Microcystin-LR Impairs Endometrial Receptivity during the Peri-Implantation Window via Disruption of STAT3/HIF-1α Signaling

Abstract

Microcystin-LR (MC-LR), an emerging contaminant present in aquatic environments, poses health risks owing to its widespread distribution, bioaccumulation potential, and well-documented human exposure. However, its impact on endometrial function during early pregnancy remains poorly understood. This study investigates the effects and mechanisms of MC-LR exposure during the peri-implantation period on endometrial receptivity. Pregnant mice were administered with MC-LR at a biologically relevant dose (1/2 NOAEL, 20 μg/kg/day) from gestational days 3.5 to 5.5. MC-LR exposure impaired uterine morphology, reduced serum progesterone, and suppressed expression of key receptivity markers, resulting in decreased implantation sites. Transcriptomic analysis revealed dysregulation of the extracellular region, immune response, and hormone activity, with STAT3 signaling identified as a key regulator. MC-LR also disrupted uterine immune homeostasis, causing macrophage dysfunction and reduced IL-6 levels. The IL-6-dependent STAT3/HIF-1α signaling pathway was inhibited by MC-LR but reactivated by Garcinone D. Pharmacological activation of STAT3 prevented MC-LR-induced impairments, including cytokine dysregulation, extracellular matrix degradation, angiogenesis inhibition, reduced gland numbers, and decreased implantation capacity, though serum progesterone levels remained unaffected. These findings suggest that MC-LR disrupts endometrial receptivity via STAT3/HIF-1α signaling, independent of progesterone restoration, providing novel insights into microcystin-induced reproductive toxicity and a potential therapeutic target for implantation failure.

1. Introduction

Harmful algal blooms (HABs), driven by climate change and eutrophication, are increasingly contaminating aquatic ecosystems. Among the toxins produced by cyanobacteria, microcystins (MCs) are recognized as one of the most toxic and frequently detected cyanotoxins. MC-LR, the most common congener, is noted for its bioaccumulation and acute toxicity. Its presence in water, food, and human serum has raised substantial public health concerns.

MC-LR has been frequently detected in surface waters and drinking water at concentrations ranging from 23.63 to 997.5 μg/L, , with levels often exceeding the World Health Organization recommended limit of 1 μg/L. In addition to waterborne exposure, humans can ingest MC-LR through various pathways including contaminated food, dermal contact, and inhalation. For instance, MC-LR concentrations of 4.29 and 1.17 mg/g have been detected in the hepatopancreas and gonads of farmed freshwater shrimp, respectively, while levels up to 5.2 μg/kg have been found in leafy vegetables. Systemic human exposure has also been confirmed, as demonstrated in the Chaohu region of China, where MC-LR was detected in the serum of approximately 64% of local fishermen, with concentrations ranging from 2 to 78 pg/mL. These findings underscore the widespread environmental presence of MC-LR and its significant human exposure risk.

MC-LR exerts multiorgan toxicity affecting the intestine, liver, kidney, and gonads. Its high chemical stability makes it resistant to degradation and difficult to remove by conventional water treatment, leading to persistent environmental contamination and bioaccumulation in aquatic food chains. The primary toxic mechanism is potent inhibition of the serine/threonine protein phosphatases PP1 and PP2A, which disrupts phosphorylation homeostasis and triggers oxidative stress, cytoskeletal injury, apoptosis, and inflammatory signaling across diverse cell types and organs. Among these, reproductive toxicity is of particular concern, as demonstrated in animal studies reporting endocrine disruption, ovarian injury, and impaired spermatogenesis. Studies have shown that MC-LR exposure may reduce offspring birth rates, potentially leading to increased incidences of low birth weight and miscarriage, raising concerns about its potential to interfere with early gestational processes. However, the underlying mechanisms, particularly those involving uterine function during the peri-implantation period, remain poorly characterized.

Endometrial receptivity, defined as a temporally restricted, hormone-dependent condition of the uterus that permits embryo implantation, plays a pivotal role in pregnancy establishment. This receptive state is orchestrated through finely tuned molecular and cellular processes involving hormonal signaling, immune tolerance, extracellular matrix (ECM) remodeling, and angiogenesis. Disruption of any of these pathways has been shown to impair implantation, thereby contributing to infertility and early pregnancy loss. While several environmental endocrine-disrupting chemicals (such as bisphenol A, cypermethrin and phthalates) have been linked to disturbances in endometrial receptivity, the specific effects of MC-LR on this critical process remain unelucidated. Considering that the endocrine-disrupting effects of MC-LR have been clearly established, its impacts on uterine receptivity and the underlying mechanisms merit focused investigation.

Recent studies have highlighted the signal transducer and activator of transcription 3 (STAT3) as a key mediator of endometrial receptivity, facilitating decidual transformation, immune modulation, and vascular remodeling in response to cytokines. Hypoxia-inducible factor 1α (HIF-1α), which interacts with STAT3 under hypoxic or inflammatory conditions, has also been identified as a regulator of endometrial angiogenesis and implantation success. MC-LR has been reported to interfere with intestinal barrier function via modulation of STAT3 signaling, leading to inflammatory bowel disease-like phenotypes. However, whether MC-LR influences endometrial receptivity through the STAT3-HIF-1α axis remains unexplored.

In this study, we hypothesized that MC-LR exposure during the peri-implantation period impairs endometrial receptivity by disrupting STAT3/HIF-1α signaling. The murine model of early pregnancy was used and MC-LR was administered during the implantation window. Uterine receptivity was assessed via histology, hormonal assays, and molecular analysis. Transcriptomic profiling was performed to identify key dysregulated pathways. To investigate the role of STAT3/HIF-1α signaling, targeted activation of STAT3 using Garcinone D was performed. This study aims to elucidate the molecular mechanisms underlying MC-LR-induced impairment of endometrial receptivity, and to evaluate a potential strategy for restoring endometrial function. The findings offer new insights into the reproductive toxicity of MCs and support a mechanism that can inform health risk assessment and the development of potential mitigation strategies.

2. Materials and Methods

2.1. Chemicals and Reagents

MC-LR (purity ≥95%) was purchased from Express Technology Co., Ltd. (Beijing, China). Garcinone D was obtained from MedChemExpress (Monmouth Junction, New Jersey, USA). Primary antibodies GAPDH (EM1101), IL-1β (HA601002), TNFα (A722022), IL-6 (EM1701-45), and IL-10 (HA722032) were from Huabio Biotechnology (Hangzhou, China). IL-4 (ES5878) was from ELK Biotechnology (Wuhan, China). TIMP1 (85959-1-RR), SERPINE1 (83980-3-RR), MMP9 (82854-8-RR), and PLAU (17968-1-AP) antibodies were from Proteintech Group. STAT3 (A22434) and p-STAT3 (AP0705) antibodies were from ABclonal Technology (Wuhan, China). The HIF-1α antibody (bsm-62534R) was from Bioss (USA). The secondary antibodies Goat Anti-Rabbit IgG (A21020) and Goat Anti-Mouse IgG (A21010) were from Abbkine (Wuhan, China). For flow cytometry, fluorochrome-conjugated antibodies against CD16/CD32, CD3, F4/80, CD45, and CD19 were purchased from Elabscience Biotechnology Co., Ltd. (Wuhan, China), and antibodies against CD11b, NK1.1, CD206, and CD86 were obtained from BioLegend, Inc. (San Diego, California, USA).

2.2. Animal Treatment and Exposure Protocol

Seven-week-old SPF female (n = 60) and male (n = 30) BALB/c mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. Mice were housed in a controlled environment (22 ± 2 °C, 12 h light/dark cycle, 50% ± 10% humidity) with ad libitum food and water. After a 1-week acclimatization, females were mated with males, and the presence of a vaginal plug marked GD0.5. All procedures were approved by the Animal Ethics Research Committee of Zhengzhou University (ethical number: ZZUIRB 2023-0013).

MC-LR was administered intraperitoneally (i.p.) at a dose of 20 μg/kg/day from GD3.5 to GD5.5. Control animals received equivalent volumes of physiological saline via the same route. The selected dose of 20 μg/kg/day is approximately half the reported no observed adverse effect level (NOAEL) for mice and is below the tolerable daily intake (TDI) for humans. This dose was chosen to simulate environmentally relevant subtoxic exposure and to investigate subtle reproductive effects during the sensitive peri-implantation window. The i.p. route was selected to ensure precise dosing and to approximate oral pharmacokinetics. Although a parenteral method, i.p. administration enables mesenteric absorption into the portal vein, preserving hepatic first-pass metabolism while reducing variability associated with gastrointestinal absorption. The selected exposure period, GD3.5 to GD5.5, corresponds to the peri-implantation window in mice, a critical time frame for uterine receptivity, embryo attachment, and early decidualization. Evaluating MC-LR effects during this window allows precise interrogation of its impact on implantation-related processes.

Garcinone D, a pharmacological activator of STAT3, was administered by oral gavage at 1 mg/kg/day, 2 h before each MC-LR injection during GD3.5-GD5.5, representing a preventive regimen. The dose was determined based on preliminary in vivo experiments conducted in this study, confirming its efficacy in activating uterine STAT3 without inducing systemic toxicity. Oral administration was chosen to mimic clinically relevant routes and avoid potential interference with the intraperitoneal delivery of MC-LR. Control mice received an equivalent volume of physiological saline.

2.3. Serum Hormone Measurement

Serum levels of estrogen (E2) and progesterone (PGN) were determined using ELISA kits (Jiangsu Meimian Industrial Co., Ltd.), following the manufacturer’s protocols. Briefly, 50 μL of serum or standard solution was added to each well, followed by 50 μL of HRP-conjugated antibody. Plates were incubated at 37 °C for 60 min, washed, and incubated with substrate solution for 15 min. The reaction was terminated with 50 μL of stop solution, and absorbance was measured at 450 nm using a microplate reader. Hormone concentrations were calculated from the standard curve. Six mice were analyzed per group.

2.4. Evaluation of Embryo Implantation

Embryo implantation was assessed on GD3.5, 4.5, and 5.5 using 1% Evans blue dye (Solarbio, China). Briefly, 200 μL of the dye solution was injected into the lateral tail vein of each mouse. Following a 30 min circulation period, mice were euthanized. The uterine tissue was excised and observed, and implantation sites were identified as distinct blue bands along the uterus and counted to evaluate implantation efficiency. Three mice per group were analyzed.

2.5. Hematoxylin–Eosin Staining (H&E Staining)

Uterine tissues were fixed in 4% paraformaldehyde for 24 h, embedded in paraffin, and sectioned at 6 μm thickness. Sections were mounted onto glass slides, dried at 45 °C, and then deparaffinized with xylene. After rehydration through a graded ethanol series (100, 95, 85, and 75%) to water, slides were stained with hematoxylin for 4 min, rinsed in running water until partially blue, and differentiated as needed. Following eosin staining for 1 min, slides were dehydrated in ascending concentrations of ethanol, cleared in xylene, and mounted with neutral resin. Histological morphology was observed using a light microscope.

For each uterine sample, 6 μm consecutive serial sections were prepared. A systematic random sampling approach was used, starting from a randomly selected section, then selecting every 10th section from the tissue block for analysis. This resulted in six to eight sections per animal being analyzed, ensuring representative sampling across the tissue. Gland counts were performed on the selected sections, and the gland count for each animal was the average of the counts from the selected sections. Three mice per group were analyzed.

2.6. Immunohistochemistry

Paraffin-embedded uterine sections (6 μm) were deparaffinized in xylene and rehydrated through a graded ethanol series. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 10 min. After antigen retrieval in citrate buffer (pH 6.0), sections were blocked with 5% bovine serum albumin (BSA) for 30 min at room temperature. Slides were incubated overnight at 4 °C with anti-CD31 primary antibody (ab182981, Abcam), followed by HRP-conjugated secondary antibody for 50 min at room temperature. Signals were visualized using DAB chromogen, and nuclei were counterstained with hematoxylin. After dehydration and xylene clearing, sections were mounted and imaged under a light microscope. CD31-positive microvessels were quantified using ImageJ based on positively stained areas. Three mice per group were analyzed.

2.7. Quantitative Real-Time PCR (qPCR)

Total RNA was extracted from mouse uterine tissues using TRIzon reagent (CWBIO, China), following the manufacturer’s instructions. RNA concentration and purity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), and RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, USA). First-strand cDNA was synthesized from 1 μg of total RNA using the SweScript All-in-One RT SuperMix for qPCR (One-Step gDNA Remover) (Servicebio, China), according to the manufacturer’s protocol. Quantitative PCR was performed using 2× Universal Blue SYBR Green qPCR Master Mix (Servicebio, China) on a QuantStudio 7 Flex Real-Time PCR system (Applied Biosystems, USA). The amplification conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Melting curve analysis was performed to verify primer specificity. Relative mRNA expression was calculated using the 2^–ΔΔCt method, with GAPDH as the internal reference gene. qPCR reactions were performed in technical triplicates for each biological sample, with three independent biological replicates (n = 3 mice per group). Primer sequences are listed in Table .

1. Primer Sequences Used in qPCR.

genes	forward primers (5′–3′)	reverse primers (5′–3′)
Angpt1	CACATAGGGTGCAGCAACCA	CGTCGTGTTCTGGAAGAATGA
Angpt4	CGGGAGGATGGAAGCGTAAA	TTCCACGCGTAGCAAGTAGG
Arg1	GTACATTGGCTTGCGAGACG	AATCGGCCTTTTCTTCCTTCC
Hoxa10	CCTGCCGCGAACTCCTTTT	GGCGCTTCATTACGCTTGC
Cdh1	CTCCAGTCATAGGGAGCTGTC	TCTTCTGAGACCTGGGTACAC
Cdh2	AGCGCAGTCTTACCGAAGG	TCGCTGCTTTCATACTGAACTTT
Col1a1	ACGCCATCAAGGTCTACTGC	ACTCGAACGGGAATCCATCG
Col6a5	CCAAACATGACACGGATCATCA	GGAACTGTCTTATCAACGTGGT
Csf3	CAGCCCAGATCACCCAGAATC	GCTGCAGGGCCATTAGCTTC
Igfbp1	ATCAGCCCATCCTGTGGAAC	TGCAGCTAATCTCTCTAGCACTT
Il1β	AGCTACGAATCTCCGACCAC	CGTTATCCCATGTGTCGAAGAA
Il4	GGTCTCAACCCCCAGCTAGT	GCCGATGATCTCTCTCAAGTGAT
Il6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
Il10	GCTCTTACTGACTGGCATGAG	CGCAGCTCTAGGAGCATGTG
Nos2	TCTAGTGAAGCAAAGCCCAACA	TGATGGACCCCAAGCAAGAC
Plau	CATGCCTCCCTTCCCACTAC	TCTGAATCCGCACAACACCA
Serpine1	CAAGGGGCAACGGATAGACA	AAGCAAGCTGTGTCAAGGGA
Socs3	ATGGTCACCCACAGCAAGTTT	TCCAGTAGAATCCGCTCTCCT
Timp1	GCAACTCGGACCTGGTCATAA	CGGCCCGTGATGAGAAACT
Tnfa	ACCCTCACACTCACAAACCA	ACAAGGTACAACCCATCGGC
Vegfa	GTCCGATTGAGACCCTGGTG	TTGACCCTTTCCCTTTCCTCG
Gapdh	GGTTGTCTCCTGCGACTTCA	TGGTCCAGGGTTTCTTACTCC

2.8. Western Blotting

Total protein was extracted from 50 mg of uterine tissue using RIPA lysis buffer (Beyotime, China) supplemented with protease and phosphatase inhibitors (M7528, AbMole, USA). Tissues were homogenized with stainless-steel beads on ice using a tissue grinder, incubated for 30 min with intermittent sonication, and centrifuged at 12,000 × g for 10 min at 4 °C. The supernatant was collected, and protein concentration was determined using a BCA protein assay kit (AP12L025, Life-iLab, China). Protein samples were normalized to equal concentrations, mixed with 5× loading buffer, and denatured at 95 °C for 5 min.

Equal amounts of protein were separated by SDS-PAGE (PG112, Epizyme, Shanghai, China) and transferred to PVDF membranes (0.22 μm pore size, Millipore, USA). Membranes were blocked with 5% nonfat milk in TBST for 2 h at room temperature and incubated overnight at 4 °C with primary antibodies. After washing, membranes were incubated with species-specific HRP-conjugated secondary antibodies for 1 h at room temperature. Bands were visualized using enhanced chemiluminescence (ECL) reagent (Affinity, USA) and imaged using a Touch Imager XLi system (Eblot, China). Band intensities were quantified using ImageJ software and normalized to GAPDH. Each group included samples from three mice.

2.9. RNA Sequencing

Total RNA was extracted from uterine tissues on GD5.5 using TRIzol. RNA quantity and quality were assessed by NanoDrop and Agilent Bioanalyzer, and only high-quality samples (RIN ≥ 7.0) were used for library construction. mRNA was enriched using oligo­(dT) magnetic beads, fragmented, and reverse-transcribed into cDNA. After adaptor ligation and PCR amplification, libraries were circularized and amplified into DNA nanoballs for sequencing on the DNBSEQ-T7 platform (MGI, China). Transcriptome sequencing and gene expression analysis were performed by BIOYIGENE (Wuhan, China). Each group included samples from three mice.

2.10. Flow Cytometry for Immune Cell Profiling

Uterine tissues were minced and digested in RPMI 1640 medium (AMM1201, Arizona) supplemented with 200 U/mL collagenase type III (Solarbio, China) and 10% fetal bovine serum (BioChannel Biological Technology Co., Ltd.) at 37 °C for 30 min with gentle agitation. The resulting cell suspension was filtered through a 70 μm cell strainer and treated with red blood cell lysis buffer (1:3 dilution) for 5 min at room temperature. After centrifugation (450 × g, 5 min, 4 °C), cells were washed with PBS and resuspended for immunostaining.

For surface marker staining, 1 × 10⁶ cells were incubated with CD16/CD32 antibody for 15 min at 4 °C to block nonspecific Fc receptor binding. Cells were then stained with fluorochrome-conjugated monoclonal antibodies against CD45 (pan-leukocyte marker), CD11b and F4/80 (macrophages), CD86 (M1-like macrophages), CD3 (T cells), CD19 (B cells), and NK1.1 (NK cells). Intracellular staining for CD206 (M2-like macrophages) was performed using the BD Cytofix/Cytoperm fixation/permeabilization kit (BD Biosciences) according to the manufacturer’s protocol. Samples were acquired on a NovoCyte 3080 flow cytometer (Agilent, USA). Data were analyzed using NovoExpress software (Agilent Technologies). Isotype-matched controls and fluorescence-minus-one (FMO) controls were included to ensure gating specificity. Three mice per group were analyzed.

2.11. Detection of Microcystins in Uterine Tissue

Uterine tissues were collected at GD5.5, rinsed with ice-cold PBS, blotted dry, weighed (wet weight), and processed immediately. Each sample was homogenized on ice in 90% methanol at 1 mL per 100 mg tissue, vortexed, sonicated (3 × 10 s), and centrifuged at 3000 × g for 10 min at 4 °C. The supernatant was evaporated to dryness under nitrogen and reconstituted in 1.0 mL of the kit 1× assay buffer. Total microcystins were quantified by competitive ADDA-ELISA in accordance with the manufacturer’s instructions (Cayman, USA). Standards and samples, run in duplicate, were incubated for 2 h at room temperature, plates were washed and developed with TMB, the reaction was stopped, and absorbance was read at 450 nm. Concentrations were calculated from a four-parameter logistic calibration curve, corrected for dilution, and expressed as MC-LR equivalents in ng/g (wet weight). Six mice per group were analyzed.

2.12. Statistical Analysis

Data are presented as mean ± standard deviation (SD). Statistical analyses were performed using SPSS 21.0 software. For comparisons between two groups, independent-sample t tests were used. For comparisons among multiple groups, one-way ANOVA was performed, followed by Student–Newman–Keuls (SNK) post hoc tests for equal variances or Dunnett’s T3 test for unequal variances, as determined by Levene’s test. A p-value < 0.05 was considered statistically significant.

3. Results and Discussion

3.1. MC-LR Exposure during the Peri-Implantation Period Impairs Endometrial Receptivity

Although the reproductive toxicity of MC-LR is widely recognized, its effects on the uterus during pregnancy remain insufficiently characterized. This study investigated the impact of MC-LR exposure during the peri-implantation period (GD3.5 to GD5.5), a critical window for the establishment of uterine receptivity and successful embryo implantation (Figure A). No significant differences in maternal body weight were observed between the MC-LR-treated and control groups at any examined time point (Figure B). However, a significant reduction in uterine index was observed in the MC-LR group on GD5.5 (p < 0.05) (Figure C), indicating that the uterus may exhibit heightened sensitivity to toxicant exposure during this critical period. Compared with the control group (<LOD), uterine microcystins (MC-LR equivalents) at GD5.5 measured by ELISA increased with exposure duration during GD3.5 to GD5.5: 4.38 ± 1.13, 7.94 ± 1.53, and 10.91 ± 2.43 ng/g wet weight after 1, 2, and 3 days, respectively (Figure D). This time-dependent rise indicates uterine accumulation during the peri-implantation window, suggesting a direct uterine effect of MC-LR. Serum hormone analysis showed that while E2 levels remained unchanged, PGN levels were significantly decreased at all examined time points following MC-LR exposure (p < 0.05) (Figure E). PGN is essential for endometrial remodeling, and the establishment of immune tolerance during early pregnancy. Its sustained reduction may disrupt endocrine signaling necessary for establishing a receptive endometrium.

1.

MC-LR exposure during the peri-implantation period impairs endometrial receptivity in mice. (A) Schematic diagram illustrating the MC-LR exposure protocol in mice during the peri-implantation period. Mice were intraperitoneally injected with MC-LR at a dose of 20 μg/kg/day on gestational days (GD) 3.5, 4.5, and 5.5. (B) Changes in body weight and (C) uterine index following MC-LR treatment (n = 8). (D) Uterine microcystins (ng/g wet weight) measured by ELISA, reported as MC-LR equivalents (n = 6). (E) Serum levels of E2 and PGN measured by ELISA (n = 6). (F) Representative histological images of uterine tissue stained with H&E staining. Black arrows indicate uterine glands; red arrows indicate loss of columnar epithelial cells. Scale bar = 500 μm. (G) Quantification of uterine gland number (n = 3). (H) Relative mRNA expression levels of the endometrial receptivity markers (Hoxa10 and Igfbp1) analyzed by qPCR (n = 3). (I) The number of implanted embryos was assessed at GD5.5 following 1-, 2-, or 3-day MC-LR exposure during the peri-implantation period (n = 3). *p < 0.05 vs control group at the corresponding time point.

Histological evaluation of GD5.5 uterine tissues observed a loss of columnar epithelial cells and a significant reduction in the number of uterine glands (p < 0.05) (Figure F,G), which may hinder embryo implantation. Consistently, the expression levels of Hoxa10 and Igfbp1, two key molecular markers of endometrial receptivity, were significantly downregulated in the MC-LR group on GD5.5 (p < 0.05) (Figure H). These genes modulate ECM remodeling and embryo–endometrium interaction necessary for implantation, and their suppression further corroborates the impairment of endometrial receptivity. Functionally, MC-LR exposure from GD3.5 to 5.5 significantly reduced the number of implantation sites in the uterus (p < 0.05) (Figure I), suggesting that impaired endometrial receptivity ultimately compromises implantation competence.

These results suggest that MC-LR disrupts hormonal homeostasis, impairs endometrial structure, and downregulates receptivity-related genes, ultimately compromising embryo implantation. Our findings highlight the heightened vulnerability of the peri-implantation period to environmental toxicants and reveal a previously underappreciated reproductive risk associated with MC-LR exposure.

3.2. Transcriptomic Profiling Reveals Mechanisms Underlying MC-LR-Induced Uterine Dysfunction

To uncover the molecular basis of MC-LR-induced uterine impairment, transcriptomic sequencing was performed on uterine tissues collected at GD5.5. This time point was selected because it represents the optimal implantation window and showed the most pronounced pathological alterations in response to MC-LR exposure in the current study.

A total of 1264 differentially expressed genes (DEGs) were identified between MC-LR-treated and control groups (586 upregulated, 678 downregulated; |fold change| > 3, p < 0.05) ( Figure A). GO enrichment analysis revealed that immune response, hormone activity, and extracellular region were among the top 10 GO terms ranked by the number of DEGs (Figure B). These biological processes are fundamental to establishing a receptive uterine environment. Immune tolerance facilitates maternal–fetal immune adaptation, reducing inflammatory rejection of the embryo. Hormonal signaling regulates epithelial receptivity and stromal decidualization, critical for preparing the endometrium for implantation. Meanwhile, ECM remodeling reorganizes the endometrial structure to enable embryo invasion and stable attachment. Disruption of these coordinated processes can lead to implantation failure and compromised pregnancy outcomes.

2.

Transcriptomic analysis reveals altered gene expression and enriched pathways involved in MC-LR-induced uterine toxicity. Uterine tissues were collected from GD5.5 pregnant mice following MC-LR exposure and from matched controls for transcriptomic sequencing (n = 3). (A) Volcano plot showing DEGs with |fold change| > 3 and p < 0.05. (B) Gene Ontology (GO) enrichment analysis of DEGs, categorized into biological process (BP), cellular component (CC), and molecular function (MF). (C) KEGG pathway enrichment analysis of DEGs involved in biological processes related to extracellular region, immune response, and hormone activity. (D) Protein–protein interaction (PPI) network of DEGs involved in the JAK-STAT signaling pathway, constructed using the STRING database. (E) The corresponding heatmap displays their expression patterns and functional classification.

KEGG pathway enrichment further highlighted consistent involvement of the JAK-STAT signaling pathway across all three biological process (Figure C), suggesting it as a shared regulatory mechanism. STRING-based protein–protein interaction analysis revealed a tightly interconnected network of genes associated with the JAK-STAT pathway (Figure D), including key regulators of ECM remodeling (Timp1, Serpine1), angiogenesis (Angpt1, Angpt4), hormone activity (Lep, Prl6a1), STAT regulators (Csf3, Socs3), and immune responses (Il6, Tnfa) (Figure E).

STAT signaling is known to coordinate immune balance, angiogenesis, and ECM dynamics in the uterus. Its activation by cytokines and hormones promotes endometrial receptivity, while its disruption impairs decidualization and implantation-related remodeling. Notably, similar transcriptional changes have been observed in endometrial cells following exposure to environmental endocrine disruptors such as bisphenol A and phthalates. Our findings suggest that MC-LR may disrupt endometrial function through a comparable mechanism, potentially by interfering with immune regulation, angiogenesis, and ECM remodeling, all crucial for successful implantation.

3.3. MC-LR Disrupts Uterine Immune Homeostasis by Altering Cytokine and Immune Cell Profiles

Immune homeostasis is crucial during embryo implantation, as the uterus must maintain an immune-tolerant environment to prevent the maternal immune system from rejecting the embryo. Disruption of immune balance can significantly impair uterine receptivity, leading to implantation failure. In this study, we found that MC-LR exposure during the peri-implantation period induces significant alterations in immune-related gene expression and immune cell populations, which contribute to immune dysfunction in the uterus.

At GD5.5, qPCR showed downregulation of Il6, Il1b, and Il10, accompanied by upregulation of Tnfa in the MC-LR-exposed group relative to time-matched controls (p < 0.05) (Figure A). Western blot analysis further confirmed reduced protein levels of IL-1β, IL-6, and IL-10 and increased TNFα expression (Figure B–G). These cytokines play pivotal roles in modulating uterine immune responses. IL-6 and IL-1β support decidualization, angiogenesis, and maternal–fetal immune communication, whereas IL-10 restrains inflammatory activity and promotes tolerance. In controls, IL-6 and IL-1β increased from GD3.5 to GD5.5 and IL-10 rose toward the end of the window, which is consistent with the well-described transient pro-inflammatory phase that initiates implantation in mice and with classic reports of uterine IL-1, IL-6, and TNFα expression during the peri-implantation period, , whereas IL-4 changed little. With MC-LR exposure, the increases observed in controls were blunted and TNFα was higher than time-matched controls, indicating a pro-inflammatory skew that is unfavorable for receptivity and has been linked to trophoblast apoptosis, impaired vascular changes, and implantation failure. − Together, these findings suggest that MC-LR-induced cytokine imbalance compromises uterine immune tolerance and endometrial receptivity.

3.

Peri-implantation MC-LR exposure alters uterine cytokine expression and immune cell composition during implantation. (A) Heatmap presentation of qPCR results showing the expression of immune-related genes (Il6, Tnfa, Il1b, Il4, and Il10) in uterine tissue (n = 3). (B) Western blot analysis of IL-1β, TNFα, IL-6, IL-4, and IL-10 protein levels in the uterus, with densitometric quantification using ImageJ (C–G) (n = 3). (H) Flow cytometric analysis of immune cell subtypes in uterine tissue, including macrophages, NK cells, B cells, and T cells, with statistical comparisons shown in (I) (n = 3). (J) The mRNA expressions of the M2-like macrophage marker (Arg1) and the M1-like macrophage marker (Nos2) were detected by qPCR (n = 3). *p < 0.05 vs control group at the corresponding time point.

Given that IL-6, IL-1β, and IL-10 are mainly secreted by macrophages, T cells, and dendritic cells, while TNFα is primarily produced by macrophages and NK cells, , we examined whether MC-LR alters uterine immune cell populations. Flow cytometry analysis showed that MC-LR exposure decreased the M2-to-M1 frequency ratio, and increased the proportions of NK cells and B cells within CD45⁺ leukocytes at GD5.5 (p < 0.05) (Figure H,I). As an independent transcript readout of macrophage polarization, qPCR of uterine tissue showed a decreased Arg1 to Nos2 expression ratio after MC-LR exposure (Figure J), in line with the flow findings and indicative of an M1-like bias. These shifts are consistent with the cytokine changes and indicate a move from an immune-tolerant toward a more pro-inflammatory uterine milieu.

Mechanistically, MC-LR can inhibit the serine/threonine phosphatases PP1 and PP2A, thereby elevating kinase signaling and oxidative stress. This promotes activation of NFκB and MAPK and primes the NLRP3 inflammasome. , In parallel, it weakens IL-10-dependent STAT3 and Arg1 programs that maintain tolerance in macrophages. , These features provide a coherent basis for the observed M1-like shift and align with the cytokine changes.

3.4. STAT3/HIF-1α Signaling Mediates Immune Gene Dysregulation in the Uterus Following MC-LR Exposure

IL-6 is a key immunoregulatory cytokine that activates STAT3 through its receptor complex, leading to phosphorylation and nuclear translocation of STAT3. Activated STAT3 regulates gene expression involved in maintaining immune balance, promoting angiogenesis, and remodeling the uterine environment for embryo implantation. Transcriptomic and qPCR analyses revealed discordant changes in two key STAT3-associated genes. Csf3 encodes granulocyte colony-stimulating factor (G-CSF), a cytokine involved in STAT3 signaling, and its expression was significantly upregulated at GD5.5 (p < 0.05) (Figure A). Conversely, Socs3 expression was downregulated at the same time point (p < 0.05) (Figure A). Given that Socs3 reflects STAT3 activity, this pattern suggests that despite Csf3 upregulation, reduced IL-6 may have constrained STAT3 activation, resulting in lower Socs3 expression.

4.

MC-LR downregulates immune-related gene expression through suppressing STAT3/HIF-1α signaling in the uterus. (A) Heatmap visualization of qPCR results showing the expression of genes that regulate STAT3 signaling (Socs3 and Csf3) in mouse uterine tissue. (B) Western blot analysis of STAT3 and its downstream target HIF-1α in uterine tissue following MC-LR exposure, with densitometric quantification shown in (C). During the MC-LR exposure period (up to GD5.5), mice were administered the STAT3 activator Garcinone D (1 mg/kg/day) via oral gavage. (D) Western blot analysis was performed to detect STAT3, p-STAT3, and HIF-1α protein levels in uterine tissue, with quantification performed using ImageJ (E). (F) qPCR was conducted to evaluate the expression levels of immune-related genes (Il6, Tnfa, Il1b, Il4, and Il10) in uterine tissue. n = 3, *p < 0.05 vs control group at the corresponding time point; ^# p < 0.05 vs MC-LR group at the corresponding time point.

Western blot analysis confirmed that MC-LR significantly suppressed STAT3 phosphorylation at GD3.5, GD4.5, and GD5.5 (p < 0.05) (Figure B,C), indicating inhibition of its activity, potentially reflecting a compensatory response to inflammatory stress. Given the suppressed STAT3 activity, we next examined HIF-1α, a cooperative transcription factor that functions with STAT3 to regulate immune gene expression under inflammatory and hypoxic conditions. MC-LR exposure significantly reduced uterine HIF-1α protein levels at GD3.5 and GD5.5 (p < 0.05) (Figure B,C), consistent with the observed suppression of STAT3 phosphorylation. HIF-1α not only regulates cytokine transcription but also supports trophoblast viability and endometrial angiogenesis, both critical for successful implantation.

Garcinone D treatment effectively increased the p-STAT3 and HIF-1α levels in MC-LR-exposed uteri (p < 0.05) (Figure D,E) and reversed the downregulation of Il6 and Il1b (p < 0.05) (Figure F). Taken together with this rescue, the data are consistent with an IL-6-STAT3/HIF-1α regulatory loop in which MC-LR lowers IL-6, attenuates STAT3 activation and HIF-1α cooperation, and thereby further limits IL-6 transcription. This framework reconciles the decrease in whole-tissue IL-6 with the reduced M2/M1 frequency ratio, because the ratio indexes macrophage phenotype whereas IL-6 reflects aggregate cytokine output that depends on intact STAT3/HIF-1α support.

3.5. MC-LR Impairs Extracellular Matrix Remodeling in the Uterus via STAT3/HIF-1α Signaling

ECM remodeling is essential for embryo implantation, as it provides structural support for trophoblast invasion and regulates uterine receptivity. To investigate whether MC-LR disrupts this process, we assessed ECM-related gene expression in uterine tissue based on transcriptomic profiling.

MC-LR exposure significantly downregulated the mRNA expression of Timp1, Serpine1, Plau, Col1a1, Col6a5, and Cdh1, while upregulating Cdh2 (p < 0.05) (Figure A). Western blot results confirmed reduced protein levels of TIMP1, SERPINE1, and PLAU, along with increased MMP9 expression (p < 0.05) (Figure B–F), suggesting an imbalance between matrix synthesis and degradation.

5.

Inhibition of STAT3/HIF-1α signaling by MC-LR disrupts extracellular matrix remodeling in the uterus. (A) Heatmap visualization of qPCR results showing the expression levels of extracellular matrix (ECM) remodeling-related genes (Timp1, Serpine1, Plau, Col1a1, Col6a5, Cdh1, and Cdh2) in mouse uterine tissue. (B) Western blot analysis of ECM remodeling-associated proteins TIMP1, SERPINE1, MMP9, and PLAU in uterine tissue, with densitometric quantification shown in (C–F). Mice were administered the STAT3 activator Garcinone D (1 mg/kg/day) via oral gavage throughout the MC-LR exposure period (up to GD5.5). (G) qPCR analysis of ECM remodeling-related genes (Timp1, Serpine1, Plau, Col1a1, Col6a5, and Mmp9) following Garcinone D treatment. (H) Western blot analysis of ECM remodeling-associated proteins TIMP1, SERPINE1, MMP9, and PLAU, with quantification performed using ImageJ (I–L). n = 3, *p < 0.05 vs control group at the corresponding time point; ^# p < 0.05 vs MC-LR group at the corresponding time point.

TIMP1 inhibits MMP9-mediated matrix degradation, and its reduction, alongside elevated MMP9, implies excessive ECM degradation. Both Plau, a promoter of plasmin-mediated matrix remodeling, and its inhibitor Serpine1 were downregulated, indicating disrupted proteolytic regulation. Furthermore, Col1a1 and Col6a5, encoding structural collagens, were decreased, suggesting impaired collagen deposition and matrix integrity.

MC-LR also induced a shift in epithelial–mesenchymal transition (EMT) markers. CDH1 (E-cadherin), crucial for epithelial adhesion, was suppressed, while CDH2 (N-cadherin), associated with mesenchymal characteristics, was upregulated. This shift may weaken epithelial integrity and compromise endometrial receptivity.

To assess the involvement of STAT3/HIF-1α signaling, we treated MC-LR-exposed mice with Garcinone D, a pharmacological activator of STAT3. Garcinone D attenuated the MC-LR-induced reductions in Timp1, Serpine1, Plau, Col1a1, and Col6a5 mRNA and the increase in Mmp9 at GD5.5 (p < 0.05) (Figure G). Consistently, compared with the MC-LR group, protein levels of TIMP1, SERPINE1, and PLAU were higher and MMP9 was lower after Garcinone D (p < 0.05) (Figure H–L). These findings indicate that inhibition of STAT3/HIF-1α contributes to MC-LR-induced disruption of uterine extracellular matrix remodeling, potentially reducing endometrial receptivity. Notably, these findings support involvement of the STAT3/HIF-1α axis in mediating protection but do not show that only this pathway is involved. Potential application is preliminary and should be confirmed with selective pharmacologic or genetic approaches and formal safety evaluation.

3.6. Disruption of STAT3/HIF-1α Signaling Contributes to MC-LR-Induced Impairment of Endometrial Receptivity

To elucidate the role of the STAT3/HIF-1α signaling in MC-LR-induced disruption of endometrial receptivity, pregnant mice were treated with the STAT3 activator Garcinone D alongside MC-LR exposure. Immunohistochemical analysis of CD31, a marker of endothelial integrity and angiogenesis, revealed that MC-LR exposure significantly reduced uterine vascular density, which was reversed following Garcinone D treatment (p < 0.05) (Figure A,B), suggesting that STAT3 activation ameliorates MC-LR-induced inhibition of uterine angiogenesis during the embryo implantation period.

6.

Activation of STAT3/HIF-1α signaling alleviates MC-LR-induced impairments in endometrial receptivity. During MC-LR exposure (up to GD5.5), pregnant mice were administered the STAT3 activator Garcinone D (1 mg/kg/day) via oral gavage. (A) Immunohistochemical staining of CD31 to visualize blood vessel distribution in uterine tissue, with relative expression quantified using ImageJ (B). (C) qPCR analysis of angiogenesis-related genes (Vegfa, Angpt1, and Angpt4) in the uterus. (D) H&E staining was performed to evaluate histopathological alterations in uterine tissue. Black arrows indicate uterine glands, red arrows indicate loss of columnar epithelial cells. Scale bar = 500 μm. (E) The number of uterine glands was quantified. (F) Expression levels of Hoxa10 and Igfbp1, markers of endometrial receptivity, were quantified by qPCR. (G) ELISA assay to measure serum PGN levels. (H, I) Observation and quantification of embryo implantation sites in the uterus. n = 3, *p < 0.05 vs control group at the corresponding time point; ^# p < 0.05 vs MC-LR group at the corresponding time point.

Consistently, qPCR results showed that MC-LR significantly downregulated angiogenesis-associated genes Vegfa, Angpt1, and Angpt4, whereas their expression was significantly increased upon STAT3 activation (p < 0.05) (Figure C). These findings are consistent with previous reports demonstrating that STAT3 functions as a transcriptional coactivator of HIF-1α, enhancing its ability to promote the expression of vascular growth factors such as Vegf and Angpts. The coordinated expression of these factors is critical for endometrial vascular remodeling and the establishment of a receptive uterine environment.

In endometrial tissue, MC-LR exposure led to a significant reduction in gland number, which was partially reversed by Garcinone D treatment (p < 0.05) (Figure D,E). The expression of key receptivity markers Hoxa10 and Igfbp1, both transcriptional targets of HIF-1α, were significantly suppressed by MC-LR and subsequently recovered following STAT3 activation (p < 0.05) (Figure F). These results highlight the critical role of the STAT3/HIF-1α signaling in maintaining endometrial receptivity at the molecular level.

Notably, although MC-LR exposure significantly reduced serum PGN levels, Garcinone D treatment did not reverse this hormonal disturbance (Figure G). As a pivotal regulator of endometrial receptivity, PGN is predominantly secreted by the ovarian corpus luteum, with additional contributions from the placenta during gestation. This hormone orchestrates multiple physiological processes essential for successful embryo implantation, including stromal decidualization, modulation of immune tolerance, and vascular remodeling of the uterine endometrium. The observation that STAT3 activation did not restore PGN levels raises the possibility that MC-LR may disrupt ovarian steroidogenesis, potentially representing an additional site of toxicity beyond the endometrial STAT3/HIF-1α pathway. Importantly, the ability of Garcinone D to rescue implantation despite persistent PGN deficiency suggests that restoration of the local uterine signaling microenvironment may compensate for the systemic hormonal imbalance. These findings point to a complex model in which both endocrine disruption and local signaling defects contribute to MC-LR-induced implantation failure. Specifically, the local STAT3 pathway plays a potentially decisive role in determining endometrial receptivity.

Finally, the number of embryo implantation sites was significantly reduced in MC-LR-exposed mice, corroborating the impairment of endometrial receptivity. However, Garcinone D treatment significantly increased the number of implantations (p < 0.05) (Figure H,I), indicating that STAT3/HIF-1α activation can mitigate implantation failure caused by MC-LR exposure. These findings underscore the pivotal role of STAT3/HIF-1α signaling in maintaining endometrial receptivity and highlight its potential as a therapeutic target for mitigating reproductive toxicity induced by MC-LR exposure.

4. Conclusions

Taken together, this study indicates that during the peri-implantation window, MC-LR accumulates in the uterus and decreases IL-6. This decrease is accompanied by reduced STAT3 phosphorylation and lower HIF-1α expression, indicating suppression of the IL-6-STAT3/HIF-1α axis. Suppression of this axis reduces transcription of immune-related cytokines (Il6, I l1b), extracellular matrix-related regulators (Timp1, Serpine1), and angiogenic factors (Vegfa, Angpt4). These transcriptional changes drive immune dysregulation, extracellular matrix degradation, and impaired angiogenesis, thereby weakening endometrial receptivity and reducing implantation. Our findings highlight the endometrium as a sensitive target of MC-LR toxicity and identify STAT3/HIF-1α signaling as a potential therapeutic axis for mitigating reproductive risks associated with environmental exposure.

This work was supported by the National Natural Science Foundation of China (Grant No. 82273594), the China Postdoctoral Science Foundation (Grant No. 2025M780725), and the Key Research Project of Higher Education Institutions in Henan Province (Grant No. 25A330002).

The authors declare no competing financial interest.