Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2026 May 18;12(3):e70997. doi: 10.1002/vms3.70997

Sex Determination of X and Y Separated Fresh Bull Sperm Using SRY Gene Copy Number Analysis

Ali Kadivar 1,✉, Arash Rasouli 1, Naser Shams Esfandabadi 1, Najmeh Davoodian 2, Hassan Nazari 2, Seyed Abbas Mirzaei 3,4, Ebrahim Ahmadi 2, Hamid Rahimi 2
PMCID: PMC13181913  PMID: 42148768

ABSTRACT

Background and Objective

The present study employed absolute quantitative PCR to determine the sex of sperm fractions after subjecting fresh bull semen to motility‐based separation using resiquimod, an agonist of Toll‐like receptors 7 and 8, which is supposed to selectively impair the motility of sperm carrying the X chromosome.

Methods

The upper and lower fractions obtained from fresh bull sperm following the swim‐up procedure, in both the control (untreated) and resiquimod‐treated groups, were subjected to sperm DNA extraction and absolute quantification by real‐time PCR to determine the number of Y chromosome‐bearing sperm. Ten different dilutions were prepared from the cloned plasmid with SRY sequence. Isolated sperms from the upper and lower layers in the resiquimod‐treated group and the fresh non‐treated sperm were also used for in vitro embryo production.

Results

The SRY gene copy number was significantly higher in the upper than the lower layer in the resiquimod‐treated group (p < 0.05). The sex of the embryos produced with sperm harvested from the upper and lower layers of the treatment group confirmed the results of the PCR, because the number of male embryos produced from the upper layer sperm was significantly higher than the lower layer (73.33% vs. 28.57%) (p < 0.05).

Conclusion

Considering that this sexing method is low‐cost and can be done with little facilities, it can be used in the future for the isolation of X and Y sperms in bulls.

Keywords: bull sperm, embryo, real‐time PCR, resiquimod, swim‐up

Resiquimod treatment and swim‐up significantly enriched Y‐bearing bull sperm in the separated fraction, confirmed by higher SRY copy numbers and increased male embryo production.

graphic file with name VMS3-12-e70997-g001.jpg

1. Introduction

Sex determination in mammals relies on fertilization by X‐ or Y‐bearing sperm. Artificial insemination with sexed semen in domestic animals offers economic and research benefits by enabling targeted production of desired sexes and selection of superior genetics (Yata 2022). This technology improves efficiency, profitability and sustainability in dairy and beef farming by reducing unwanted male calves in dairy and increasing growth‐advantageous male calves in beef production (Seidel 2003).

X‐ and Y‐bearing sperm differ in charge, size, density, DNA content and motility, with X sperm being negatively charged, larger, denser and containing more DNA, whereas Y sperm is positively charged and more motile (Pozdyshev et al. 2023; Quelhas et al. 2021). The presence of these and other identified differences has been utilized in various studies to separate X and Y sperm (De Canio et al. 2014; De Luca et al. 2014; Hendriksen et al. 1993; Wang et al. 1994). However, most of the techniques failed to gain commercial significance, leading to numerous efforts to develop more effective and cost‐efficient methods that can be implemented using simpler procedures.

Fluorescence‐activated cell sorting (FACS) separates X‐ and Y‐bearing sperm by staining DNA, considering that X sperm have about 4% more DNA. This method achieves 75%–90% accuracy in sperm sexing, is widely used in cattle, but is costly, time‐consuming, can harm sperm quality and requires processing within 7 h of collection (Garner et al. 2013).

Despite progress in semen sexing technology, developing a cost‐effective and efficient method to separate X‐ and Y‐bearing sperm without compromising quality remains difficult. Recently, research has focused on using toll‐like receptor (TLR) ligands to differentiate between the two sperm types. TLRs are present on immune and tumour cells and are crucial for innate immunity (Takeda et al. 2003). Surface TLRs include 1, 2, 4, 5, 6, 10 and 11, whereas TLRs 3, 7, 8 and 9 are found inside endosomes or lysosomes. In mammals, TLR7 and TLR8 are membrane glycoproteins located both inside the cell and on the cell surface, specifically on X‐bearing sperm—TLR7 on the tail and TLR8 in the midpiece—where they control ATP production; their agonists is demonstrated to aid in separating X‐ and Y‐bearing sperm (Umehara et al. 2019).

Resiquimod (R848), a TLR7/8 agonist, selectively lowers ATP production and motility in X‐bearing sperm, allowing their separation from Y‐bearing sperm. Umehara et al. (2020) demonstrated this by inhibiting glycolysis in mouse X‐sperm, and the method was also successfully applied to frozen bull sperm (Umehara et al. 2020).

Given the differences between fresh and frozen–thawed sperm in energy metabolism, motility patterns and membrane permeability, this method requires optimization for use with freshly ejaculated sperm, whereas optimizing this technique would enable the cryopreservation of fresh sex‐sorted sperm and facilitate its widespread application in cattle farms. Furthermore, because this method affects the motility of X‐sperm, developing an effective technique to separate sperm based on motility remains a major challenge. In our previous study, we treated fresh bull sperm samples with resiquimod and established an efficient method for separating high‐motility sperm from low‐motility sperm (Rasouli et al. 2024). In the present study, the effectiveness of motility‐based separation using resiquimod treatment in separating X‐ and Y‐bearing sperms in freshly ejaculated bull semen was investigated. The separated sperms were also used for in vitro embryo production, and the sex of the produced embryos was evaluated.

2. Materials and Methods

2.1. Media Preparation

All materials used in this study were manufactured by Sigma‐Aldrich (Germany); otherwise, it is mentioned. The required solutions were prepared by dissolving the powder of the compounds in deionized water (Milli‐Q) or appropriate solvents. On the basis of the need for each session, they were divided into smaller amounts and stored under appropriate conditions. HTF (human tubular fluid) medium, IVM medium, in vitro fertilization (IVF) medium and in vitro culture (IVC) medium were prepared as follows.

HTF medium composed of 0.1 M NaCl, 4.5 mM KCl, 0.4 mM MgSO4, 0.3 mM KH2PO4, 2.7 mM CaCl2, 0.45 mM pyruvate, 0.03 mM lactate, 0.01 mM HEPES‐free acid, 0.01 mM HEPES‐sodium salt, BSA (5 mg/mL) and antibiotics (0.06 mg/mL penicillin and 0.05 mg/mL streptomycin) was employed for sperm transport following semen collection and for sperm isolation using the swim‐up method.

Preincubated b‐TCM (9.5 mg M199, 2.1 mg NaHCO3, 0.04 mg Na pyruvate, 0.06 mg penicillin, and 0.05 mg streptomycin per mL) supplemented with 0.05 IU/mL FSH and 12% FBS was employed for maturing bovine cumulus–oocyte complexes (COCs). TALP (Tyrod's albumin lactate pyruvate) supplemented with heparin and 0.6% BSA was employed for coincubation of mature eggs with sperm cells and fertilization process. IVC‐SOF media composed of SOF (0.33 mM Na pyruvate, 3.3 mM Na lactate, 1.5 mM glucose, 25 mM NaHCO3, 1.19 mM KH2PO4, 1.78 mM CaCl2·2H2O, 0.5 mM MgCl2·6H2O, 107.7 mM NaCl, 7.16 mM KCl) plus amino acids (2% (v/v) BME amino acid solution, 1% (v/v) MEM amino acid solution) and antibiotics (0.06 mg/mL penicillin and 0.05 mg/mL streptomycin), 8% BSA (fatty acid‐free BSA), and 10% charcoal‐stripped FBS were used for culture of presumptive zygotes up to blastocyst stage (Davoodian et al. 2024).

2.2. Sperm Collection and Preparation

A total of 15 ejaculates (three replicates per bull) were collected using an artificial vagina from five clinically healthy registered Holstein bulls maintained at a frozen bovine semen production centre under standardized feeding and management conditions. During the sampling period, the mean ± SE age of the bulls was 32.2 ± 2.35 months (range: 27–41 months), and the mean ± SE body weight was 903.7 ± 25.01 kg (range: 842–970.5 kg). Following collection, semen samples were diluted 1:1 with HTF medium and transported to the laboratory at room temperature in a light‐protected container within approximately 1.5 h. During laboratory procedures, samples were maintained at 37°C, and all sperm handling was performed on a 37°C heated surface. Evaluation of these samples showed no significant differences in total sperm count or motility parameters, as assessed by CASA (Hooshmand Fanavar Company, Tehran, Iran) and a Neubauer chamber (Marienfeld, Lauda‐Königshofen, Germany) (Rasouli et al. 2024).

2.3. Sperm Isolation

Spermatozoa were isolated using the swim‐up technique as previously described (Rasouli et al. 2024). Briefly, aliquots containing 1 × 108 spermatozoa were allocated to control and resiquimod‐treated groups. Semen collected from each bull was divided into control and treatment groups. Therefore, no baseline difference in sperm motility existed between the groups, as each bull served as its own control. Samples were adjusted to a final volume of 1 mL with HTF medium, and 0.3 µM resiquimod was added to the treatment group, followed by incubation at 37°C for 20 min; the control group received no treatment. After centrifugation (400 × g for 3 min) in HTF medium, sperm pellets were placed at the bottom of a conical swim‐up device and incubated at 37°C for 20 min. Subsequently, 1 mL fractions were collected separately from the upper and lower layers, and sperm concentration in each fraction was determined.

The motility indices and sperm concentrations in the separated layers from this procedure were previously reported in our earlier study (Rasouli et al. 2024). For the present study, portions of the isolated sperm (2 × 106 spermatozoa from the upper and lower layers) from control and treated groups were stored at −20°C for subsequent DNA extraction. Another portion was used for in vitro fertilization of in vitro‐matured bovine oocytes in four biological replicates.

2.4. Sperm DNA Extraction

DNA was extracted from 2 × 106 spermatozoa collected from both the upper and lower phases of the separated medium using a DNA extraction commercial kit (Favorgen, Taiwan), according to the manufacturer's instructions. Briefly, samples were lysed in FABG buffer containing proteinase K and incubated at 60°C for 15 min. Following ethanol addition, the lysates were transferred to spin columns and centrifuged. The columns were sequentially washed with W1 buffer, dried by centrifugation, and DNA was eluted with 50 µL of pre‐warmed elution buffer. The extracted DNA was stored at −20°C until further analysis.

2.5. DNA Amplification and TA Cloning

PCR targeting the SRY gene (Bos taurus sex‐determining region Y) was performed on a Rotor‐Gene Q 6000 (Corbett Life Science, QIAGEN, Hilden, Germany) in a 20 µL reaction containing 10 µL RealQ Plus 2X Master Mix Green (Ampliqon, Denmark), 0.5 µM of each primer and 1 µL DNA. Primers were designed using NCBI Primer‐BLAST to ensure specificity, with sequences forward 5′‐ATGTTAGGGAGAGCAGCCAG‐3′ and reverse 5′‐TTTCTGTGGCCTCTTGGCTC‐3′, producing a 269 bp amplicon (GenBank: EU581861.1). PCR involved holding at 95°C for 15 min, 25 cycles of 95°C for 15 s, 62°C for 30 s, and 72°C for 30 s, followed by melting curve analysis (65–95°C). Products were verified by 1.5% agarose gel electrophoresis, and the target fragment was gel‐extracted for cloning.

2.6. Amplification and Purification of PCR Products by TA Cloning

Following amplification, the PCR product was cloned to obtain a stable and homogeneous copy of the target sequence. Cloning enables isolation of individual amplicons, minimizing the impact of low‐frequency variants or minor nonspecific products generated during PCR. The insert was propagated in a plasmid vector to provide a uniform and stable template for accurate sequence verification and downstream analyses. TA cloning was performed using the InsTAclone PCR Cloning Kit (Thermo Scientific, K1214). The ligation reaction (30 µL total volume) contained 3 µL of PTZ57R/T vector (0.17 pmol), 6 µL of 5× ligation buffer, required quantity of PCR product (0.52 pmol), and 1 µL of T4 DNA ligase, with nuclease‐free distilled water added to adjust the final volume. The following formula was used to calculate the required concentration of the target fragment:

3×55ng2880bp=xng270bp

The number 3 in the left formula is the 1–3 ratio of vector to the target fragment, the number 55 is the vector mass is needed. The number 2880 is the vector size, x is the required concentration of the target fragment and the number 270 is the size of target fragment.

Accordingly, the value of x was 15.46 ng, which was equivalent to 0.078 µL of the stock volume. Other reaction materials were combined according to the amounts mentioned above. The ligation mixture was incubated for 1 h at 22°C and overnight at 4°C. The ligation mixture was introduced into Escherichia coli DH5α competent bacteria to allow propagation of the recombinant plasmids. Following incubation, transformants were identified by their ability to grow in the presence of 100 µg/mL ampicillin, indicating successful acquisition of the plasmid‐encoded resistance marker. Ampicillin‐resistant colonies were selected as putative recombinant clones and subjected to further analysis to confirm the presence and integrity of the inserted PCR fragment (Figure 1).

FIGURE 1.

FIGURE 1

Open in a new tab

White colonies (arrows) arising from competent cells transformed with the ligation mixture containing vector PTZ57R/T, ligation buffer, PCR product and T4 DNA ligase. These colonies are selected on the basis of antibiotic resistant.

2.7. Performing Colony PCR

Three colonies were selected and were grown individually in 1 mL LB medium containing ampicillin for 5 h, and 800 µL of each was frozen along with 200 µL of glycerol. The remaining 200 µL was centrifuged to remove the liquid LB medium and the impurities of the culture medium were removed by two steps of washing with water and centrifugation (12,000 rpm for 10 min). Finally, the cell pellet was dissolved in 200 µL of water and incubated for 10 min at 95°C. The extracted DNA was used for PCR. PCR was performed as touchdown PCR. A total of 7 cycles from 57°C to 50°C and finally 25 cycles at 50°C were set based on the primer annealing temperature. Gel electrophoresis on 1.5% agarose gel was performed to visualize the PCR products. Plasmid was extracted from the clone that showed the best band and verified by Sanger sequencing.

2.8. Absolute Quantification

A standard graph was generated using ten serial dilutions of the cloned plasmid containing the SRY sequence. The initial dilution corresponded to 1:10,000 of the original plasmid stock, followed by nine successive two‐fold serial dilutions to obtain a graded dilution series. Quantitative PCR was performed using SRY‐specific primers, and the obtained Ct values were plotted against the logarithm of the calculated copy numbers to construct a linear standard curve and determine the equation. The plasmid copy number per millilitre was calculated on the basis of the total plasmid length (vector plus SRY insert) to determine molar concentration, which was then multiplied by Avogadro's number (6.022 × 1023) to obtain copies per millilitre. These calculated copy numbers were used to generate the standard graph.

2.9. Real‐Time PCR for Sorted and Unsorted Sperm

Real‐time PCR for absolute quantification of SRY gene copy number was performed using DNA extracted from 2 million sperm cells suspended in 1 mL of medium collected from the upper and lower fractions following the swim‐up procedure. PCR amplification was carried out under the same conditions described in Section 2.5, except that the number of cycles was increased to 40. The Ct values were used to determine the SRY gene copy number based on the standard curve. As 1 µL of extracted DNA was used in each PCR reaction and the total volume of extracted DNA was 50 µL, the copy number obtained from the standard curve was multiplied by 50 to estimate the total SRY gene copy number in each sample.

2.10. In Vitro Embryo Production by Sorted and Unsorted Sperm

Bovine ovaries were obtained from an industrial slaughterhouse and transported to the laboratory in normal saline at 30–37°C. After removal of surrounding tissues and repeated washing with physiological saline, follicles measuring 3–8 mm in diameter were aspirated using a 16‐gauge needle attached to a syringe. COCs were recovered from the follicular fluid. Only COCs containing oocytes with homogeneous cytoplasm and a normal morphological appearance, surrounded by at least three layers of granulosa cells, were selected for further use.

2.10.1. In Vitro Maturation

After three time washes in HEPES‐buffered M199 medium containing 5% FBS, each of 10 COCs were transferred to 50 µL drops of maturation medium (bicarbonate‐buffered M199 containing 10% FBS and 0.05 U of FSH per mL), and incubated in 5% CO2, 100% humidity and 39°C for 22–24 h.

2.10.2. In Vitro Fertilization

For IVF, mature oocytes with fully expanded cumulus cells were washed three times in HEPES‐buffered SOF medium supplemented with BSA and allocated into three experimental groups. In matured bovine COCs, the cumulus layer supports sperm fertilizing competence by establishing a favourable microenvironment of secretions and metabolites (Tanghe et al. 2003); hence, cumulus cells were retained in this study, as is commonly practised in bovine IVP protocols. Groups of 10 COCs were co‐incubated in 50 µL droplets of fertilization medium (F‐TALP containing 0.6% w/v BSA) with 50,000 spermatozoa at 39°C under 9% CO2 and maximum humidity for 22–24 h. Sperm samples included fresh non‐treated sperm, as well as sperm recovered from the lower (X‐fraction) and upper (Y‐fraction) layers. In the resiquimod‐treated groups, spermatozoa from the upper and lower layers were used separately for embryo production. Prior to fertilization, resiquimod was removed by transferring sperm to a new microtube, centrifuging at 400 × g for 4 min, and resuspending the pellet in resiquimod‐free medium. This washing procedure effectively eliminated residual resiquimod from both the medium and sperm cells. Four biological replicates were conducted.

2.10.3. In Vitro Culture

For IVC, presumptive zygotes, obtained following IVF, were mechanically denuded to remove residual cumulus cells and adherent spermatozoa. Zygotes were cultured in 20 µL droplets of IVC‐SOF medium supplemented with 0.8% (w/v) BSA under standard incubation conditions. The culture medium was renewed every 48 h, and embryos were subsequently transferred to fresh medium supplemented with 10% (v/v) charcoal‐stripped serum.

Cleavage rate was assessed on Day 2 post‐fertilization (Day 0 = IVF), and only cleaved embryos were maintained in culture. On Day 8, the numbers of total blastocysts, expanded blastocysts and hatched blastocysts were recorded. Fertilization rate was defined as the proportion of cleaved embryos relative to the number of mature oocytes, whereas blastocyst rate was calculated as the proportion of blastocysts relative to the number of cleaved embryos.

2.11. Embryo Sex Determination

Embryo sex determination was performed by PCR amplification of the SRY gene, with GAPDH used as an internal control to verify successful DNA extraction. To prevent interference from spermatozoa attached to the zona pellucida, embryos were treated with pronase to remove the zona layer. All blastomeres from each embryo were collected into microtubes and stored at −20°C until DNA extraction.

Genomic DNA was extracted using the Favorgen kit (Taiwan) according to the protocol previously described for sperm DNA extraction. Separate PCR reactions were performed for SRY and GAPDH. The GAPDH primer sequences were as follows: forward 5′‐AAGGCCATCACCATCTTCCA‐3′ and reverse 5′‐CCACCACATACTCAGCACCAGCAT‐3′ (accession no. Nc_037332.1) (Nakaya et al. 2009). This primer pair amplifies a 194 bp fragment from genomic DNA spanning an intron between exons 4 and 5; amplification from mRNA would yield a 76 bp product.

The SRY primer sequences were identical to those described previously in the section ‘DNA Amplification and TA‐Cloning’ (forward and reverse sequences as previously reported). PCR conditions for both SRY and GAPDH were identical to those used for SRY amplification in that section, except that 40 cycles were performed for embryo sex determination.

2.12. Statistical Analysis

Statistical analysis was performed using version 16 of SPSS software (SPSS Inc., Chicago, USA). Results were expressed as mean ± standard error, and differences between groups were considered significant at the p < 0.05. The calculated mean copy number of the SRY gene in the upper and lower layers of the control and treated groups in the absolute quantification method was analysed using independent t‐test. The percentage of fertilized embryos in the control, X‐ and Y‐containing sperm groups, and the percentage of male embryos in the X‐ and Y‐carrying sperm groups were compared using the chi‐square test.

3. Results

3.1. DNA Amplification and TA Cloning

The results of gel electrophoresis on 1.5% agarose gel after performing PCR are shown in Figure 2. Wells 2, 3, 5 and 6 show the specific amplified region of the SRY gene.

FIGURE 2.

FIGURE 2

Open in a new tab

Electrophoresis result after performing PCR for TA cloning. Wells 2, 3, 5 and 6 show the specific amplified region of the SRY gene. Well number 1 is the 100 bp ladder.

3.2. Colony PCR

Gel electrophoresis on 1.5% agarose gel was performed to visualize the PCR products after performing colony PCR. The distance between the two primers, along with the plasmid sequence, was about 200 bp, which, together with the ligated fragment, was about 500 bp. Clone number 3 showed the best band (Figure 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Electrophoresis result of the PCR products from colony PCR performed on ligated fragments. The expected fragment size, including the region between the two primers on the plasmid and the ligated insert, was approximately 500 bp. Numbers correspond to colony identifiers. Clone number 3 exhibited the strongest and clearest band. L: 100 bp ladder.

3.3. Absolute Quantification

Figure 4 shows the standard graph and the equation obtained for the resulting line in the absolute quantification method. On the basis of the obtained equation, the slope of the line was −3.158 and the efficiency was 2 (according to the Pfaffl equation, E = 10(−1/slope) for quantification of RT‐PCR). The results of absolute quantification using the SYR gene in the control and treatment group are given in Figure 5. In the control group, there was no significant difference in copy number of SRY gene between sperms collected from the upper and lower layers of the medium (p > 0.05), whereas the SRY gene copy number was significantly higher in the upper than the lower layer in the groups treated with resiquimod (p < 0.05). The SRY gene copy number in upper layer relative to lower layer was 0.88 in control group and 6.89 in resiquimod group. This shows a relative enrichment in Y‐bearing sperm in upper layer compared to lower layer.

FIGURE 4.

FIGURE 4

Open in a new tab

Standard graph constructed from 10 serial dilutions of cloned plasmid containing SRY sequence with corresponding equation for absolute quantification.

FIGURE 5.

FIGURE 5

Open in a new tab

Copy number of SRY gene in sperm from upper and lower layers of control and resiquimod‐treated groups.

3.4. In Vitro Embryo Production

The results of in vitro fertilization of mature oocytes using untreated and resiquimod‐treated sperm are presented in Table 1. There was no significant difference in the fertilization rates of oocytes fertilized in the control, X‐ and Y‐containing sperm groups. The number of male embryos in the Y‐sperm‐fertilized groups was significantly higher than that in the X‐sperm‐fertilized group (11 vs. 4) (p < 0.05).

TABLE 1.

Results of embryo production using in vitro fertilization with X‐ and Y‐containing sperm separated by resiquimod treatment.

Groups Number of mature oocytes Cleaved embryos (%) Blastocysts (%) Blastocysts examined for sexing Number of male embryos (%)
Control 71 41 (57.74) 14 (34.14) — —
Lower layer 67 40 (59.70) 14 (35) 14 4 (28.57)a
Upper layer 68 42 (61.76) 15 (35.71) 15 11 (73.33)b
Open in a new tab

Note: The number of cleaved embryos on Day 2 was used to assess the fertilization rate. The cleavage rate was calculated as the proportion of cleaved embryos relative to the total number of mature oocytes. The blastocyst rate on Day 8 was calculated as the proportion of blastocysts relative to the number of cleaved embryos. Different superscript letters (a, b) within the same column indicate a statistically significant difference between groups at p < 0.05.

4. Discussion

In this study, absolute quantification results indicated no significant difference in the SRY gene copy number between spermatozoa collected from the upper and lower layers in the control group. In contrast, treatment with resiquimod led to a significantly higher SRY gene copy number in sperm from the upper layer compared to the lower layer.

Umehara et al. applied resiquimod treatment to successfully separate X‐ and Y‐chromosome‐bearing sperm cells in frozen–thawed bull semen. Their results showed that R848 treatment efficiently separates frozen–thawed bull sperm into fractions enriched with either X‐ or Y‐bearing sperm. Embryos derived from the Y‐enriched fraction were predominantly XY (91.3%) with a small proportion XX (7.2%), whereas those from the X‐enriched fraction were mainly XX (84.2%) and some XY (15.8%) (Umehara et al. 2020). However, frozen–thawed sperm differ from fresh sperm because they lack seminal plasma, which normally suppresses capacitation. As a result, fresh sperm depend more on mitochondrial energy metabolism, whereas frozen‐thawed sperm are more prone to capacitation due to calcium influx during thawing (Okazaki et al. 2011). In this context, sperm primarily rely on the glycolytic pathway for energy production, leading to a transition from linear to zigzag motility as observed in the uterine tube near the oocyte. On the other hand, fresh and frozen–thawed sperm behave differently in swim‐up, so the method that is set for frozen–thawed sperm needs optimization to better recover motile sperm from fresh samples. Moreover, the process of freezing and thawing damages sperm membranes, changing their permeability and causing frozen–thawed sperm to respond differently to resiquimod compared to fresh sperm. So, this study established a method for separating and recovering fresh sperm samples, and the results can provide a foundation for developing cost‐effective cryopreservation techniques for bull sexed sperm, enhancing their application in artificial insemination programs.

In our previous study resiquimod was used to separate motile and non‐motile sperm from fresh bovine semen with a swim‐up method. After separation, no significant difference was observed in the percentage of motile spermatozoa in the upper layers between the control and resiquimod‐treated groups; however, motility in the lower layer was higher in the control group. The ratio of sperm counted in the upper layer relative to the lower layer was greater in the control group compared to the treatment group. Moreover, calculation of the ratio of sperm counted in the upper layer relative to the total number of sperm counted in both upper and lower layers demonstrated that the number of sperm in the upper layer of the resiquimod‐treated group was approximately half that of the control group. These findings indicate that the method effectively separated low‐ and high‐motility spermatozoa in the resiquimod‐treated group. The resulting fractions were subsequently analysed in the present study for X‐ and Y‐bearing sperm ratios (Rasouli et al. 2024). The separated sperms were selected to evaluate the efficiency of the method in separating X and Y sperm. Our results showed that the SRY gene copy number was significantly higher in the upper than the lower layer in the resiquimod‐treated group, and it showed that the protocol was successful in separating X and Y sperm.

Sperm from both upper and lower layers of resiquimod‐treated and control samples were used for in vitro embryo production after washing to remove residual resiquimod. This washing was necessary because cumulus cells around oocytes express TLR receptors that, when activated, can increase cytokine secretion, affecting sperm capacitation. Since resiquimod might activate these receptors and trigger inflammation in cumulus cells, it was removed before fertilization testing (Shimada et al. 2006).

Resiquimod treatment did not reduce sperm fertility, as fertilization rates matched the control group. A higher proportion of male embryos from the upper sperm layer confirmed selective enrichment of Y‐bearing sperm. Future studies should explore sperm from intermediate layers and consider dividing sperm samples into more, smaller layers—especially further subdividing the lower layers—to improve sex‐specific embryo production.

Resiquimod has been tested to separate X and Y sperms in other studies. Huang et al. (2025) tested polyvinylpyrrolidone (PVP) concentrations in a resiquimod solution to enhance Y‐sperm sorting efficiency for bull. PVP‐enhanced solutions separated sperm, which were then quantified for motility, X/Y ratios via flow cytometry, integrity, TLR7/8‐negative rates via immunofluorescence, and IVF blastocyst sexing. Y‐sperm purity was similar at 3%–7% PVP but higher than at 0%–1%; TLR7/8‐negative rates were unchanged at 3%–7% yet elevated versus 0%–1%; male blastocysts peaked at 3% PVP (higher than 0%–1%, similar to 5%–7%). Thus, 3% PVP optimizes Y‐sperm yield and purity for efficient X/Y separation in livestock reproduction (Huang et al. 2025).

Huang et al. (2022) incubated goat semen with resiquimod at pH 7.4 and used a swimming method to isolate X‐bearing sperms. The technique increased X sperm proportion to about 85.57%, as confirmed by double TaqMan qPCR. Using these sperms in in vitro fertilization raised female embryo rates to 83.25% versus 47.71% in controls. Artificial insemination with treated sperm also resulted in a higher percentage of female offspring (62.79%) compared to controls (47.65%) (Huang et al. 2022).

Pan et al. studied TLRs 7 and 8 in canine sperm and utilized resiquimod to separate X‐ and Y‐bearing sperm. They found TLR8 was absent, whereas TLR7 was present in head and tail of all sperm. There were no differences in X‐bearing sperm proportions between treated and control groups. Thus, TLR7/8 expression does not differ between X and Y sperm, making separation based on these receptors ineffective in dogs (Pan et al. 2025).

Yotov et al. (2024) studied the effects of cooling and cryopreservation on sperm motility and movement traits of sex‐sorted ram sperm with resiquimod. Resiquimod significantly lowered sperm velocity in both X‐ and Y‐bearing sperm. Diluting sperm with a freezing extender before cooling helped maintain motility during storage, but cryopreservation reduced motility more in sexed sperm than in unsexed samples. Thus, dilution with a suitable extender plus controlled cooling best preserves sexed ram sperm (Yotov, Kistanova, et al. 2024). In another study, Yotov et al. compared X‐ and Y‐bearing ram sperm separated by BSA column or resiquimod. They analysed motility, enzyme activity, lactate and DNA content from six rams. X‐sperm had higher DNA content than Y‐sperm with both methods. The BSA method preserved high motility in both groups, whereas resiquimod increased non‐progressive sperm, linked to higher lactate levels. Both methods showed decreased enzyme activities in the surrounding medium (Yotov, Abadjieva, et al. 2024). Setiawan et al. (2024) studied how resiquimod affects motility of X‐ and Y‐bearing sperm in rams. They incubated sperm from three rams with different resiquimod doses and used the swim‐up method for analysis. Resiquimod decreased motility and ATP levels in X‐sperm, causing them to settle lower, whereas more motile Y‐sperm stayed upper. This shows TLR7/8 activation selectively impairs X‐sperm movement and energy, suggesting its potential use in sperm selection and sex‐sorting (Setiawan et al. 2024).

The effectiveness of sperm motility–based separation using the swim‐up technique depends on several factors. One key factor is the initial motility of the sperm; samples with low motility notably reduce overall efficiency, especially in resiquimod‐treated samples. On the basis of the authors’ experience, additional factors such as container shape, the number of sperm cells used for swim‐up, medium volume, incubation time and temperature can also significantly impact sperm migration and separation results. Therefore, when sperm cells treated with resiquimod are separated using the swim‐up method, it is necessary to establish an efficient swim‐up protocol that takes into account all the factors mentioned.

In this study, TLR7 and TLR8 receptors were not evaluated on sperm cells. Therefore, the authors are unable to comment on the distribution of these receptors in the sperm of the bulls examined in this study. In this regard, several studies have previously investigated differences among bulls regarding the ratio of X‐ and Y‐bearing sperm. Kholghi et al. (2020) found that Holstein bulls show a wide variation in the ratio of Y‐ to X‐chromosome‐bearing sperm (18%–82%), and higher testosterone levels in blood and semen, especially in older bulls, were linked to a higher proportion of Y‐bearing sperm. This indicates that paternal testosterone and age affect sperm sex ratio, offering insights for controlling offspring sex and managing sex‐linked traits in livestock (Kholghi et al. 2020). Moreover, Alomar et al. (2008) found that bulls significantly demonstrate differences in the results of in vitro embryo production, fertilization speed, embryo development timing and sex ratios. Some bulls show faster early embryonic development and higher blastocyst rates by Day 7, along with a strong male‐biased sex ratio from early stages. This suggests that paternal factors can affect both embryo development timing and sex determination, emphasizing the role of bull‐specific traits in IVP results (Alomar et al. 2008). Furthermore, Chandler et al. (1998) used PCR with Y chromosome‐specific primers to measure the proportion of Y‐bearing sperm in bull ejaculates. They validated PCR results by comparing them to male calf production from artificial insemination and mating. Their analysis revealed significant variation in Y‐sperm percentages within ejaculates from the same bull (24%–84%) and corresponding variation in male offspring (16.1%–72.3%). This shows that ejaculates may have unequal numbers of X‐ and Y‐bearing sperm, influencing the offspring's sex ratio (Chandler et al. 1998). Although some studies do not verify the results of mentioned studies for example, Amadesi et al. (2014) analysed the calf gender produced by 98 Holstein Friesian bulls during 4 years, showing no significant deviation for calf gender from 1:1 ratio for each single bull and no significant different of Y‐bearing sperm mean value between three sperm batches of the same bull, or Parati et al. (2006), evaluating unsorted sperm for X‐bearing sperm to show the average of 50.17% ± 0.58% for the commercial semen samples and 51.11% ± 0.56% for ejaculated sperm (Parati et al. 2006).

Considering the specificity of TLR7/8 to X sperm cells, these controversial results about the X/Y sperm ratio in bulls show the possibility of heterogeneous distribution of these receptors in the sperm population of all bulls that necessitates the evaluation of TLR7/8 distribution pattern among different bulls in the future studies to help better and wider use of this simple and practical method for X and Y sperm separation in bull with lower possible variability in the results of this method.

On the other hand, some studies have used the swim‐up method to separate X and Y sperm without any treatment. Azizeddin et al. (2014) developed a vertical swim‐up method using a long narrow column to enrich X‐ or Y‐bearing sperm. Sperm collected from the top were mostly Y‐bearing (60%) and produced more male embryos than the standard swim‐up. The pipette swim‐up also favoured males, with a 62% male to 38% female ratio (Azizeddin et al. 2014). Wolf et al. (2018) found that sperm selection methods in IVF affect the sex ratio of bovine embryos: The swim‐up technique favoured male embryos, whereas continuous Percoll gradient centrifugation for 10 min increased female embryos; however, other methods showed no significant effect on sex ratio. Therefore, based on the points mentioned above, it is essential to investigate the distribution of TLR7/8 across different bulls in future studies. If the distribution of TLR7/8 varies among bulls, a fixed method is unlikely to yield consistent results for all. Consequently, the protocol should be adjusted for bulls whose TLR7/8 distribution deviates from 50% of the sperm population.

5. Conclusion

In the present study, the effectiveness of resiquimod treatment followed by motility‐based swim‐up separation was evaluated for the enrichment of X‐ and Y‐bearing sperm in freshly ejaculated bull semen. The results demonstrated that the proportion of Y‐bearing sperm was significantly higher in the upper layer collected after swim‐up compared to the lower layer in the resiquimod‐treated group. Furthermore, in vitro embryo production revealed a significantly greater proportion of male embryos in the Y‐enriched group compared with the X‐enriched group. Although this method is relatively low‐cost and does not require sophisticated equipment, the findings should be considered preliminary. Further studies are required to evaluate the efficiency, scalability and reproducibility of this approach before it can be considered for practical application in sex selection programs in cattle breeding.

Author Contributions

Ali Kadivar: conceptualisation, project administration, conducting the experiment, writing the manuscript, statistical analysis. Arash Rasouli: sampling, conducting the experiment. Naser Shams Esfandabadi: conducting the experiment. Najmeh Davoodian: conducting the experiment, review and editing. Hassan Nazari: conducting the experiment. Seyed Abbas Mirzaei: conducting the experiment, review and editing. Ebrahim Ahmadi: conducting the experiment. Hamid Rahimi: conducting the experiment.

Funding

This study was funded by Shahrekord University, Shahrekord, Iran (Grant 0GRD34M1576).

Ethics Statement

This study was approved by the Ethics Committee of Shahrekord University with the ID of IR.SKU.REC.1400.033.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgements

The authors wish to give thanks to the Behshad Gostar Farzanegan Company that helped and supported us in conducting research and sample collection.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Alomar, M. , Tasiaux H., Remacle S., George F., Paul D., and Donnay I.. 2008. “Kinetics of Fertilization and Development, and Sex Ratio of Bovine Embryos Produced Using the Semen of Different Bulls.” Animal reproduction science 107, no. 1–2: 48–61. 10.1016/j.anireprosci.2007.06.009. [DOI] [PubMed] [Google Scholar]
  2. Amadesi, A. , Frana A., Gandini L. M., et al. 2015. “Comparison Between Primary Sex Ratio in Spermatozoa of Bulls and Secondry Sex Ratio in the Deriving Offspring.” Theriogenology 83: 199–205. 10.1016/j.theriogenology.2014.09.014. [DOI] [PubMed] [Google Scholar]
  3. Azizeddin, A. , Ashkar F., King W., and Revay T.. 2014. “Enrichment of Y‐Chromosome‐Bearing Bull Spermatozoa by Swim‐up Through a Column.” Reproduction in Domestic Animals 49, no. 1: e1–e4. 10.1111/rda.12252. [DOI] [PubMed] [Google Scholar]
  4. Chandler, J. , Steinholt‐Chenevert H., Adkinson R., and Moser E.. 1998. “Sex Ratio Variation Between Ejaculates Within Sire Evaluated by Polymerase Chain Reaction, Calving, and Farrowing Records.” Journal of Dairy Science 81, no. 7: 1855–1867. 10.3168/jds.S0022-0302(98)75756-X. [DOI] [PubMed] [Google Scholar]
  5. Davoodian, N. , Kadivar A., and Mehrban H.. 2024. “Supplementation of Media With Gamma‐Oryzanol as a Novel Antioxidant to Overcome Redox Imbalance During Bovine Oocyte Maturation In Vitro.” Reproduction in Domestic Animals 59, no. 1: e14503. [DOI] [PubMed] [Google Scholar]
  6. De Canio, M. , Soggiu A., Piras C., et al. 2014. “Differential Protein Profile in Sexed Bovine Semen: Shotgun Proteomics Investigation.” Molecular BioSystems 10, no. 6: 1264–1271. 10.1039/C3MB70306A. [DOI] [PubMed] [Google Scholar]
  7. De Luca, A. , Managó S., Ferrara M., et al. 2014. “Non‐Invasive Sex Assessment in Bovine Semen by Raman Spectroscopy.” Laser Physics Letters 11, no. 5: 055604. 10.1088/1612-2011/11/5/055604. [DOI] [Google Scholar]
  8. Garner, D. L. , Evans K. M., and Seidel G. E.. 2013. Sex‐Sorting Sperm Using Flow Cytometry/Cell Sorting (Vol. 927). Humana Press. 10.1007/978-1-62703-038-0_26. [DOI] [PubMed] [Google Scholar]
  9. Hendriksen, P. J. , Tieman M., Van Der Lende T., and Johnson L. A.. 1993. “Binding of Anti‐H‐Y Monoclonal Antibodies to Separated X and Y Chromosome Bearing Porcine and Bovine Sperm.” Molecular reproduction and development 35, no. 2: 189–196. 10.1002/mrd.1080350213. [DOI] [PubMed] [Google Scholar]
  10. Huang, F. , Niu P., Qu H.‐M., et al. 2025. “Polyvinylpyrrolidone Can Effectively Improve the Efficiency of Resiquimod in Sorting Bovine Y Sperm.” Animal Bioscience 38, no. 9: 1881. 10.5713/ab.24.0738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Huang, M. , Cao X., He Q., et al. 2022. “Alkaline Semen Diluent Combined With R848 for Separation and Enrichment of Dairy Goat X‐Sperm.” Journal of Dairy Science 105, no. 12: 10020–10032. 10.3168/jds.2022-22115. [DOI] [PubMed] [Google Scholar]
  12. Kholghi, M. , Rostamzadeh J., Razmkabir M., and Heidari F.. 2020. “Blood Testosterone Level Affects Sex Ratio of Bull Semen.” Concepts of Dairy & Veterinary Sciences 4, no. 1: 363–369. 10.32474/CDVS.2020.04.000177. [DOI] [Google Scholar]
  13. Nakaya, Y. , Kizaki K., Takahashi T., Patel O. V., and Hashizume K.. 2009. “The Characterization of DNA Methylation‐Mediated Regulation of Bovine Placental Lactogen and Bovine Prolactin‐Related Protein‐1 Genes.” BMC Molecular Biology 10, no. 1: 19. 10.1186/1471-2199-10-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Okazaki, T. , Yoshida S., Teshima H., and Shimada M.. 2011. “The Addition of Calcium Ion Chelator, EGTA to Thawing Solution Improves Fertilizing Ability in Frozen–Thawed Boar Sperm.” Animal Science Journal 82, no. 3: 412–419. 10.1111/j.1740-0929.2010.00856.x. [DOI] [PubMed] [Google Scholar]
  15. Pan, C. , Xu S., Zhang W., Zhao Y., Zhao J., and Song M.. 2025. “Expression of TLR7/8 in Canine Sperm and Evaluation of the Effect of Ligand R848 on the Sorting of Canine X/Y Sperm.” Theriogenology 231: 127–132. 10.1016/j.theriogenology.2024.10.015. [DOI] [PubMed] [Google Scholar]
  16. Parati, K. , Bongioni G., Aleandri R., and Galli A.. 2006. “Sex Ratio Determination in Bovine Semen: A New Approach by Quantitative Real Time PCR.” Theriogenology 66: 2202–2209. 10.1016/j.theriogenology.2006.07.007. [DOI] [PubMed] [Google Scholar]
  17. Pozdyshev, D. V. , Kombarova N. A., and Muronetz V. I.. 2023. “Biochemical Features of X or Y Chromosome‐Bearing Spermatozoa for Sperm Sexing.” Biochemistry (Moscow) 88, no. 5: 655–666. 10.1134/S0006297923050085. [DOI] [PubMed] [Google Scholar]
  18. Quelhas, J. , Santiago J., Matos B., Rocha A., Lopes G., and Fardilha M.. 2021. “Bovine Semen Sexing: Sperm Membrane Proteomics as Candidates for Immunological Selection of X‐and Y‐Chromosome‐Bearing Sperm.” Veterinary Medicine and Science 7, no. 5: 1633–1641. 10.1002/vms3.540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Rasouli, A. , Kadivar A., Esfandabadi N. S., Davoodian N., and Nazari H.. 2024. “Using an Optimal Method to Separate Low‐Motile and High‐Motile Sperms in Fresh Bull Semen Treated With Resiquimod With the Aim of Separating Sperms Containing X From Y Chromosomes.” Iranian Journal of Veterinary Clinical Sciences 18, no. 1: 63–73. 10.22034/ijvcs.2024.14828.1094. [DOI] [Google Scholar]
  20. Seidel, G. Jr. 2003. “Economics of Selecting for Sex: The Most Important Genetic Trait.” Theriogenology 59, no. 2: 585–598. 10.1016/S0093-691X(02)01242-6. [DOI] [PubMed] [Google Scholar]
  21. Setiawan, R. , Widyastuti R., Nurmeidiansyah A. A., and Solihati N.. 2024. “The Effect of Toll‐Like Receptor 7/8 Ligand in Inhibiting the Motility of Putative X‐Chromosome‐Bearing Sperm in Rams.” Journal of Advanced Veterinary and Animal Research 11, no. 3: 648. 10.5455/javar.2024.k814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Shimada, M. , Hernandez‐Gonzalez I., Gonzalez‐Robanya I., and Richards J. S.. 2006. “Induced Expression of Pattern Recognition Receptors in Cumulus Oocyte Complexes: Novel Evidence for Innate Immune‐Like Functions During Ovulation.” Molecular Endocrinology 20, no. 12: 3228–3239. 10.1210/me.2006-0194. [DOI] [PubMed] [Google Scholar]
  23. Takeda, K. , Kaisho T., and Akira S.. 2003. “Toll‐Like Receptors.” Annual Review of Immunology 21, no. 1: 335–376. 10.1146/annurev.immunol.21.120601.141126. [DOI] [PubMed] [Google Scholar]
  24. Tanghe, S. , Van Soom A., Mehrzad J., Maes D., Duchateau L., and de Kruif A.. 2003. “Cumulus Contributions During Bovine Fertilization In Vitro.” Theriogenology 60, no. 1: 135–149. 10.1016/S0093-691X(02)01360-2. [DOI] [PubMed] [Google Scholar]
  25. Umehara, T. , Tsujita N., and Shimada M.. 2019. “Activation of Toll‐Like Receptor 7/8 Encoded by the X Chromosome Alters Sperm Motility and Provides a Novel Simple Technology for Sexing Sperm.” PLoS Biology 17, no. 8: e3000398. 10.1371/journal.pbio.3000398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Umehara, T. , Tsujita N., Zhu Z., Ikedo M., and Shimada M.. 2020. “A Simple Sperm‐Sexing Method That Activates TLR7/8 on X Sperm for the Efficient Production of Sexed Mouse or Cattle Embryos.” Nature Protocols 15: 2645–2667. 10.1038/s41596-020-0348-y. [DOI] [PubMed] [Google Scholar]
  27. Wang, H.‐X. , Flaherty S. P., Swann N. J., and Matthews C. D.. 1994. “Genetics: Discontinuous Percoll Gradients Enrich X‐Bearing Human Spermatozoa: A Study Using Double‐Label Fluorescence In‐Situ Hybridization.” Human Reproduction 9, no. 7: 1265–1270. 10.1093/oxfordjournals.humrep.a138692. [DOI] [PubMed] [Google Scholar]
  28. Wolf, C. , Brass K., Rubin M., Pozzobon S., Mozzaquatro F., and De La Corte F.. 2018. “The Effect of Sperm Selection by Percoll or Swim‐Up on the Sex Ratio of In Vitro Produced Bovine Embryos.” Animal Reproduction (AR) 5, no. 3: 110–115. [Google Scholar]
  29. Yata, V. K. 2022. “Commercial and Ethical Aspects of Sperm Sexing.” In Sperm Sexing and Its Role in Livestock Production. Springer. 10.1007/978-981-19-1790-5_7. [DOI] [Google Scholar]
  30. Yotov, S. , Abadjieva D., Atanasov A., et al. 2024. “In Vitro Characteristics of X‐and Y‐Bearing Ram Spermatozoa Sorted by Bovine Serum Albumin (BSA) Column and TLR7/8 Ligand R848.” Animal Reproduction Science 263: 107450. 10.1016/j.anireprosci.2024.107450. [DOI] [PubMed] [Google Scholar]
  31. Yotov, S. , Kistanova E., Atanasov А., Ivanova B., and Zaimova D.. 2024. “Effect of Cooling and Freezing on the Kinematic Parameters of Ram Spermatozoa Sexed by Modified Protocol With TLR7/8 Ligand R848.” Biotechnology in Animal Husbandry 40, no. 2: 87–99. 10.2298/BAH2402087Y. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES