Repurposing the MEK inhibitor binimetinib as a dual anti-inflammatory and antifibrotic agent in pulmonary fibrosis

Abstract

Background

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive interstitial lung disease of unknown etiology with poor prognosis. The currently approved antifibrotic drugs only decelerate functional decline and fail to reverse established fibrosis or extend survival. Binimetinib, a highly selective and noncompetitive MEK1/2 inhibitor, has been approved for clinical use in malignancies such as melanoma and non–small cell lung cancer. This study aims to evaluate the therapeutic effects of binimetinib on IPF and to explore its underlying mechanism.

Methods

In this study, the antifibrotic effects and underlying mechanisms of binimetinib were evaluated both in vivo and in vitro.

Results

In vivo, experiments demonstrated that binimetinib markedly ameliorated bleomycin-induced pulmonary fibrosis in mice, as evidenced by the reduction in hydroxyproline content (184.3±25.4 µg in bleomycin group vs. 94.6±9.8 µg in high-dose binimetinib group, P<0.001) and fibrotic area (14.8%±2.9% in bleomycin group vs. 5.4%±1.6% in high-dose binimetinib group, P<0.001). In vitro, binimetinib directly targeted the MEK/ERK signaling cascade and concurrently inhibited both the TGF-β/SMAD and TGF-β/non-SMAD pathways, thereby suppressing fibroblast proliferation, migration, activation, and extracellular matrix deposition. Furthermore, binimetinib attenuated the overall activation of pulmonary macrophages through inhibition of the JAK/STAT pathway.

Conclusions

In summary, binimetinib exerted potent anti-inflammatory and antifibrotic effects by suppressing the activation of both fibroblasts and pulmonary macrophages, ultimately mitigating bleomycin-induced pulmonary fibrosis in mice.

Highlight box.

Key findings

• This study demonstrates that binimetinib exerts potent antifibrotic and anti-inflammatory effects both in vivo and in vitro.

What is known and what is new?

• Idiopathic pulmonary fibrosis (IPF) is a chronic interstitial lung disease of unknown etiology with poor prognosis. The currently approved drugs fail to reverse established fibrosis or extend survival.

• Binimetinib markedly alleviated bleomycin-induced pulmonary fibrosis and improved lung function in mice. Binimetinib suppressed fibroblast activation, proliferation, and extracellular matrix deposition in vitro and in vivo, through inhibiting both SMAD-dependent and non-SMAD signaling downstream of TGF-β. Binimetinib reduced macrophage-mediated inflammation by blocking the JAK/STAT pathway and modulating macrophage polarization.

What is the implication, and what should change now?

• These findings identify binimetinib as a promising dual anti-inflammatory and antifibrotic therapeutic candidate for pulmonary fibrosis.

Introduction

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, fibrotic interstitial lung disease of unknown etiology (1,2). It is characterized by epithelial cell injury and interstitial fibrosis, leading to progressive destruction of the alveolar architecture and respiratory failure (1). Patients with IPF typically present with insidious onset, rapid progression, and poor prognosis, with a median survival of only 2 to 4 years (2). The prevailing pathogenic model posits that, in genetically susceptible individuals, repeated injury to alveolar epithelial cells leads to aberrant epithelial repair, which in turn drives persistent fibrosis and excessive extracellular matrix (ECM) deposition (3). In recent years, clinical guidelines have recommended the use of nintedanib and pirfenidone for IPF treatment. However, clinical studies have shown that these agents merely slow disease progression yet neither reverse established fibrosis nor improve survival (4,5). Thus, there remains an urgent need to identify and develop novel therapeutic strategies for IPF.

Although IPF exhibits considerable biological complexity due to the involvement of multiple cell types and signaling pathways, inflammation secondary to tissue injury and chronic fibrotic remodeling represent two fundamental pathological processes (1,6,7). Aberrant activation and myofibroblastic differentiation of fibroblasts are considered central to the pathogenesis of pulmonary fibrosis, usually, triggered by repeating pulmonary injury events. Chronically activated myofibroblasts continuously secrete ECM proteins such as collagen and fibronectin (Fn), ultimately leading to the formation of fibrotic lesions in the lung (8). Furthermore, the development of pulmonary fibrosis is closely linked to persistent immune-inflammatory responses, particularly the activation and polarization of macrophages. During the early phase of IPF, alveolar macrophages predominantly exhibit an M1 proinflammatory phenotype, secreting cytokines such as interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) to amplify inflammation (9). As IPF progresses, macrophages shift toward an M2 profibrotic phenotype, secreting cytokines such as arginase-1 (ARG-1), which further stimulate mesenchymal cell activation (9-11). Therefore, fibroblasts and macrophages, as the core components of fibrosis remodeling and inflammation regulation, respectively, jointly perpetuate the inflammatory-fibrotic feedback loop in IPF pathological progression.

The mitogen-activated protein kinase (MAPK) signaling pathway, including extracellular signal-regulated kinase (ERK) cascade and upstream target MAPK/ERK kinase (MEK), is a key regulator of fibrosis (12). Existing studies have demonstrated that certain MEK inhibitors possess anti-inflammatory and antifibrotic potential in preclinical models. For instance, MEK inhibitor has been implicated in modulating inflammatory processes in hepatic and renal cells (13,14). Selumetinib has been shown to ameliorate dermal fibrosis (15) and suppress α-smooth muscle actin (α-SMA) expression in rat cardiomyocytes (16). Similarly, trametinib, a dual inhibitor of ERK1/2 and mTORC1 signaling, has been reported to reduce collagen deposition and fibroblast proliferation in renal tissue (17).

Binimetinib is an orally bioavailable, non-ATP-competitive, allosteric inhibitor of MEK1/2 that has been approved for clinical use in several malignancies, including melanoma and non-small cell lung cancer (18). By blocking MEK-mediated downstream signaling, binimetinib effectively inhibits aberrant cell proliferation and migration (18,19). However, its potential efficacy and mechanistic role in fibrotic diseases have not yet been explored.

This study aimed to systematically evaluate the therapeutic effects of binimetinib in a bleomycin-induced mouse model of pulmonary fibrosis in vivo, and to investigate its effects on fibroblast activation and macrophage-mediated inflammatory responses in vitro. By integrating in vivo and in vitro findings, we sought to elucidate the regulatory role of the MAPK/MEK signaling pathway in the development of pulmonary fibrosis. We present this article in accordance with the ARRIVE reporting checklist (available at https://jtd.amegroups.com/article/view/10.21037/jtd-2025-1-2696/rc).

Methods

Animals

Eight-week-old male C57BL/6J mice (weighing 20–22 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of NanKai Animal Resources Center (approval No. 2024-SYDWLL-000001) and were performed in accordance with institutional guidelines and relevant regulations for the care and use of animals.

Cells and cell culture

Mouse fibroblast cells (Mlg, ATCC) and mouse macrophage cells (RAW 264.7, ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, China) supplemented with 10% fetal bovine serum (FBS, Gibco, China). Both cell lines were maintained in a humidified incubator at 37 ℃ with 5% CO₂.

Model establishment and group assignment

Bleomycin-induced mouse model of pulmonary fibrosis

Bleomycin (BLM, Nippon Kayaku, Tokyo, Japan) was dissolved in sterile saline. Following established protocols (20), mice in the experimental groups received an intratracheal instillation of BLM (2 U/kg), while control mice received an equal volume of sterile saline.

A total of 60 mice were randomly divided into six groups (n=10 per group): control group, BLM model group, nintedanib group, and three binimetinib groups treated with low, medium, and high doses of binimetinib. On day 0, control mice were given saline intratracheally, whereas all other groups received BLM. Starting from day 7 after BLM instillation, mice in the positive control group were administered nintedanib (HWRK Chem, Beijing, China) orally at 60 mg/kg once daily. Mice in the binimetinib-treated groups received oral administration of binimetinib (HY-15202, MedChemExpress, USA) twice daily at 2.5, 5.0, and 10.0 mg/kg, respectively. Nintedanib was suspended in 1% carboxymethylcellulose sodium (CMC-Na, Sangon Biotech, Shanghai, China), and binimetinib was first dissolved in 5% dimethyl sulfoxide (DMSO, Solarbio, Beijing, China) and then diluted in 1% CMC-Na before oral administration (0.1 mL per mouse per dose). Mice in the control group and BLM model group were administered an equal volume of 1% CMC-Na daily. Body weight and survival were monitored throughout the study. On day 14, all mice were anesthetized for pulmonary function testing. Bronchoalveolar lavage fluid (BALF) was collected via tracheal cannulation. The left lung was harvested for histopathological examination, and the right lung was used for Western blotting (WB), quantitative reverse transcription-polymerase chain reaction (qRT-PCR), and hydroxyproline assay.

TGF-β1-stimulated fibroblast model

Recombinant TGF-β1 (10 ng/mL, P00121, Solarbio) was used to stimulate Mlg fibroblasts for 24 hours to establish an in vitro fibrosis model. Cells were divided into control, TGF-β1, nintedanib (1,000 nM), and three binimetinib treatment groups (250, 500, and 1,000 nM).

M1-like macrophage model and M2-like macrophage model

RAW 264.7 cells were seeded into six-well plates and divided into control, M1/M2 polarization, and three binimetinib treatment groups. After 24-hour cell culture, M1 polarization was induced using lipopolysaccharide (LPS, 100 ng/mL, Sigma Aldrich) and interferon-γ (IFN-γ, 20 ng/mL, PeproTech), while M2 polarization was induced with murine IL-4 (20 ng/mL, PeproTech) and IL-13 (20 ng/mL, PeproTech) (21). Following stimulation for 24 hours, cells were observed microscopically to confirm polarization. Binimetinib (250, 500, and 1000 nM) was then added and incubated for an additional 24 hours before cell collection for downstream analyses.

Micro-computed tomography (Micro-CT) imaging

To evaluate the degree of pulmonary fibrosis, micro-CT was performed on day 13 after BLM or saline treatment using a NEMO micro-CT scanner (PINGSENG Healthcare, Kunshan, China). Mice were anesthetized with isoflurane inhalation and scanned in the head-first-in prone position. Pulmonary images were reconstructed, and regions with different Hounsfield unit (HU) values were classified into fully and partially ventilated volumes, corresponding to healthy and fibrotic lung tissue, respectively.

Pulmonary function test

Mice were anesthetized and a sterile cannula was inserted in their tracheas. Pulmonary function was tested by body plethysmography and assessed using the AniRes 2005 system (Biolab, Beijing, China). Forced vital capacity (FVC) and dynamic compliance (Cdyn) were recorded.

BALF collection

Bronchoalveolar lavage was performed three times using 1 mL of phosphate-buffered saline (PBS, 4 ℃) each time. The collected lavage fluid was centrifuged at 3,500 rpm for 10 min. The supernatant was collected, while the cell pellet was treated with red blood cell lysis buffer, washed, and resuspended in 200 µL PBS. Total inflammatory cell counts were determined using a hemocytometer.

Hydroxyproline assay

Hydroxyproline content of the right lung was measured using the acid hydrolysis method followed by chloramine-T oxidation and spectrophotometric detection at 570 nm to quantify collagen deposition.

Lung histopathology

The dissected lungs were fixed in 10% formalin, dehydrated, paraffin-embedded, and sectioned at 5 µm. Sections were deparaffinized in xylene, rehydrated alcohol solutions, and then stained with hematoxylin and eosin (H&E) (G1120, Solarbio), Masson’s trichrome (G1340, Solarbio), or Sirius Red (G1473, Solarbio). Random microscopic images were captured using a Nikon microscope, while fibrotic and collagen deposition areas were quantified by ImageJ (National Institutes of Health, USA). The fibrosis ratio (%) was calculated as: the fibrotic area / the total lung tissue area.

Immunohistochemistry (IHC)

IHC was performed using a Polymer-HRP Detection System (PV-1022, MultiSciences). After deparaffinization and antigen retrieval by microwave heating, sections were blocked and incubated overnight at 4 ℃ with primary antibodies against fibronectin (Fn, CST #63779T), collagen-I (Col-1, CST #72026T), and F4/80 (Affinity #DF2789). Secondary antibody incubation, DAB visualization, and hematoxylin counterstaining followed. Stained slides were mounted for microscopic examination (40×). Quantitative analysis was conducted using ImageJ software to measure the integrated optical density (IOD) and positive staining area. The mean optical density (MOD = IOD/Area) was calculated for protein expression analysis.

Enzyme-linked immunosorbent assay (ELISA)

The following cytokines were measured using commercial ELISA kits: inducible nitric oxide synthase (iNOS), interleukin-6 (IL-6), IL-1β, interleukin-10 (IL-10), transforming growth factor-beta 1 (TGF-β1), secreted phosphoprotein 1 (SPP-1, also known as osteopontin), interleukin-4 (IL-4), and interleukin-13 (IL-13). To measure BALF cytokine levels, commercial ELISA kits were used according to the manufacturers’ protocols: Mouse iNOS ELISA Kit (E-EL-M0696, Elabscience), IL-6 (70-EK206/3-96, MultiSciences), IL-1β (70-EK201B/3-96, MultiSciences), IL-10 (70-EK210/4-96, MultiSciences), TGF-β1 (JL12223, Jianglai Bio), Osteopontin/SPP-1 (EK0483, Boster), IL-4 (70-EK204/2-96, MultiSciences), and IL-13 (70-EK213/2-96, MultiSciences).

qRT-PCR

Total RNA was extracted from lung tissue or cultured cells using an RNA extraction kit (TIANGEN, Beijing, China). Reverse transcription was performed using gDNA Remover SuperMix and 5×Hifair^® One Step RT SuperMix (YEASEN, Shanghai, China). The qRT-PCR was conducted using Hieff UNICON^® qPCR SYBR Green Master Mix (YEASEN, Shanghai, China) on an LC480 cycler (Roche). The primer sequences are listed in Table 1. Relative mRNA expression was normalized to the reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and analyzed using the 2^⁻ΔΔCT method.

Table 1. The primer sequences for qRT-PCR detection.

Gene	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
Fibronectin	GTGTAGCACAACTTCCAATTACGAA	GGAATTTCCGCCTCGAGTCT
Collagen I	CCAAGAAGACATCCCTGAAGTCA	TGCACGTCATCGCACACA
α-SMA	GCTGGTGATGATGCTCCCA	GCCCATTCCAACCATTACTCC
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
IL-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
IL-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
IFN-γ	ATGGAACTGGCAAAAGGATGG	TCAGCAGCGACTCCTTTTCCG
TNF-α	CAGGCGGTGCCTATGTCTC	CGATCACCCCGAAGTTCAGTAG
ARG-1	CTCCAAGCCAAAGTCCTTAGAG	GGAGCTGTCATTAGGGACATCA
TGF-β1	CCACCTGCAAGACCATCGAC	CTGGCGAGCCTTAGTTTGGAC
SPP-1	AGCAAGAAACTCTTCCAAGCAA	GTGAGATTCGTCAGATTCATCCG
APOE	CTGACAGGATGCCTAGCCG	CGCAGGTAATCCCAGAAGC

qRT-PCR, quantitative reverse transcription-polymerase chain reaction.

WB

Proteins were extracted from lung tissues and cells using Radio-Immunoprecipitation Assay (RIPA) lysis buffer (Sangon Biotech, China) supplemented with Cocktail (Targetmol, USA) and sodium fluoride (NaF). bicinchoninic acid (BCA) protein assay kit (Beyotime Biotechnology, China) was used to detect the protein concentration of the extracted solutions. Then the proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride (PVDF) membranes (Roche, Switzerland), and incubated overnight with specific primary antibodies (see Table 2), followed by incubating with horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam, UK) for 2 h. Protein bands were visualized using the enhanced chemiluminescence system (Affinity, USA). GAPDH served as the loading control.

Table 2. The primary antibodies using in Western blotting.

Antibody	Item No.	Company
α-SMA	AF1032	Affinity
Collagen I	72026T	CST
Fibronectin	63779T	CST
F4/80	DF2789	Affinity
SMAD2	5339T	CST
p-SMAD2	3108T	CST
SMAD3	9523T	CST
p-SMAD3	9520T	CST
MEK	AF6385	Affinity
p-MEK	AF8035	Affinity
ERK1/2	AF0155	Affinity
p-ERK1/2	AF1015	Affinity
iNOS	AF0199	Affinity
JNK	AF6318	Affinity
p-JNK	AF3318	Affinity
P38	AF6456	Affinity
p-P38	AF4001	Affinity
NF-κB	8242T	CST
p-NF-κB	3033T	CST
JAK2	AF6022	Affinity
p-JAK2	AF3024	Affinity
STAT1	AF6300	Affinity
p-STAT1	AF3300	Affinity
STAT3	AF6294	Affinity
p-STAT3	AF3293	Affinity

Methyl thiazolyl tetrazolium (MTT) assay

Cell viability and proliferation were evaluated using the MTT assay. After the predetermined drug incubation period, 15 µL MTT solution (5 mg/mL, Sangon Biotech, Shanghai, China) was added to each culture dish and incubated for 3 h at 37 ℃. The medium was discarded, and formazan crystals were dissolved in 150 µL DMSO. Absorbance was measured at 570 nm.

Wound-Healing assay

Mlg cells were seeded into 12-well plates and cultured in DMEM containing 0.1% FBS for 24 h. A linear cell-free wound area was made vertically across the cell monolayer with a 200-µL pipette tip. The 0-hour time point was designated as the adding time of binimetinib. Wound closure was photographed at 0, 6, 12, and 24 h using an inverted phase-contrast microscope (40×), and migration distances were quantified using ImageJ.

Statistical analysis

All data were expressed as mean ± standard deviation (SD) and analyzed using GraphPad Prism 10 (GraphPad Software, Boston, MA, USA). Survival curves were generated using the Kaplan-Meier method, and differences in survival distributions were evaluated using the Log-rank test. Statistical significance was assessed using one-way analysis of variance (ANOVA) and P<0.05 was considered statistically significant.

Results

Binimetinib attenuates bleomycin-induced pulmonary fibrosis in mice

As illustrated in Figure 1A, to determine the therapeutic potential of binimetinib in pulmonary fibrosis, a BLM-induced mouse model was established, and the antifibrotic efficacy of binimetinib was evaluated. During the experiment, body weight was monitored daily. As shown in Figure 1B, all groups except the NaCl control group exhibited weight loss after bleomycin administration. Following initiation of treatment on day 7, body weight began to recover in both the binimetinib and nintedanib groups, with recovery in the 10 mg/kg bid binimetinib group comparable to that in the 60 mg/kg qd nintedanib group. Furthermore, we closely monitored the mental state, hair growth, and general behavior of the mice throughout the experimental procedure and observed no significant adverse reactions or toxicity signs. As shown in Figure S1, no statistically significant differences (P=0.798) were found in survival curves among all the groups. On day 13 post-bleomycin, all mice underwent CT scanning and three-dimension pulmonary reconstruction (Figure 1C). The ventilated lung volume (represented in blue) was notably preserved in the high-dose binimetinib group (177.0±48.7 mm³ in BLM group vs. 290.6±41.3 mm³ in high-dose binimetinib group, P=0.010). Furthermore, mice receiving medium and high doses of binimetinib demonstrated significantly improved FVC and Cdyn values compared with the BLM model group.

Figure 1.

Binimetinib attenuates bleomycin-induced pulmonary fibrosis in mice. (A) The experimental flowchart. (B) The body weight changes. (C) The lung reconstruction and pulmonary function. (D) Hematoxylin & eosin (1×, 20×), Masson’s trichrome (20×), and Sirius Red (20×) staining of lung tissues. (E) The hydroxyproline content of right murine lungs. Data are presented as mean ± SD (n=10). *, P<0.05; **, P<0.01; ****, P<0.0001, represents significant difference vs. the bleomycin group. BLM, bleomycin; Cdyn, dynamic compliance; FVC, forced vital capacity; HE, hematoxylin & eosin; SD, standard deviation.

Histopathological staining demonstrated collagen deposition, inflammatory infiltration, and destructed tissue architecture, while these changes were remarkably alleviated by binimetinib in a dose-dependent manner (Figure 1D). H&E staining revealed overall lung architecture, while Masson and Sirius Red stains highlighted collagen fibers. Compared with the BLM model group, binimetinib-treated mice exhibited markedly reduced fibrotic area (14.8%±2.9% in BLM group vs. 5.4%±1.6% in high-dose binimetinib group, P<0.001) and collagen deposition. Consistently, hydroxyproline content (184.3±25.4 µg in BLM group vs. 94.6±9.8 µg in high-dose binimetinib group, P<0.001), a biochemical marker of collagen accumulation, was significantly decreased in the high-dose binimetinib group (Figure 1E). These findings together suggested that binimetinib could attenuate BLM-induced IPF in vivo.

Binimetinib suppresses fibroblast activation in bleomycin-induced fibrosis

Excessive ECM secretion serves as a hallmark of fibroblast activation. As shown in Figure 2A, IHC staining demonstrated a dose-dependent reduction of Fn and Col-1 deposition in the binimetinib groups compared with the BLM group. Consistently, mRNA and protein expression of α-SMA, Fn, and Col-1 were markedly downregulated in the mice administrated with binimetinib (Figure 2B,2C). Moreover, binimetinib inhibited the phosphorylation of SMAD2 and SMAD3 in BLM-induced fibrotic lungs (Figure 2C). As a selective MEK1/2 inhibitor, binimetinib also significantly decreased the phosphorylated-MEK1/2 expression in a dose-dependent manner and partially suppressed activation of downstream proteins including ERK, JNK, and p38. These together revealed that binimetinib was able to suppress the activation of fibroblasts in BLM-induced IPF.

Figure 2.

Binimetinib suppresses fibroblast activation in bleomycin-induced pulmonary fibrosis. (A) The immunohistochemistry staining for Fn and Col-1 (20×). (B) The relative mRNA expression of α-SMA, Fn, and Col-1. (C) The protein and phosphorylation levels of MEK1/2, SMAD2/3, and related signaling molecules. Data are presented as mean ± SD (n=10). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. Bin, binimetinib; BLM, bleomycin; IHC, immunohistochemistry; Nin, nintedanib; SD, standard deviation.

Binimetinib reduces pulmonary inflammation induced by bleomycin

BALF cell counts and cytokine levels were assessed for inflammation evaluation. As shown in Figure 3A, total inflammatory cell numbers and concentrations of iNOS, IL-6, IL-1β, IL-10, TGF-β1, SPP-1, IL-4, and IL-13 were reduced in the BALF samples form binimetinib-treated mice, particularly at 10 mg/kg bid. The IHC staining for macrophage marker F4/80 revealed diminished macrophage infiltration in the lungs from binimetinib groups (Figure 3B). What’s more, the results of WB further showed decreased iNOS expression and reduced phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in lung tissues following binimetinib treatment (Figure 3C). Together, these above demonstrated that binimetinib can alleviate pulmonary inflammation after intratracheal instillation of BLM.

Figure 3.

Binimetinib reduces bleomycin-induced pulmonary inflammation. (A) The cell counts and cytokine levels of bronchoalveolar lavage fluid. (B) The immunohistochemistry staining for macrophage marker F4/80 (20×). (C) The expression and phosphorylation of inflammatory proteins. Data are presented as mean ± SD (n=10). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. BALF, bronchoalveolar lavage fluid; Bin, binimetinib; BLM, bleomycin; IHC, immunohistochemistry; MOD, mean optical density; Nin, nintedanib; SD, standard deviation.

Binimetinib inhibits TGF-β1-induced fibroblast activation in vitro

To further validate the antifibrotic mechanism, TGF-β1 was used to induce fibroblast activation. As shown in Figure 4A, binimetinib suppressed fibroblast migration compared with the TGF-β1 group. Based on the MTT assay (Figure 4B), three concentration gradients (250, 500, and 1,000 nM) were selected for subsequent experiments. Consistent with in vivo results, binimetinib decreased α-SMA, Fn, and Col-1 expression at both mRNA and protein levels (Figure 4C,4D). Moreover, binimetinib reduced the phosphorylation of MEK1/2, SMAD2, and SMAD3, while also inhibiting ERK, JNK, p38, and NF-κB activation to varying degrees. Therefore, it was suggested that TGF-β1–induced fibroblast activation can be suppressed by binimetinib.

Figure 4.

Binimetinib inhibits TGF-β1–induced fibroblast activation. (A) Wound-healing assay (40×) showed the impact on fibroblast migration. (B) The methyl thiazolyl tetrazolium assay showed cell viability under different binimetinib concentrations. (C) The mRNA levels of α-SMA, Fn, and Col-1. (D) The protein and phosphorylation levels of related signaling molecules. Data are presented as mean ± SD (n=3). ns, no significance; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. Bin, binimetinib; CTL, control; Nin, nintedanib; SD, standard deviation.

Binimetinib suppresses macrophage activation

To explore the impact of our target drug on macrophage polarization, RAW264.7 cells were stimulated to M1 and M2 macrophage phenotypes with LPS/IFN-γ or IL-4/IL-13 respectively. As shown in Figure 5A, binimetinib reduced the mRNA expression of IL-1β, IL-6, TNF-α, and IFN-γ in M1 macrophages, as well as TGF-β1, ARG-1, SPP-1, and apolipoprotein E (APOE) in M2 macrophages. WB analysis (Figure 5B) demonstrated that binimetinib exhibited a dose-dependent inhibition of phosphorylated MEK and ERK in both macrophage subtypes. In M1 macrophages, binimetinib suppressed the protein phosphorylation of Janus kinase (JAK)2 and signal transducer and activator of transcription (STAT)1, meanwhile reducing expression of iNOS and p-NF-κB. In M2 macrophages, binimetinib markedly inhibited activation of the JAK2/STAT3 signaling pathway. The above results indicated that the activation of both proinflammatory and profibrotic macrophages was inhibited by binimetinib administration.

Figure 5.

Binimetinib suppresses macrophage activation. (A) The mRNA levels of inflammatory and profibrotic markers in M1 and M2 macrophages. (B) The phosphorylation levels of signaling proteins in M1 and M2 macrophages. Data are presented as mean ± SD (n=3). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. CTL, control; SD, standard deviation.

Discussion

This study suggests that binimetinib exerts potent antifibrotic and anti-inflammatory effects both in vivo and in vitro. Binimetinib attenuates pulmonary fibrosis by reducing cytokine production, limiting inflammatory cell infiltration, and suppressing macrophage activation. Compared with nintedanib, binimetinib exhibited a non-inferior or even superior efficacy in alleviating BLM-induced pulmonary fibrosis in mice. Mechanistically, binimetinib can not only directly inhibit MEK within the MAPK cascade but may also modulate both canonical and noncanonical TGF-β signaling, thereby preserving alveolar structure, reducing collagen deposition, and mitigating fibrotic remodeling. Collectively, these findings suggest that binimetinib is a potential candidate for antifibrotic therapy in IPF patients.

Binimetinib, an adenosine triphosphate (ATP)-noncompetitive allosteric inhibitor of MEK1/2, has been approved by the Food and Drug Administration (FDA) for combination therapy in patients with unresectable or metastatic BRAF V600E/K-mutant melanoma and BRAF V600E-mutant non-small cell lung cancer, at a maximum recommended dose of 45 mg twice daily (18). By blocking the MEK-ERK signaling cascade, binimetinib effectively inhibits aberrant cell proliferation and migration, thereby exerting potential anti-inflammatory and anti-fibrotic effects. Compared to other marketed MEK inhibitors, the currently reported adverse effects of binimetinib are restricted to manageable rash, diarrhea, and fatigue, and no pulmonary toxicity has been reported to date (22). A large-scale analysis of adverse event data indicated no statistically significant association between binimetinib and specific serious cardiovascular risks (23), suggesting that it possesses a relatively favorable cardiovascular safety profile, a characteristic particularly important for IPF patients requiring long-term treatment. Furthermore, binimetinib has a shorter plasma half-life, which reduces the potential risk of cumulative toxicity associated with sustained drug exposure, indicating its greater suitability for chronic non-oncological indications. Considering its preliminary preclinical anti-fibrotic potential and its favorable safety profile, this study selected binimetinib as the interventional agent, aiming to explore a new therapeutic strategy for IPF that combines potential efficacy with enhanced safety and tolerability. Although the repurposing of binimetinib holds promise for rapid clinical translation, the repositioning of an anticancer drug for non-malignant diseases entails challenges related to off-label use, long-term toxicity assessment, and ethical approval. Preclinical studies had shown that binimetinib inhibited tumor growth at doses of 3–30 mg/kg twice daily in mice without evident toxicity (19). Based on these data, we selected appropriate dose gradients for our experiments within a safe and potentially efficacious range.

Ample evidence identified TGF-β as a central mediator of fibrosis through the classical SMAD-dependent and nonclassical MAPK pathways (24). In the canonical pathway, TGF-β can activate SMAD2 and SMAD3, which form complexes with SMAD4 and translocate to the nucleus to regulate transcription of genes involved in fibroblast activation, myofibroblast differentiation, and ECM production. Our data showed that binimetinib reduced the phosphorylation of SMAD2/ SMAD3 in both murine lung tissues and fibroblasts, consistent with its direct suppression of the TGF-β/SMAD axis. Similar findings were reported for trametinib in renal fibrosis models (17).

TGF-β also activates non-SMAD-dependent pathways like MAPK branches, including ERK, JNK, and p38, which contribute to ECM deposition and fibrosis development (25). Elevated phosphorylated MAPK protein levels, including p-ERK, p-JNK, p-p38, had been detected in lung tissues from IPF patients (26). Given MEK1/2 serves as a critical kinase in the MAPK signaling pathway, it can further activate ERK1/2 and regulate various cellular behaviors by entering the nucleus (12,27). Among them, the MEK/ERK axis plays an important role in fibroblast proliferation and migration, while the JNK and p38 pathways are closely related to cellular inflammatory responses and epithelial-mesenchymal transition (27). Consistently, we found that binimetinib suppressed phosphorylation of ERK, JNK, and p38 in our murine lung tissues. These results suggested that, beyond directly targeting MEK/ERK signals, binimetinib also interfered with TGF-β-mediated MAPK axes to inhibit fibrogenesis.

In addition to its antifibrotic effects, binimetinib markedly reduced pulmonary inflammation during the acute injury phase of BLM-induced fibrosis. Binimetinib decreased the levels of pro-inflammatory cytokines and anti-inflammatory cytokines and diminished the macrophage infiltration. The observed downregulation of NF-κB activation suggested that binimetinib modulated the inflammatory signaling, consistent with findings in the inflammation and fibrosis models in other organs (13,17,28).

Macrophages play distinct roles at different stages of IPF progression (29). In an early stage, M1 type macrophages dominantly accumulate in the lungs and release pro-inflammatory cytokines, which is associated with JAK1/2 and STAT1 protein activation. While during the later stages, profibrotic macrophages gradually take the position, whose polarization could be activated through JAK1/2 and STAT3 pathway (9,29). Binimetinib exerted a dual suppression of inflammatory and fibrotic macrophage phenotypes, through inhibiting both p-JAK2/STAT1 in M1 macrophages and p-JAK2/STAT3 in M2 macrophages. These results aligned with several prior studies highlighting the importance of MEK/ERK1/2 signaling in both the initiation and resolution of inflammation (17,30).

We evaluated the therapeutic efficacy and underlying possible mechanisms (Figure 6) of binimetinib in the BLM-induced pulmonary fibrosis mouse model. Binimetinib therapy led to a marked reduction in fibrotic lung areas, accompanied by improvements in total ventilated lung volume and pulmonary function. Moreover, it also significantly suppressed the expression of markers associated with proinflammatory and profibrotic macrophages. We speculate that this dual inhibitory effect may result from the coexistence of inflammatory and fibrotic pathological phenotypes in the 14-day BLM model, thereby permitting simultaneous attenuation of both processes. Collectively, these findings suggest that binimetinib may play a pivotal role in mitigating the progression of pulmonary fibrosis in mice. Considering the differences in disease progression speed and physiological metabolism between animal models and human IPF, we cannot directly extrapolate the experimental duration to clinical treatment cycles. Instead, we propose that clinical intervention may require early initiation, and that treatment courses lasting several weeks to months should be explored to observe efficacy.

Figure 6.

Mechanism of dual anti-inflammatory and antifibrotic action of binimetinib in pulmonary fibrosis. Binimetinib directly targeted the MEK/ERK signaling cascade and concurrently inhibited both the TGF-β/SMAD and TGF-β/non-SMAD pathways in fibroblasts; meanwhile, binimetinib attenuated the overall activation of pulmonary macrophages through inhibition of the JAK/STAT pathway. Created in https://BioRender.com. ECM, extracellular matrix.

There are several limitations in this study. First, it was based on the BLM-IPF model, which, although the most robust and widely accepted preclinical animal model, primarily represented a fibrosis pattern along the airways and could not reproduced the complex pathological features of human fibrosis patterns. Second, the duration of binimetinib treatment and follow-up was relatively short, precluding assessment of long-term efficacy and safety. Finally, it is worth noting that not all the mice exhibited a significant response to our drug treatment, probably due to individual heterogeneity or different baseline disease burden. Although the current sample size is sufficient to support the preliminary conclusions of this study, its generalizability to a broader population still requires further validation through studies with larger sample sizes.

Conclusions

In summary, binimetinib significantly alleviated bleomycin-induced pulmonary fibrosis by suppressing fibroblast activation, ECM deposition, and macrophage polarization. Mechanistically, binimetinib inhibited the TGF-β/SMAD, MEK/ERK, and JAK/STAT signaling pathways, thereby exerting both antifibrotic and anti-inflammatory effects. These findings suggest that binimetinib, a clinically available MEK inhibitor, holds promise as a novel therapeutic agent for IPF and potentially other fibrotic lung diseases.

Supplementary

The article’s supplementary files as

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of NanKai Animal Resources Center (Approval No. 2024-SYDWLL-000001) and were performed in accordance with institutional guidelines and relevant regulations for the care and use of animals.

Data Sharing Statement

Available at https://jtd.amegroups.com/article/view/10.21037/jtd-2025-1-2696/dss

jtd-18-04-394-dss.pdf ^{(46.8KB, pdf)}

DOI: 10.21037/jtd-2025-1-2696