Molecular screening for Rickettsia, Anaplasma, and Coxiella in head lice (Pediculus humanus capitis) collected from primary school girls in Fars Province, Iran (2024)

Abstract

Objective

Lice are obligate ectoparasites divided into two main families: Pediculidae and Phthiridae. Body lice are known vectors of bacterial pathogens like Rickettsia, which cause diseases such as epidemic typhus and trench fever. Although head lice are genetically similar to body lice, they have long been considered a nuisance rather than a medical threat. This is particularly concerning for primary school girls, a vulnerable group with high infestation rates. This study aimed to detect deoxyribonucleic acid (DNA) from Coxiella, Rickettsia, and Anaplasma in head lice collected from female elementary school students in Fars, Iran, in 2024. Head lice were collected from the scalp of school-aged girls and pooled for molecular analysis, with each pool containing 10 lice. DNA was extracted, and specific primers were designed for the detection of each pathogen using polymerase chain reaction (PCR) assays.

Results

Coxiella DNA was detected in pooled head lice samples collected from six of the seven surveyed cities, including Marvdasht, Kazerun, Sepidan, Shiraz, Firouzabad, and Kavar. Anaplasma DNA was detected only in pooled samples from Firouzabad. Rickettsia DNA was not detected in any of the examined samples. The absence of Rickettsia DNA in all surveyed locations may reflect a low prevalence or absence of detectable Rickettsia DNA in the sampled head lice populations. It should be noted that the PCR assay used in this study detects Coxiella spp. at the genus level and does not distinguish Coxiella burnetii from Coxiella-like endosymbionts (CLEs) commonly found in arthropods. Therefore, the detection of Coxiella DNA should be interpreted as molecular evidence of bacterial genetic material rather than confirmation of pathogenicity or public health risk.

Introduction

Pediculus humanus humanus (body lice) are recognized vectors of several clinically significant bacterial infections, including Rickettsia prowazekii (epidemic typhus), Bartonella quintana (trench fever), and Borrelia recurrentis (relapsing fever) [1]. In contrast, P. h. capitis, although genetically and morphologically similar to body lice, have not historically been considered vectors of human pathogens [2, 3]. Head lice are highly prevalent among school-aged girls, and emerging molecular evidence highlights the need to investigate their potential association with pathogenic bacteria from a public health perspective [4]. Recent studies have reported the presence of opportunistic bacterial pathogens in human head lice, underscoring the ongoing public health significance of ectoparasitic infestations [5–7]. These findings have prompted renewed attention to their potential epidemiological relevance and highlighted the need for systematic surveillance and molecular investigations, particularly in settings with high infestation rates [7, 8]. In Iran, the consistently high prevalence of head lice among schoolchildren, particularly girls, highlights the importance of pathogen surveillance in these populations to support evidence-based public health planning and risk assessment [9, 10]. Human lice are globally distributed, and pediculosis remains a common public health problem, particularly in temperate regions [11]. Several studies have documented a high prevalence of head lice infestation among schoolchildren, with a disproportionate burden observed in girls, including reports from Fars Province, Iran [12–14]. Rickettsia, Anaplasma, and Coxiella were selected for molecular screening based on their known or suspected associations with arthropod vectors and their documented circulation in Iran. Previous studies have reported these bacteria in ticks, mosquitoes, and other hematophagous arthropods, including lice, highlighting their zoonotic and public health relevance [15, 16]. It should be noted that the molecular detection of bacterial DNA in arthropod vectors does not necessarily indicate pathogen viability or vector competence, and some detected bacteria, such as Coxiella, may represent Coxiella-like endosymbionts rather than pathogenic strains. Given the high prevalence of head lice among schoolchildren and the limited molecular data on bacterial pathogens associated with P. h. capitis in Iran, screening for these bacterial genera addresses an important epidemiological knowledge gap.

Materials and methods

Sample collection and preparation

This descriptive cross-sectional study was conducted on female elementary school students in public schools in selected cities based on DNA was detected and geographical distribution of the province including Shiraz-Marvdasht-Kazeroun-Sepidan-Firozabad and Kavar in Fars province in 2024. Two girls’ primary schools were selected from each city and children in each of the elementary schools were screened for the presence of live head lice using plastic lice combs (Thornton Ross Company: comb teeth spacing 0.3 mm). Lice will be collected from the heads of elementary school students in the cities. All subjects were thoroughly examined for the presence of lice. All visible lice will be removed from the hair using a fine-toothed comb. All lice will be stored under sterile conditions at dry room temperature and sent to the Entomology Laboratory of the Faculty of Health. A standard informed consent form approved by the Ethics Committee of the University of Medical Sciences will be obtained from all participants or their parents stating that they accept the purpose of the study as outlined in the information sheet. For molecular analysis, head lice were analyzed in pooled samples, with each pool consisting of ten lice. Each pool was prepared from lice collected from a single infested child in order to minimize inter-host variation. Both adult and nymph stages were included in the pools due to limited sample availability, and life stages were not analyzed separately.

DNA extraction

Genomic DNA was extracted from homogenized lice pools using the Sambio DNA extraction kit with (South Korea), following the manufacturer’s protocol. The samples were stored at -20 °C until further analysis. DNA quality was measured using the Analytik Jena Nanodrop device with a ratio of 260/280, where values between 1.8 and 2 were considered to indicate DNA quality.

Molecular detection of Rickettsia, Anaplasma, and Coxiella

To screen for bacterial DNA, including Rickettsia, Anaplasma, and Coxiella, specific primers were designed based on conserved regions of target genes retrieved from the GenBank database. Primer design was performed by aligning reference sequences using Molecular Evolutionary Genetics Analysis (MEGA) version 6.0, Gene Runner version 4.0 and Oligo7.0 software, and conserved regions were identified for primer development. For bacterial DNA identification, the IS1111 gene was used to detect Coxiella spp., the MSP4 gene to detect Anaplasma spp., and the 16SRNA gene to detect Rickettsia spp. This assay was designed for the detection of Coxiella spp. and does not allow differentiation between pathogenic Coxiella burnetii and Coxiella-like endosymbionts commonly found in arthropods. All primers used in this study were designed to detect Coxiella spp., Anaplasma spp., and Rickettsia spp. at the genus level and were not intended for species-level discrimination. Primer specificity was evaluated in silico using Basic Local Alignment Search Tool (BLAST) analysis against the National Center for Biotechnology Information (NCBI) database to confirm homology with target bacterial sequences and to exclude significant similarity with human DNA or non-target microorganisms. PCR reactions were performed in a final volume of 25 µL containing 12.5 µL of Master Mix (Sambio), 1 µL of each primer (10 pmol/µL), 2 µL of DNA template, and nuclease-free water. Thermocycling conditions included an initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at primer-specific temperatures for 30 s, extension at 72 °C for 45 s, and a final extension at 72 °C for 5 min. PCR reaction products were visualized by 1.5% agarose gel electrophoresis under UV illumination to confirm the presence of amplicons of the expected size. Positive controls consisted of previously confirmed DNA samples of Coxiella spp., Anaplasma spp., and Rickettsia spp., obtained from reference material, while nuclease-free water was used as a negative control. Positive and negative controls were included in each PCR run to monitor amplification performance and potential contamination, and all positive control amplicons consistently produced bands of the expected size.

Sequencing

The observed bands of the expected size (visible in Table 1) were purified for final confirmation using a DNA purification kit and sent to Pishgam Company in Iran for sequencing. The sequencing results were recorded in the Gene bank (NCBI).

Table 1.

Primer designed to detection for Rickettsia spp., Anaplasma spp. and Coxiella spp. genes

Species	Primer	Nucleotide sequence (5′–3′)	Amplicon size (bp)	Annealing
Rickettsia spp.	F-Ri	CGGAGGAAAGATTTATCGCTGATG	580 bp	58.4 °C
	R-Ri	GTTTACGGCGTGGACTACC		57.3 °C
Anaplasma spp.	F-ana	ACTCACATCTTTCGACGGC	381 bp	57 °C
	R-ana	CCTTGCCCCTGTAGGCTA		57.9 °C
Coxiella spp.	F-coxi	GCAAACAGGATTAGAGACC	577 bp	57.5 °C
	R-coxi	GCGATTACTAGCGATTCC		55 °C

Bioinformatics and phylogenetic analysis

The results of the sequences were analysed using the NCBI BLAST webserver. In addition, MEGA 6.0 software was also used for nucleic acid analysis. Phylogenetic analysis was performed using the Neighbor-Joining method implemented in MEGA version 6.0, with bootstrap analysis based on 1000 replicates.

PCR reactions were performed in 25-µL volumes containing 12.5 µL of Master Mix (Sambio), 1 µL of each primer (10 pmol/µL), 2 µL of DNA template, and nuclease-free water. Thermocycling conditions included an initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation (95 °C, 30 s), annealing (primer-specific temperatures, 30 s), extension (72 °C, 45 s), and a final extension at 72 °C for 5 min. Positive controls (reference strains) and negative controls (nuclease-free water) were included in each run. Amplified products were visualized via 1.5% agarose gel electrophoresis under UV light.

Results

This study included the analysis of head lice samples collected from different cities (Marvdasht, Kazerun, Sepidan, Shiraz, Firouzabad, Abadeh, and Kavar) in Fars Province, Iran. Out of the 28 tested lice pools (comprising 280 samples), Coxiella DNA. was the most frequently detected pathogen, identified in 6 out of 7 surveyed cities (85.7%). The highest Coxiella DNA was detected pools was recorded in Marvdasht (66.6%), followed by Firouzabad (40%). In contrast, Abadeh was the only city with no detection of Coxiella DNA. Anaplasma spp. was found only in Firouzabad, with a DNA was detected of 20% among its pools. Representative PCR-positive samples for Coxiella spp. (n = 1) and Anaplasma spp. (n = 1) were subjected to Sanger sequencing for confirmation. The obtained sequences were deposited in GenBank under accession numbers PX735746 , PX568919and PX767795. Rickettsia spp. was not detected in any of the samples examined during this study. Coxiella DNA was detected in 6 out of 7 surveyed cities, indicating a high and DNA detected of this bacterium in head lice populations across the region (Fig. 1).

Fig. 1.

Geographic distribution of Coxiella and Anaplasma DNA detected in head lice collected from selected cities of Fars Province, southern Iran. Red-colored areas indicate cities where Coxiella DNA was detected, while pink-colored areas represent cities with co-detection of Coxiella and Anaplasma DNA in head lice samples. Blue-colored areas denote cities that were either not sampled in the present study or where no bacterial DNA was detected (e.g., Abadeh)

Anaplasma had a much narrower distribution with presence only seen in Firouzabad County suggesting a limited geographic distribution unlike Coxiella, which was wider spread. Rickettsia was not detected in any tested samples from the counties included suggesting the absence of Rickettsia, or a very low density of lice checked in the present study. Firouzabad County was the only location to co-detect Coxiella and Anaplasma which prompts questions regarding potential ecological or vector factors related to Anaplasma at this location. This study highlighted some major differences of lice-borne pathogens, such as Coxiella’s Ubiquitous Presence.

Anaplasma has a local distribution, and its observation only in Firuzabad city could be a factor in the presence of a unique reservoir host (i.e., animal) in Firuzabad city (Table 2). Favorable local ecological conditions (e.g., climate types, diverse vegetation) of a specific unique strain of Anaplasma. The detection of bacterial DNA indicates the presence of genetic material only and does not provide evidence of vector competence or pathogen transmission. Absence of rickettsia. The absence of Rickettsia DNA in all examined pools may indicate a low prevalence or absence of detectable Rickettsia DNA in the sampled head lice populations, at least in the study areas, lice may not be the main vector of this pathogen or that its DNA was detected is below detectable levels. Given the pooled nature of the samples and the small number of pools per city, Fisher’s exact test was used to evaluate the association between geographical location and the detection of Coxiella DNA in pooled head lice samples. The analysis did not detect a statistically significant association between city and Coxiella DNA detection (p > 0.05). Due to limited statistical power, differences in detection frequencies across cities should be interpreted with caution. Given the pooled nature of the samples and the small number of pools per city, Fisher’s exact test was used to evaluate the association between geographical location and the detection of Coxiella DNA in pooled head lice samples. These findings indicate the presence of bacterial DNA only and do not confirm pathogen viability, transmission potential, or vector competence of head lice. PCR amplification of Coxiella spp. and Anaplasma spp. produced amplicons of the expected size, as visualized by agarose gel electrophoresis (Fig. 2). Phylogenetic tree based on the IS1111A gene of Coxiella spp. sequence was performed using the Neighbor-Joining method with 1000 bootstrap replicates. Rickettsia raoultii was used as an outgroup. The sequence obtained in the current study (PP848948.1) clustered within the Coxiella spp. clade and showed close genetic relatedness to C. burnetii strains Coxi-IR-FM-103, Coxi-IR-FM-108, Coxi-IR-FM-109, and Coxi-IR-FM-112. This clustering was supported by high bootstrap values (up to 92%). The results confirm that the sequence from the present study belongs to Coxiella spp. and is genetically similar to previously reported IS1111A sequences (Fig. 3).

Table 2.

Detection of Coxiella, Anaplasma, and Rickettsia DNA in pooled head lice samples collected from different cities of Fars Province, Iran

Cities	Number of samples	Number of pools	Positive pools (%)	Coxiella	Anaplasma	Rickettsia
Marvdasht	60	6	4(66.6%)	Positive	Negative	Negative
Kazerun	30	3	1(33.3%)	Positive	Negative	Negative
Sepidan	40	4	1(25%)	Positive	Negative	Negative
Shiraz	30	3	1(33.3)	Positive	Negative	Negative
Firouzabad	50	5	3(60%)	Positive (40%)	Positive (20%)	Negative
Abadeh	30	3	0	Negative	Negative	Negative
Kavar	40	4	1(25%)	Positive	Negative	Negative
Total	280	28	11(39.2%)

Fig. 2.

Agarose gel electrophoresis of PCR amplicons used for the detection of Coxiella spp. and Anaplasma spp. in pooled head lice samples. A Coxiella spp.: lane 1, positive sample; lane 2, 100-bp DNA ladder; lane 3, negative control. B Anaplasma spp.: lane 1, positive sample; lane 2, 100-bp DNA ladder; lane 3, negative control

Fig. 3.

Neighbor-joining phylogenetic tree based on partial [IS1111A] sequences showing the relationship between Coxiella spp. detected in this study and reference sequences retrieved from GenBank

Discussion

The present study showed that the presence of Coxiella DNA was detected in six of the seven cities studied (Marvdasht, Kazerun, Sepidan, Shiraz, Firouzabad, and Kavar), indicating the distribution of this DNA of these bacteria throughout the study area. It is important to emphasize that the detection of Coxiella DNA in head lice in the present study does not confirm the presence of viable Coxiella burnetii. The PCR assay used in this study targets Coxiella spp. and cannot differentiate pathogenic C. burnetii from Coxiella-like endosymbionts (CLEs), which are commonly found in arthropods. Therefore, the results should be interpreted as molecular evidence of bacterial DNA presence rather than proof of vector competence or transmission. This finding is consistent with previous research describing Coxiella-like endosymbionts as common associates of multiple arthropods (lice included), which often provides a route for pathogens or reservoirs of these bacteria [17]. The omnipresence of Coxiella indicates its possibility as a potentially pathogen in the areas being monitored and implies a need for investigation and epidemiological work. However, anaplasma was only found in lice from Firuzbad County indicating it may be geographically restricted. In Iran, there are no published research articles or reports on the history of C. burnetii, the etiological agent of Q fever and human head lice (Pediculus humanus capitis). C. burnetii has been identified in other arthropod vectors such as ticks in multiple regions of Iran; however, no studies have identified lice populations in Iran [18–20]. Internationally, a study conducted in Mali reported the detection of C. burnetii DNA in 5.1% of human head lice samples, indicating that lice can act as vectors for this pathogen [6]. Regardless this study was limited geographically, and to the lice’s competence as a vector for C. burnetii transmission has not been established in Iran.

Such restricted distribution could reflect either ecological or host-specific reasons unique to Firuzabad, which can include composition of local vector populations, availability of host reservoirs, or environmental conditions that promote Anaplasma maintenance and transmission [21]. To the best of our knowledge, it is currently unreported that Anaplasma can be present in human head lice in Iran. Although Anaplasma infections were found in various vectors and hosts in Iran such as ticks, ruminants and humans, we are not aware of any studies that specifically documented identification of Anaplasma in lice populations. One study from Ghaemshahr, Mazandaran Province, did report Anaplasma infections in ticks in addition to domestic ruminants and humans identifying Anaplasma ovis, Anaplasma bovis, and Anaplasma centrale species [22]. In another study from southeastern Iran, found Anaplasma infections in ticks collected from sheep identifying A. ovis. However, the previous studies did not identify occurring in lice as vectors [23]. The observed localized occurrence of Anaplasma justifies the need for targeted surveillance and control measures in that area, and additional studies to better understand the host factors driving focal distribution.

There is no information available on the prevalence of Rickettsia pathogens in human head lice (P. h. capitis) from Iran. Rickettsia infections have been found in different types of vectors and hosts in Iran, including domestic animals and ticks, but no studies have examined Rickettsia in lice collections. However, when studying Rickettsia in hard (Ixodidae) ticks, Rickettsia was detected in two collections of hard ticks obtained from animals (cattle, sheep and goats) in the Zanjan province. In that study, four species of Rickettsia were detected from different hard tick species including Rickettsia aeschlimannii, Rickettsia raoultii, Rickettsia sibirica, and Rickettsia slovaca [24]. Rickettsia was not detected in any of the lice pools sampled in each county. This may be an indication of low frequency or absence of Rickettsia species in the local populations of lice or host animals, as has been also seen in similar ecological contexts [25]. Likewise, negative outcomes may be attributed to methodological differences or the possibility that the lice sampled belong to a species that is not suitable vectors for Rickettsia pathogen in the areas we sampled. Overall, the different detection patterns of these pathogens support the idea of the diverse ecology of lice-borne pathogens [26]. The local detection of Anaplasma, in particular, confirms the importance of well-planned monitoring protocols to mitigate potential outbreaks. Future studies should focus on characterizing appropriate ecological interactions involving lice, hosts, and these bacteria and potential transmission routes and clinical implications for animal and human health in these locations.

Limitations

This study has several limitations. The use of pooled head lice samples prevents estimation of individual-level prevalence and assessment of co-infection patterns and may lead to underestimation of true pathogen prevalence. Mixing different life stages (nymphs and adults) within pools may also influence detection rates. The molecular assays were designed at the genus level and could not distinguish pathogenic species (e.g., Coxiella burnetii) from non-pathogenic endosymbionts; therefore, detection of bacterial DNA does not indicate viability, pathogenicity, or transmission potential. No clinical or epidemiological linkage between head lice infestation and human disease was assessed. Sampling was limited to school-aged girls, which may restrict generalizability. In addition, vector competence was not evaluated. These limitations should be considered when interpreting the findings, and future studies using individual-louse analyses and species-specific assays are warranted.

Conclusion

In conclusion, this study provides molecular evidence for the presence of Coxiella and Anaplasma DNA in head lice collected from school-aged girls in Fars Province, Iran. However, these findings do not demonstrate bacterial viability, pathogenicity, or transmission capability. Further studies using species-specific assays, larger sample sizes, and experimental approaches are required to clarify the epidemiological and public health significance of these findings.

Author contributions

H. A supervisor and writing original, Z.N molecular identifican, writing original and data collection, Z.S sample identification and S.M writing original.

Funding

This study was supported by the Vice Chancellor for Research and Technology, Shiraz University of Medical Sciences, with grant number 27803.

Data availability

the data of this article available in NCBI by accssetion numbers PP848948.1 and PP355842.1.

Declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of Shiraz University of Medical Sciences (IR.SUMS.SCHEANUT.REC.1402.087). Written informed consent was obtained from the parents or legal guardians of all participating students. The study was conducted in accordance with the principles of the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.