGCTTTA
OPN-Human	TCACACATGGAAAGCGAGGAGTTG	ACTGTCCTTCCCACGGCTGTC
OPN-Rat	GCCTGACCCATCTCAGAAGC	CATGGTCTCCGTCGTCATCG
CD44-Human	TACATCCTCACATCCAACACC	GTGCCATCACGGTTAACAATAG
CD44-Rat	CTGGCACAGCAGCAGATC	GGTGGGCAAGGTGGTATT

All primers used in this study were designed and synthesized by Sangon Biotech Co.,Ltd

Western blotting (WB)

Total protein extracts were prepared from cultured cells and rat renal outer medulla tissues using RIPA buffer (Solarbio, Cat# R0010) supplemented with PMSF (Solarbio, Cat# P0100) and phosphatase inhibitors (Solarbio, Cat# P1260). Protein concentrations were determined, and equal amounts were resolved via SDS-PAGE (Seven, Cat# SW143-02). Proteins were then transferred onto PVDF membranes (Millipore, Cat# IPVH00010) pre-activated in methanol. Following blocking and washing, membranes were incubated overnight at 4 °C with primary antibodies against IL‑6, p38 MAPK, phosphorylated p38 MAPK, OPN, CD44, and GAPDH (Table 2). After six washes with TBST, membranes were incubated with appropriate secondary antibodies for 1 h. Subsequent washes were performed six times before chemiluminescent detection using Meilunbio kit (Cat# MA0186-1) and visualization on a Tanon infrared imaging system (China). Protein band intensities were quantified using ImageJ software, normalizing to GAPDH as an internal control.

Table 2.

Antibodies used in this study

Gene	Origin	Manufacturer	Catalogue Number	Concentration ratio
GAPDH	Britain	Abcam	ab181602	1:10000
IL-6	China	Cohesion	CQA3710	1:1000
p38 MAPK	China	Abmart	T55600	1:1000
Phospho-p38 MAPK	China	Abmart	TP56391S	1:1000
OPN	China	Cloud-Clone	PAA899Ca01	1:1000
CD44	China	Affinity	DF6392	1:1000
HRP-conjugatedGoatAnti-RabbitIgG(H + L)	China	Proteintech	SA00001-2	1:10000/1:5000

Immunohistochemistry (IHC)

Kidney tissue specimens were fixed in formalin, paraffin-embedded, and sectioned. Sections underwent three washes with distilled water, followed by antigen retrieval and blocking. They were incubated overnight at 4 °C (≥ 12 h) with primary antibodies against p38 MAPK and OPN (Table 2). After washing, appropriate secondary antibodies were applied. Sections were then color-developed, counterstained, differentiated, dehydrated, and mounted. Positive staining areas were quantified under light microscopy using ImageJ software.

Immunofuorescence (IF)

For immunofluorescence analysis, paraffin-embedded sections were sequentially sectioned, deparaffinized, and subjected to antigen retrieval and blocking. Sections were incubated overnight at room temperature with primary antibodies targeting p38 MAPK and OPN (Table 2). Following extensive washing, corresponding secondary antibodies were applied at 37 °C. Sections were rinsed with PBS, counterstained with DAPI, and mounted. Fluorescent images were acquired with a fluorescence microscope, and mean fluorescence intensity was quantified using ImageJ software.

Cell viability

Cell viability was assessed using a CCK-8 assay kit (Biosharp, Cat# BS350B). Post-treatment, culture medium was removed, and pre-prepared CCK-8 solution was added to each well. After a 1-hour incubation, absorbance at 450 nm was measured using a microplate reader. Cell viability was calculated as: (absorbance of treated group - absorbance of blank) / (absorbance of control group - absorbance of blank).

Enzyme-linked immunosorbent assay (ELISA)

IL-6 concentrations were determined via ELISA (JONLNBIO, Cat# JL14113). Samples and standards were incubated with the reagent mixture, and absorbance was measured at 450 nm using a microplate reader.

Statistical analysis

All statistical analyses were performed using GraphPad Prism (version 9.0.0). Data are expressed as mean ± SEM. Comparisons between two groups were made using Student’s t-test, while one-way ANOVA was employed for multiple group comparisons. A p-value < 0.05 was considered statistically significant, with *p < 0.05, **p < 0.01, and ***p < 0.001 indicating levels of significance.

Results

In CaOx KS, expression levels of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 were significantly increased

To investigate these molecular changes and their regulatory mechanisms, a stable rat model was first established. SD rats were administered drinking water containing 1% EG for 28 days to establish a model of CaOx nephrolithiasis. Von Kossa staining revealed pronounced CaOx crystal deposition within renal tissues of the model group (Fig. 1A, C). WB and qPCR analyses showed significantly elevated protein (Fig. 1B, D-H) and mRNA (Fig. 1I-L) levels of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 in the model group. These results confirmed simultaneous upregulation of these molecules during CaOx stone formation.

Complementary in vitro experiments were performed to confirm these findings and optimize conditions. HK-2 cells were exposed to COM for 24 h. Expression of IL‑6, p38 MAPK, p‑p38 MAPK, OPN, and CD44 increased gradually with rising COM concentrations, reaching a peak at 1.0 mM, and then decreased at higher doses. The 1.0 mM concentration yielded the highest and most stable expression at both protein (Fig. 1M-R) and mRNA levels (Fig. 1S-V). Therefore, 1.0 mM COM was chosen as the optimal concentration for subsequent in vitro mechanistic studies.

Fig. 1.

The expression levels of IL‑6, p38 MAPK, p‑p38 MAPK, OPN, and CD44 were increased in renal tissues containing CaOx stones. A, C Representative images (A) and quantitative data (C) from Von Kossa staining indicate calcium deposition in kidneys of control and EG groups. B, D-H Representative Western blot (B) and quantitative analyses (D-H) show protein expression of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44. I-L qPCR analyses demonstrate mRNA expression of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44. M-R Representative WB (M) and quantitative data (N-R) show protein expression levels in HK-2 cells exposed to increasing concentrations of COM. S-V qPCR results indicate mRNA expression levels in HK-2 cells at varying COM concentrations

At the cellular level, IL-6 positively regulated OPN and CD44 expression via the p38 MAPK pathway

To clarify the regulatory mechanism of IL‑6 on the p38 MAPK pathway and downstream effectors OPN and CD44, recombinant rat IL‑6 protein, p38 MAPK inhibitor (SB203580), or both were administered intraperitoneally to SPF-grade Sprague-Dawley rats. WB and qPCR analyses (Fig. 2A-J) indicated increased IL‑6 expression in the EG model group and IL‑6-treated group. These observations confirmed the robust inflammatory response during stone formation, suggesting IL‑6 as a key inflammatory mediator in nephrolithiasis.

Further analysis demonstrated significant upregulation of IL‑6, p38 MAPK, p‑p38 MAPK, OPN, and CD44 in the EG group. Treatment with IL‑6 alone markedly increased p‑p38 MAPK, OPN, and CD44 expression, indicating that IL‑6 effectively activates the p38 MAPK pathway and downstream stone-related molecules. Conversely, SB203580 treatment significantly suppressed p38 MAPK and p‑p38 MAPK expression and reduced OPN and CD44 levels, indicating effective inhibition of the pathway.

To verify whether IL-6 regulates downstream molecules through p38 MAPK, combined IL-6 and SB203580 interventions were conducted. Results demonstrated significantly reduced p-p38 MAPK, OPN, and CD44 expression compared to IL-6 alone, confirming that IL-6-induced regulation of OPN and CD44 is dependent on p38 MAPK activation.

IHC and IF staining confirmed these relationships in renal tissues. Expression levels of OPN and p38 MAPK were highest in the EG group, lower in the IL-6 group, and markedly reduced by SB203580 treatment. Combined IL-6 and SB203580 treatment further decreased OPN and p38 MAPK levels (Fig. 2K-P). These results at the tissue level are consistent with protein and mRNA findings, reinforcing the role of the IL-6/p38 MAPK/OPN/CD44 axis in CaOx KS formation. Overall, these findings demonstrate that IL-6 activates the p38 MAPK pathway, increases phosphorylation, and upregulates OPN and CD44 expression, highlighting its critical regulatory role in nephrolithiasis pathogenesis. This study provides new insights into inflammatory mechanisms underlying stone formation.

Fig. 2.

IL-6 upregulates OPN and CD44 expression through a p38 MAPK-dependent mechanism. A-F Representative immunoblots (A) and quantitative data (B-F) for IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 in renal tissues of the RC, EG, RI, RS, and R + I+S groups. G-J mRNA expression levels in kidney tissues quantified by qPCR. K-M Representative IHC images (K) and quantitative analyses (L, M) of OPN (L) and p38 MAPK (M) in kidneys. N-P IF images (N) showing renal OPN (O) and p38 MAPK (P) expression across groups

Knockdown of IL-6 inhibits p38 MAPK pathway activation and reduces OPN and CD44 expression in RTECs following COM interventin

To elucidate the contribution of IL-6 to CaOx kidney stone formation, IL-6 expression was silenced in HK-2 cells via siRNA transfection. Following exposure to COM crystals, phosphorylation of key p38 MAPK pathway proteins and expression of downstream adhesion molecules, OPN and CD44, were assessed. Quantitative PCR demonstrated that IL-6 knockdown effectively reduced IL-6 mRNA levels and protein secretion in the culture supernatant (Fig. 3A-E). Crystal adhesion assays demonstrated that IL-6 knockdown markedly decreased COM crystal adhesion to HK-2 cells (Fig. 3F-G). Mechanistically, IL-6 knockdown attenuated phosphorylation of p38 MAPK pathway components and downregulated OPN and CD44 expression at both transcriptional and translational levels (Fig. 3H-M). These findings indicate that IL-6 facilitates CaOx stone formation through activation of the p38 MAPK pathway, upregulating OPN and CD44, thereby enhancing COM crystal adhesion and aggregation on RTECs.

Fig. 3.

IL-6 deficiency inhibits RTEC adhesion and cell-crystal interactions. A-D qPCR analysis of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 mRNA expression in HK-2 cells following siRNA-mediated IL-6 knockdown. E ELISA assay for IL-6 levels in HK-2 cell culture medium (y = 0.0136x + 0.0757, R² = 0.993). F-G Representative images (G) and quantification (F) of HK-2 cell-crystal adhesion. H-M Representative immunoblots (H) and corresponding quantification (I-M) showing protein expression levels of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 after IL-6 knockdown

IL-6 upregulates OPN and CD44 expression via activation of the p38 MAPK pathway in vitro

Based on in vivo findings, the direct regulatory relationship between IL-6 and the p38 MAPK pathway was examined in an HK-2 cell model. Cells were exposed to 1.0 mM COM crystals to simulate KS microenvironments. WB analysis (Fig. 4A-F) revealed significantly increased protein levels of IL-6, total p38 MAPK, p-p38 MAPK, OPN, and CD44 after COM stimulation. In the CI experimental group, recombinant human IL-6 protein alone significantly increased p-p38 MAPK levels, accompanied by elevated OPN and CD44 expression. These results indicate IL-6 is an upstream activator of the p38 MAPK pathway, sufficient to trigger downstream signaling. In contrast, SB203580, a p38 MAPK inhibitor (group CS), effectively inhibited p38 MAPK, p-p38 MAPK, OPN, and CD44 expression. Notably, combined SB203580 and IL-6 treatment significantly reversed IL-6-induced increases in p-p38 MAPK, OPN, and CD44. qPCR results were consistent with these protein-level changes (Fig. 4G-J). In summary, these data strongly indicate that IL-6 activates the p38 MAPK pathway, promoting downstream expression of OPN and CD44 in CaOx KS formation.

Fig. 4.

IL-6 overexpression promotes CaOx crystal deposition and KS formation. A-F Representative WB (A) and corresponding quantitative data (B-F) showing protein levels of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 in HK-2 cells (CC, COM, CI, CS, and C + I+S groups). G-J qPCR analysis of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 mRNA levels in kidneys

IL-6 induces OPN and CD44 expression in CaOx-treated HK-2 cells via the p38 MAPK pathway

To further clarify the role of the IL-6/p38 MAPK pathway in CaOx KS pathogenesis, we investigated whether pharmacological inhibition of IL-6 or p38 MAPK (SB203580) affects inflammatory responses and crystal adhesion in HK-2 cells under CaOx exposure. Cell-crystal adhesion assays demonstrated that COM alone resulted in evident crystal adhesion (Fig. 5A-B). Supplementation with exogenous recombinant human IL-6 protein significantly enhanced crystal aggregation on the cell surface. Conversely, pharmacological inhibition of p38 MAPK signaling markedly reduced crystal adhesion. Importantly, combined treatment (COM + IL-6 + SB203580) significantly decreased crystal adhesion. These findings suggest that IL-6 promotes crystal deposition by activating the p38 MAPK pathway, enhancing RTEC adhesion.

Cell viability was assessed across experimental groups (Fig. 5C). ELISA analysis showed increased IL-6 protein concentration in the COM + I group. IL-6 levels in the COM + S group were intermediate, whereas the COM + I + S group had the highest IL-6 concentration (Fig. 5D). This phenomenon likely results from sustained p38 MAPK activation eliciting negative feedback mechanisms to limit inflammation. However, SB203580 inhibition removed this feedback control, potentially engaging additional pro-inflammatory pathways, thereby elevating IL-6 levels.

WB and qPCR analyses further supported the key role of the p38 MAPK signaling pathway in COM-induced inflammatory responses in HK-2 cells (Fig. 5E-N). Specifically, exposure to 1.0 mM COM for 24 h increased IL-6 expression and p38 MAPK activation (elevated p-p38 MAPK). IL-6 treatment (COM + I group) further enhanced p-p38 MAPK levels, indicating IL-6 positively regulates p38 MAPK signaling. Correspondingly, expression of downstream proteins OPN and CD44 increased. Treatment with the p38 MAPK inhibitor (SB203580) effectively blocked this signaling pathway. In the COM + I + S group, SB203580 strongly inhibited COM-induced p38 MAPK phosphorylation and markedly reduced OPN and CD44 expression compared to COM alone. Importantly, despite exogenous IL-6 stimulation in the COM + I + S group, p38 MAPK phosphorylation remained suppressed, and expression of OPN and CD44 was reduced to baseline or lower. These data strongly indicate that p38 MAPK is an essential downstream mediator through which IL-6 regulates OPN and CD44 expression.

Fig. 5.

Inhibition of the p38 MAPK pathway attenuates CaOx crystal aggregation, reduces cell-crystal adhesion, and alleviates IL-6-induced inflammation in HK-2 cells. A-B Representative images (A) and quantitative analysis (B) of cell-crystal adhesion. C HK-2 cell viability assessed by CCK-8 assay. D ELISA quantification of IL-6 levels in HK-2 cell culture medium. E-J Representative WB (E) and quantification (F-J) of IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 protein expression, in each treatment group (CC, COM, COM + I, COM + S, COM + I + S). K–N qPCR results showing IL-6, p38 MAPK, p-p38 MAPK, OPN, and CD44 mRNA expression

Discussion

KS, particularly those predominantly composed of CaOx, represent a significant public health concern worldwide. Their formation is a multifactorial process involving urine supersaturation, crystal nucleation, growth, aggregation, and retention within renal tissues. Recent research has highlighted the critical involvement of inflammation and OS in lithogenesis [17, 18]. In addition, cell-crystal adhesion is recognized as a crucial factor in CaOx KS formation [19]. Cell-crystal adhesion promotes the aggregation of dispersed CaOx crystals on the surface of RTECs. These crystal clusters subsequently serve as nuclei for stone formation. Conversely, studies have shown that targeted inhibition of molecules such as CDH4 [20] and thioredoxin-interacting protein [21], or overexpression of HIBADH [22], can suppress cell-crystal adhesion and thereby reduce CaOx stone formation.

CaOx nephrolithiasis is a chronic pathological condition. In the early stages, CaOx crystals in most patients generally lack the capacity for stable aggregation and retention and are eliminated in urine [23]. However, residual crystals can damage RTECs and disrupt the homeostasis of adhesion molecules. Injured epithelial cells then acquire enhanced adhesive properties, promoting the retention of additional CaOx crystals within renal tubules and facilitating Randall’s plaque formation [24]. Randall’s plaques act as ideal nucleation sites for CaOx stones. They promote crystal adhesion and progressive aggregation, ultimately leading to calculus formation [25, 26]. The present study demonstrates that IL‑6 activates the p38 MAPK pathway, thereby upregulating OPN and the adhesion molecule CD44. This process not only exacerbates inflammation but also enhances crystal adhesion to RTECs, providing important molecular insights into CaOx nephrolithiasis.

Using complementary in vivo and in vitro approaches, we observed that CaOx crystal deposition correlated closely with elevated IL-6 expression, activation of the p38 MAPK pathway, and increased levels of OPN and CD44. The coordinated upregulation of these factors suggests a potential causal link. As a pleiotropic cytokine, IL-6 is central to modulating both acute-phase responses and chronic inflammation [6, 27]. Elevated IL‑6 expression has been reported in several renal diseases, including polycystic kidney disease [28], chronic kidney disease [29], and diabetic kidney disease [30]. Increased IL‑6 levels activate NF‑κB and PI3K/Akt pathways, thereby intensifying inflammation and OS and aggravating renal injury. Conversely, inhibition of IL‑6 secretion can alleviate these pathological changes. IL‑6‑mediated activation of the Wnt/β‑catenin pathway is associated with the severity of inflammation and tubulointerstitial injury [31]. In addition, IL‑6 regulates ischemia/reperfusion‑induced kidney injury through the AKT/ERK pathway [32].

Under acidic conditions, IL‑6 also mediates crosstalk with fibroblasts. Previous studies have shown that IL‑6 acts as a key mediator of tubulointerstitial–fibroblast interactions, thereby promoting inflammatory responses [33]. Mesenchymal cells play an essential role in tissue repair and fibrotic remodeling. Meanwhile, CaOx crystal deposition has been identified as an important inducer of renal interstitial fibrosis [34–36]. These findings suggest a potential link between IL‑6‑mediated inflammation, CaOx nephrolithiasis, and renal fibrosis, which requires further investigation.

Interestingly, the role of IL‑6 may vary depending on the stage of CaOx nephrolithiasis. Activation of the IL‑6/JAK/STAT3 pathway induces DNA methylation within the promoter region of the D‑amino acid oxidase (DAO) gene, thereby suppressing its transcription through epigenetic regulation. Reduced DAO expression attenuates endogenous oxalate synthesis and decreases the risk of hyperoxaluria [27]. Based on these findings, we propose that CaOx crystals, acting as external stimuli, may increase the expression of inflammatory mediators such as IL‑6 and activate innate immune responses to maintain tissue homeostasis. If the stimulation is limited, the body’s regulatory mechanisms may further inhibit oxalate precursor production and reduce endogenous oxalate synthesis.

Nevertheless, IL‑6 clearly functions as a key initiator of inflammatory signaling and plays an essential regulatory role in inflammatory disease progression. In CaOx nephrolithiasis, RTECs are not only targets of crystal‑induced injury but also major sources of inflammatory mediators. In the current study, IL-6 expression was markedly elevated in EG-induced rat nephrolithiasis and in HK-2 cells challenged with CaOx crystals, aligning with clinical observations and prior reports. These findings support the notion that CaOx crystals function as “danger signals,” activating pattern recognition receptors on RTECs. Such activation engages innate immune pathways, including the NLRP3 inflammasome, leading to the secretion of pro-inflammatory cytokines such as IL-1β and IL-6 [36, 37]. This crystal‑induced inflammatory microenvironment provides favorable conditions for crystal retention and subsequent stone growth.

A key outcome of this investigation is the identification of the p38 MAPK pathway as a central mediator downstream of IL-6. This pathway acts as a versatile regulator of cellular stress responses, influencing processes such as inflammation, apoptosis, autophagy, and fibrosis [7, 8, 38]. Our study demonstrated that phosphorylation of p38 MAPK was elevated in the CaOx nephrolithiasis model. Notably, administration of recombinant IL-6 protein alone activated p38 MAPK and increased OPN and CD44 expression, an effect further enhanced by COM exposure. Conversely, pharmacological inhibition of p38 MAPK using the specific inhibitor SB203580, or genetic knockdown of IL-6 via siRNA, effectively reversed the upregulation of these molecules, irrespective of baseline conditions or stone-forming stimuli. These results indicate that IL-6 is a critical upstream activator of p38 MAPK, and that activation of p38 MAPK is indispensable for the expression of OPN and CD44.

This signaling pathway has significant biological implications, as it establishes a direct molecular link between inflammatory signaling mediated by IL-6 and cell adhesion events involving OPN and CD44. Traditionally, inflammation and crystal adhesion have been considered relatively independent factors in lithogenesis. However, our findings demonstrate that IL-6 functionally couples these two processes through the p38 MAPK pathway, integrating them into a coherent pathological cascade.

The roles of OPN and CD44 as downstream effectors of this pathway merit further investigation. OPN is known to have dual functions in renal inflammation, exhibiting both pro-inflammatory and protective effects. Systemic OPN confers renal protection by suppressing inflammation and OS, whereas macrophage-derived OPN promotes tissue injury [39]. A study using OPN knockout mice demonstrated that OPN mediates aldosterone-induced kidney damage, with OPN deficiency providing significant protection [40]. In nephrolithiasis, OPN similarly shows dual roles: some studies indicate OPN inhibits crystal growth and aggregation, exerting a protective effect [41], whereas broader evidence supports a pro-lithogenic role [42–45]. This divergence may be due to factors such as post-translational modifications, and local microenvironmental context. CD44 is well-established as a key adhesion molecule. Its expression increases significantly during inflammation or OS, enhancing cell adhesion. RTECs damaged by CaOx crystals similarly exhibit abnormal CD44 expression. Notably, inhibiting CD44 reduces crystal adhesion and suppresses crystal aggregation into stones [46–49]. Furthermore, miR-34a targets CD44 in HK-2 cells, reducing crystal adhesion both in vitro and in vivo, suggesting regulatory interplay between IL-6 and microRNAs in nephrolithiasis [12]. This study demonstrated that IL-6/p38 MAPK signaling increased OPN and CD44 expression. Cell-crystal adhesion assays showed that IL-6 stimulation markedly enhanced CaOx crystal adhesion, whereas p38 MAPK inhibition reduced this effect. Collectively, these findings demonstrate that the IL-6/p38 MAPK/OPN/CD44 axis amplifies inflammatory injury, promoting crystal adhesion to renal epithelial cells and preventing crystal clearance by urine flow. Consequently, this mechanism facilitates crystal retention and growth within the tubular lumen, contributing to stone formation. Sustained activation of p38 MAPK may also induce epithelial-mesenchymal transition (EMT) in renal tubular cells, promoting extracellular matrix accumulation and compromising basement membrane integrity, thereby facilitating crystal infiltration into the renal interstitium [50]. Moreover, IL-6 contributes to the recruitment and activation of inflammatory cells, including neutrophils and macrophages, amplifying the local pro-inflammatory cytokine milieu. This cascade exacerbates oxidative damage and fibrosis, establishing a chronic renal microenvironment associated with nephrolithiasis, potentially explaining high clinical recurrence rates [51, 52]. Pharmacological inhibition of this pathway using SB203580 reduced inflammation and crystal adhesion, highlighting its therapeutic potential for preventing stone recurrence. However, considering the broad physiological roles of p38 MAPK, kidney-targeted or localized treatment approaches are necessary to minimize off-target effects for clinical application.

Several limitations of this study require acknowledgment. Our investigation primarily focused on the IL-6/p38 MAPK/OPN/CD44 axis. Despite using SB203580, IL-6 expression remained partially elevated in both in vivo and in vitro models. Two possible explanations exist for this observation: negative feedback regulation of p38 MAPK, or activation of compensatory pathways following p38 MAPK inhibition due to persistent inflammatory stimuli like CaOx crystals. These findings suggest nephrolithiasis involves a complex regulatory network, with NF-κB, NLRP3 inflammasome, and reactive oxygen species signaling potentially participating in interactive crosstalk. Further research is necessary to clarify the integration of these pathways into the mechanism identified in this study. Additionally, inherent limitations exist in the experimental models. The EG-induced model primarily results in hyperoxaluria and crystal deposition within the cortical tubules, a condition that aligns more closely with nephrocalcinosis than with nephrolithiasis, and therefore differs substantially from the natural progression of human kidney stones. In humans, KS typically develop in association with the papillary ducts, either attached to Randall’s plaques or Randall’s plugs. Accordingly, crystals in the human kidney would initially contact collecting duct cells. In contrast, HK-2 cells are of proximal tubular origin, whereas human stone formation occurs in the collecting ducts. Cells from different tubular segments may respond differently to crystal stimuli and IL-6 signaling. To better recapitulate the physiological milieu of human lithiasis, these findings should be validated using physiologically relevant animal models or primary cultures from specific nephron segments, such as human renal collecting duct cells or tissue-based models of Randall’s plaque. These limitations highlight important directions for future studies. The potential differential functions of IL-6 across various stages of CaOx nephrolithiasis deserve further exploration. Such studies might employ exogenous stimulation in animal models with varying durations to simulate early and advanced disease stages. Moreover, ongoing controversy regarding the dual roles of OPN underscores the need to clarify functions and regulatory mechanisms of distinct splice variants or post-translational modifications within this pathway.

This study identifies a mechanistic pathway through which CaOx crystals promote nephrolithiasis. Crystal deposition stimulates RTECs to secrete IL-6, exacerbating local inflammation and activating p38 MAPK signaling. This leads to increased expression of OPN and the adhesion molecule CD44, enhancing crystal adhesion to tubular epithelia, thereby facilitating crystal retention and stone formation. These findings deepen our understanding of the inflammation-adhesion relationship central to lithogenesis. Furthermore, this pathway integrates cytokine signaling, kinase activation, and adhesion molecule expression into a coherent pathological framework. Crucially, IL-6 and p38 MAPK emerge as potential therapeutic targets. Future preventive strategies for high-risk patients may include anti-IL-6 antibodies, IL-6 receptor antagonists, or selective p38 MAPK inhibitors. By disrupting this inflammatory and adhesive cascade, these interventions could effectively reduce the incidence and recurrence of CaOx KS.

Conclusion

This study provides the first evidence that elevated IL-6 expression during CaOx nephrolithiasis not only exacerbates crystal-induced inflammatory injury in RTECs but also promotes crystal retention and stone formation. These effects are mediated via activation of the p38 MAPK pathway and subsequent upregulation of OPN and CD44 expression, thus enhancing crystal adhesion and aggregation. Therefore, IL-6 and p38 MAPK represent promising therapeutic or diagnostic targets for CaOx KS.

Author contributions

Fujie Liang：Writing-original draft，Experimental design and operation，Data organization. FuYou Guo：Experimental data analysis. Zeping Han：Animal model creation and Data analysis. You Xiang：Cell model construction and Data analysis. XiaoFeng Guan: Writing-review and editing, Methodology. Xiang Wang：Writing-review and editing, Project administration.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.