Skip to main content
Translational Cancer Research logoLink to Translational Cancer Research
. 2026 Apr 28;15(4):321. doi: 10.21037/tcr-2026-1-0080

The effect of astragaloside IV on doxorubicin-induced cardiotoxicity in young mice: exploring its cardioprotective effect during childhood tumor chemotherapy

Huai-Yang Liu 1,2,#, Jing-Jing Yang 1,2,#, Jin-Sheng Gao 2,3, Dan Tang 2,3, Ya-Jing Tian 2,3, Jia-Cheng Wang 1,2, Jin-Hu Yang 2,3, Shao-Fang Gao 1,
PMCID: PMC13190887  PMID: 42180961

Abstract

Background

Anthracyclines such as doxorubicin (DOX) are essential treatments in pediatric oncology but are highly associated with severe dose-dependent cardiotoxicity. The developing hearts of young patients are particularly vulnerable to DOX-induced oxidative damage, creating an urgent need for effective and safe cardioprotective strategies. This study aims to explore the protective efficacy of astragaloside IV (AS-IV) against DOX-induced cardiotoxicity in juvenile mice and investigate the underlying molecular mechanisms involving the silent information regulator 1 (Sirt1)/nuclear factor erythroid 2-related factor 2 (Nrf2) signaling axis and oxidative stress regulation.

Methods

Cell viability, reactive oxygen species (ROS) levels and Sirt1/Nrf2/heme oxygenase-1 gene expression were detected through Cell Counting Kit-8 (CCK-8), dichlorodihydrofluorescein diacetate (DCFH-DA) fluorescent probe and real-time quantitative polymerase chain reaction (RT-qPCR). For in vivo experiments, 3-week-old C57BL/6 young mice were randomly divided into control group, DOX group (3 mg/kg) and AS-IV group (5 mg/kg). Three days after administration, cardiac damage and protective effects were evaluated through weight monitoring, echocardiography, serum creatine kinase muscle/brain (MB) isoenzyme, hematoxylin-eosin staining, and caspase-3 immunofluorescence.

Results

In vitro AS-IV significantly increased cell viability (68.5% vs. 56.2%), reduced ROS fluorescence intensity and malondialdehyde content, and up-regulated Sirt1/Nrf2. In vivo studies showed that AS-IV effectively alleviated DOX-induced growth arrest in young mice (body weight growth rate 13.5% vs. −2.3%). Ultrasound showed significant improvement in left ventricular ejection fraction (65.4% vs. 48.2%). Serum creatine kinase isoenzyme MB level decreased from 5.29 to 4.09 ng/mL. In addition, AS-IV significantly reduced myocardial pathological damage, inhibited caspase-3-positive apoptosis rate from 28.5% to 12.4%, and restored tissue superoxide dismutase/glutathione activity.

Conclusions

AS-IV can inhibit oxidative stress and apoptosis by activating the Sirt1/Nrf2, effectively reduce DOX-induced cardiotoxicity in young mice and maintain normal growth and development, and has clinical application potential.

Keywords: Astragaloside IV (AS-IV), doxorubicin (DOX), cardiotoxicity, young mice, silent information regulator 1/nuclear factor erythroid 2-related factor 2 (Sirt1/Nrf2)


Highlight box.

Key findings

• In H9c2 cardiomyocytes, astragaloside IV (AS-IV) improved viability, reduced oxidative injury, and up-regulated silent information regulator 1/nuclear factor erythroid 2-related factor 2 (Sirt1/Nrf2)-related antioxidant signaling.

• In 3-week-old mice, AS-IV mitigated doxorubicin-induced growth arrest, improved systolic function, lowered creatine kinase-muscle/brain levels, and reduced caspase-3-positive apoptosis.

What is known and what is new?

• Anthracycline chemotherapy causes clinically important, dose-related cardiotoxicity in pediatric oncology, and developing hearts are particularly vulnerable.

• This study provides pharmacodynamic evidence in a “young-age window” that AS-IV offers multi-level protection via Sirt1/Nrf2-centered redox control.

What is the implication, and what should change now?

• AS-IV merits consideration as an adjunct cardioprotectant for pediatric anthracycline regimens.

• Future studies should optimize dose/timing, confirm long-term benefits, and ensure non-interference with antitumor efficacy.

Introduction

With the development of modern pediatric oncology, multi-modal combination chemotherapy has significantly improved the long-term survival rate of childhood malignant tumors. The 5-year survival rate of childhood acute lymphoblastic leukemia and lymphoma currently exceeds 80% (1). However, the long-term complications associated with prolonged survival, especially cardiovascular disease related to chemotherapy drugs, have become the leading non-tumor causes of late death and reduced quality of life among survivors. The anthracycline antibiotic doxorubicin (DOX) is known as the cornerstone in treating children’s solid tumors and hematological malignancies due to its broad-spectrum and efficient anti-tumor activity (2). However, DOX has severe dose-dependent cardiotoxicity, which can clinically manifest as arrhythmias, left ventricular dysfunction and even irreversible congestive heart failure. Epidemiological data show that childhood cancer survivors who have received anthracycline treatment have a risk of cardiovascular disease that is more than 15 times higher than that of the general population (3). Compared with adults, young hearts in the critical period of growth and development are more sensitive to DOX-induced toxic damage. Juvenile cardiomyocytes are in a critical window of transition from proliferation to hypertrophy, and the mitochondrial metabolic function is not yet fully mature, and the antioxidant defense system reserve is relatively insufficient (4). Injury at this stage will not only lead to acute cardiomyocyte loss, but may also lead to permanent impairment of cardiac reserve function by interfering with the physiological expansion of cardiomyocytes, laying the hidden danger for early heart failure in adulthood. Therefore, finding an auxiliary protection strategy that can effectively reduce the cardiotoxicity of DOX without interfering with the normal growth and development of children and the efficacy of chemotherapy is an urgent challenge in pediatric oncology and cardiology (5).

In the field of childhood cancer treatment, anthracyclines significantly improve survival rates, but their cumulative dose-related myocardial damage can continue to progress to cardiomyopathy and heart failure many years after treatment. Therefore, the full chain management of “prevention-monitoring-intervention” has become a core issue for cardioprotection in pediatric tumors. Ehrhardt et al. updated the International Childhood Cancer Late Effects Guidelines Coordination Group recommendations for cardiomyopathy surveillance in high-risk survivors based on a systematic review of the evidence as of September 2020. It emphasized identifying asymptomatic structural/functional changes through stratified follow-up and imaging monitoring in people with previous anthracycline or cardiac irradiation, so as to strive for a therapeutic window in the reversible stage (6). At the “primary prevention” level, de Baat et al. gave internationally consistent recommendations for the concomitant use of deferazostatin in pediatric cancer patients who are expected to receive anthracycline treatment. They pointed out that previous concerns about its safety and insufficient clinical operability are important factors limiting its application. The guideline provides a clearer framework for “when/who/how to use together” through evidence grading and benefit-risk balance (7). Further, Chow et al. evaluated long-term outcomes based on multiple pediatric randomized trials with cohort follow-up. Compared with controls, it was associated with better left ventricular shortening fraction/ejection fraction and lower myocardial stress indicators such as B-type natriuretic peptide. It also suggests that this cardioprotective association can continue to the follow-up point of adolescence/early adulthood nearly 20 years later, and is more significant in people with higher cumulative anthracycline doses (8). At the “secondary prevention” level, Leerink and Feijen further discussed the concepts and pathways of anthracycline cardiotoxicity in childhood cancer survivors. The research emphasizes the importance of standardized intervention for those who have early subclinical cardiac dysfunction and forms a closed loop with the continuous monitoring strategy (9).

In terms of potential new cardioprotective drugs, astragaloside IV (AS-IV) is a main active saponin, which has formed relatively clear evidence of docking with anthracycline cardiotoxicity at the level of mechanisms such as “anti-inflammatory cell death/antioxidative stress/mitochondria and metabolic homeostasis”. Based on the DOX cardiotoxicity model, Tian et al. found that DOX can induce cell pyroptosis-related changes through caspase-1/GSDMD and cysteinyl aspartate specific proteinase-3 (caspase-3)/GSDME pathways. AS-IV treatment can improve cardiac function, reduce myocardial tissue damage and inhibit the expression of pyroptosis marker proteins, while reversing the down-regulation of silent information regulator 1 (Sirtuin 1, Sirt1) and the activation of NLRP3 inflammasome. Sirt1 inhibitors can weaken its protective effect, suggesting that “AS-IV-Sirt1/NLRP3-pyroptosis inhibition” constitutes a key axis of action (10). In addition, Luo et al. pointed out that AS-IV can inhibit the myocardial ferroptosis process caused by DOX by enhancing the nuclear factor erythroid 2-related factor 2 (Nrf2), thereby exhibiting a protective effect on myocardial damage and providing a pharmacological basis for the “anti-lipid peroxidation-anti-ferroptosis” mechanism chain that is highly related to anthracycline oxidative stress (11).

In summary, many experts have explored the cardiovascular monitoring guidelines for childhood cancer survivors, the primary prevention value of dexrazoxane, and the anti-pyroptosis and anti-ferroptosis mechanisms of AS-IV in DOX cardiotoxicity. However, current research still lacks pharmacodynamic evidence for the special developmental window period of “young age”. Existing clinical protective agents (such as dexrazoxane) may affect children’s growth and development or increase the risk of secondary tumors. In addition, the specific molecular mechanism by which AS-IV protects young mitochondrial function based on the Sirt1/Nrf2 axis is unclear. Therefore, the study proposes to use young mouse models to examine the protective effect of AS-IV on the cardiotoxicity of DOX to solve problems such as the lack of safe and effective cardioprotective auxiliary drugs for children’s chemotherapy, the potential toxic side effects of traditional drugs on the developing body, and the mechanism gap of traditional Chinese medicine monomers in the field of pediatric cardioprotection. It is hoped that it can contribute to improving the safety of childhood cancer chemotherapy and improving the long-term quality of life of children. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0080/rc).

Methods

Materials

The study employed 3-week-old male C57BL/6 mice in the critical period of post-weaning development as the in vivo experimental model. The weight was controlled within the range of 10–12 g. All animals were obtained from Vitong Lever Laboratory Animal Technology Co., Ltd. (Beijing, China), and were raised in a specific pathogen-free constant temperature and humidity environment. Humanitarian care is carried out in accordance with the operating procedures approved by the Experimental Animal Ethics Committee (12). All animal experiments were performed under a project license (No. DWLL202307004) granted by Ethics Committee of Hebei University of Chinese Medicine, in compliance with Chinese national or institutional guidelines for the care and use of animals. Mice were housed in standard cages under a 12-h light/dark cycle with ad libitum access to standard rodent chow and water. The H9c2 rat cardiomyocyte line used in in vitro experiments was purchased from the Cell Bank of the Chinese Academy of Sciences. The cell line was tested negative for mycoplasma contamination. The culture medium was Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal calf serum. The core drugs, AS-IV (purity ≥98%) and DOX, were purchased from Sigma-Aldrich Company (St. Louis, MO, USA). They were dissolved to working concentrations using dimethyl sulfoxide or physiological saline before administration. Cell Counting Kit-8 (CCK-8) for cell viability detection, reactive oxygen species (ROS), dichlorodihydrofluorescein diacetate (DCFH-DA) for oxidative stress assessment, and superoxide dismutase (SOD), malondialdehyde (MDA), glutathione (GSH) and creatine kinase-muscle/brain (CK-MB) biochemical detection kits were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) (13).

To deeply explore the regulatory mechanism of AS-IV on the molecular level of cardiomyocytes, the study used real-time quantitative polymerase chain reaction (RT-qPCR) technology to detect the messenger RNA (mRNA) expression levels of key genes, including Sirt1, Nrf2, heme oxygenase-1 (HO-1), apoptosis-related gene Bcl-2 associated X protein (Bax), and B-cell lymphoma-2 (Bcl-2). The internal reference gene is glyceraldehyde-3-phosphate dehydrogenase (GAPDH). All primers were designed and synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. (Shanghai, China). Table 1 illustrates the specific primer sequences.

Table 1. Primer sequences of target genes.

Gene Forward primer (5'-3') Reverse primer (5'-3') Accession No.
Sirt1 TAGCCTTGTCAGATAAGGAAGGA ACAGCTTCACAGTCAACTTTGT NM_001106313
Nrf2 TTGTAGATGACCATGAGTCGC TGTCCTGCTGTATGCTGCTT NM_031789
HO-1 TCGTGCTCGAATGAACACTC TCTGCAGGGGCAGTATCTTG NM_012580
Bax AGACAGGGGCCTTTTTGCTAC AATTCGCCGGAGACACTCG NM_017059
Bcl-2 GGGATGCCTTTGTGGAACTAT TGAGCAGCGTCTTCAGAGACA NM_016993
GAPDH GGCACAGTCAAGGCTGAGAATG ATGGTGGTGAAGACGCCAGTA NM_017008

No., number.

In addition, to verify the expression changes at the protein level and perform tissue immunofluorescence localization analysis, highly specific monoclonal or polyclonal antibodies were selected. The main primary antibodies used in Western Blot and immunofluorescence experiments include anti-Caspase-3, anti-Bax, anti-Bcl-2, anti-Sirt1 and anti-Nrf2. All primary antibodies and corresponding horseradish peroxidase-labeled or fluorescent-labeled secondary antibodies are diluted (14). The specific antibody sources, product numbers, and dilution ratios used in the study are presented in Table 2.

Table 2. Detailed information of antibodies used in WB and IF assays.

Antibody Host species Dilution Manufacturer Catalog No.
WB IF
Caspase-3 Rabbit 1:1,000 1:200 Cell Signaling Tech #9662
Cleaved caspase-3 Rabbit 1:1,000 1:400 Cell Signaling Tech #9661
Bax Mouse 1:2,000 1:100 Abcam ab32503
Bcl-2 Rabbit 1:1,000 1:100 Abcam ab196495
Sirt1 Rabbit 1:1,000 1:200 Abcam ab189494
Nrf2 Rabbit 1:1,000 1:100 Proteintech 16396-1-AP
HO-1 Mouse 1:2,000 Proteintech 66743-1-Ig
β-actin Mouse 1:5,000 Sigma-Aldrich A5441
Anti-rabbit IgG Goat 1:5,000 1:500 Abcam ab6721
Anti-mouse IgG Goat 1:5,000 1:500 Abcam ab6789

Bax, Bcl-2 associated X protein; Bcl-2, B-cell lymphoma-2; HO-1, heme oxygenase-1; IF, immunofluorescence; IgG, immunoglobulin G; No., number; Nrf2, nuclear factor erythroid 2-related factor 2; Sirt1, silent information regulator 1; WB, Western blot.

In vitro cell experiment design

H9c2 rat cardiomyocytes were routinely cultured in DMEM high-glucose medium containing 10% fetal bovine serum and 1% penicillin-streptomycin double antibody, and incubated in a constant temperature incubator at 37 ℃ and 5% CO2. Cells in the logarithmic growth phase were harvested for subsequent experiments. To construct an in vitro DOX cardiotoxicity model and screen the optimal protective concentration of AS-IV, the study first used the CCK-8 method to measure cell viability (15). H9c2 cells were seeded in a 96-well plate at a density of 5×103/well. After the cells adhered, a series of DOX concentration gradients (0, 0.01, 0.1, 0.5, 1.0, 2.0, and 4.0 µg/mL) were first set to treat the cells for 48 hours to determine the optimal modeling concentration that caused significant cell damage but was non-lethal (16). Subsequently, based on the fixed DOX concentration, different gradients of AS-IV (0.3, 0.6, 0.9, 1.2, and 1.5 µg/mL) were simultaneously added for co-incubation screening to establish the optimal drug intervention dose. The study established the final in vitro experimental grouping scheme and dosing strategy. The cells were divided into a control group (CG), DOX, DOX + AS-IV and a drug safety evaluation group (AS-IV alone). The specific dosing concentration and treatment time are shown in Table 3.

Table 3. Experimental grouping and drug treatment protocol in H9c2 cardiomyocytes.

Group Pre-treatment Co-treatment (drug & dosage) Duration Description
Control DMEM PBS (vehicle) 24 h/48 h Negative control to establish baseline viability and oxidative levels
DOX DMEM DOX (0.5 μg/mL) 24 h/48 h Model group to induce cardiotoxicity and oxidative stress
DOX + AS-IV DMEM DOX (0.5 μg/mL) + AS-IV (1.2 μg/mL) 24 h/48 h Intervention group to evaluate the cardioprotective effects of AS-IV
AS-IV alone DMEM AS-IV (1.2 μg/mL) 24 h/48 h Safety evaluation group to exclude potential cytotoxicity of the drug itself

AS-IV, astragaloside IV; DMEM, Dulbecco’s Modified Eagle Medium; DOX, doxorubicin; PBS, phosphate buffered saline.

After cells in each group were treated with the drugs, indicators related to oxidative stress and mitochondrial function were immediately measured. To evaluate the intracellular redox status, the cell-permeable probe DCFH-DA was used to measure ROS levels. Twenty-four hours post-treatment, the culture medium was aspirated, and the DCFH-DA (10 µM) diluted in serum-free medium was added, incubated at 37 ℃ in the dark for 20 minutes. Subsequently, the cells were washed three times with phosphate buffered saline (PBS). Laser confocal microscope (LSM 800, Zeiss, Germany) was used to observe and capture images at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The green fluorescence intensity reflects the degree of accumulation of ROS in cells (17,18). The cell lysates of each group were collected. After protein quantification using the BCA method, the intracellular SOD and GSH and the MDA were measured strictly using a microplate reader to comprehensively evaluate the regulatory effect of AS-IV on DOX-induced oxidative imbalance (19,20). In addition, to verify cell apoptosis, caspase-3 immunofluorescence staining was used. After the cells were fixed and membrane-broken, they were incubated with caspase-3 at 4 ℃ overnight. The next day, fluorescent secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI) were added to counterstain the cell nucleus. The nuclear translocation and expression abundance of caspase-3 were observed under a fluorescence microscope (21).

In vivo animal experimental design

In the in vivo research stage, to simulate the clinical scenario of childhood tumor chemotherapy, 3-week-old juvenile animals in the rapid development period after weaning were selected as research subjects. After adaptive feeding for 3 days to eliminate environmental stress, all experimental animals were randomly divided into three groups based on weight stratification, namely the CG, DOX and DOX + AS-IV. Each group contained 15 animals to ensure statistical power. The dosage regimen was set based on preliminary experiments and previous pharmacokinetic studies. The animals in the DOX received a single tail vein injection of DOX at 3 mg/kg, which is sufficient to induce acute cardiotoxicity in young animals without causing death. The treatment group was injected with the same dose of DOX. Meanwhile, 5 mg/kg of AS-IV was given for intervention. The CG was injected with the PBS to eliminate the influence of the injection operation (22). The specific experimental grouping information, administration route and dosage regimen are detailed in Table 4.

Table 4. Animal grouping, dosage regimen, and administration routes for in vivo experiments.

Group Sample size (n) Treatment Dosage Route of administration Duration
Control 15 PBS vehicle Equivalent volume Intravenous (i.v.) Single dose
DOX 15 DOX 3 mg/kg Intravenous (i.v.) Single dose
DOX + AS-IV 15 DOX + AS-IV DOX: 3 mg/kg; AS-IV: 5 mg/kg Intravenous (i.v.) Co-administration

AS-IV, astragaloside IV; DOX, doxorubicin; i.v., intravenous; PBS, phosphate buffered saline.

After administration, the experiment entered a 3-day close observation period. During this period, animals in each group were weighed at a fixed time point every day (09:00 AM), and their food intake and mental status were recorded to dynamically evaluate the acute effects of the drugs on the growth and development of young animals. The endpoint of the experiment was set on the third day after administration, which coincides with the pathological peak period of DOX-induced acute cardiotoxicity. After all animals were anesthetized by isoflurane inhalation, blood samples were collected via the retro-orbital sinus. The serum was separated by centrifugation to detect the levels of the myocardial damage marker CK-MB (23). The animals were killed immediately, the myocardial tissue was quickly removed, washed with pre-cooled PBS to delete residual blood, and then sampled: some of the myocardial tissue was fixed in 4% paraformaldehyde for subsequent hematoxylin-eosin (H&E) staining and caspase-3 immunofluorescence analysis to observe the pathological morphology and cell apoptosis of the myocardial tissue. Another part of the fresh myocardial tissue was accurately weighed, added with normal saline to prepare a 10% tissue homogenate, centrifuged to take the supernatant, and strictly follow the instructions of the kit to measure the SOD, MDA and GSH in the myocardial tissue to evaluate the oxidative stress damage from the tissue level (24). All animals were included in the final analysis. Investigators performing echocardiography and histological assessments were blinded to the group allocation. To quantify the extent of myocardial damage, a semi-quantitative histopathological scoring system was applied to the H&E-stained sections. The severity of tissue lesions, including myofibrillar disarray, cytoplasmic vacuolization, interstitial edema, and inflammatory cell infiltration, was blindly graded on a scale from 0 to 3 (0 representing no damage, 1 for mild, 2 for moderate, and 3 for severe damage).

Statistical analysis

Data are analyzed using GraphPad Prism 9.0 software (GraphPad Software, USA). The normality of the data is assessed using the Shapiro-Wilk test. Differences between groups are determined by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. All data are presented as mean ± standard deviation (SD). A P<0.05 was considered statistically significant.

Results

AS-IV attenuates DOX-induced cardiomyocyte injury

Safe dose screening and protective effect of AS-IV on H9c2 cells

To rule out the possible toxic side effects of AS-IV itself on cardiomyocytes and ensure that the protective effects observed in subsequent experiments are not due to the drug’s cell proliferation-promoting effect, the study first examined changes in cell viability in normal H9c2 cardiomyocytes after treatment with different concentrations of AS-IV (0.3, 0.6, 0.9, 1.2, and 1.5 µg/mL) for 48 hours. Table 5 shows the specific data.

Table 5. Effects of different concentrations of AS-IV on the viability of H9c2 cardiomyocytes (n=6).
AS-IV concentration (μg/mL) Cell viability (% of control) P (vs. 0 μg/mL)
0.0 (control) 100.00±2.15
0.3 99.42±3.08 0.88
0.6 101.20±2.85 0.76
0.9 98.75±3.50 0.65
1.2 100.56±2.94 0.82
1.5 99.18±3.22 0.79

Data are presented as mean ± standard deviation. AS-IV, astragaloside IV.

The CCK-8 test results showed that the cell viability of each experimental concentration group was maintained between 98% and 102%, without obvious differences (P=0.82), indicating that AS-IV had no obvious cytotoxicity to H9c2 cells within this concentration range and had good safety. Subsequently, to establish a stable DOX myocardial injury in vitro model, the cytotoxicity of different concentrations of DOX (0.01–4.0 µg/mL) after 48 hours of action were tested, as shown in Figure 1.

Figure 1.

Figure 1

Effects of DOX and AS-IV on H9c2 cell viability detected by CCK-8 assay. (A) Cell viability of H9c2 cells exposed to increasing concentrations of DOX (0.01–4.0 μg/mL) for 48 h. Data are written as mean ± standard deviation (n=6). (B) Protective effect of AS-IV (0.3–1.5 μg/mL) on H9c2 cells treated with 0.5 μg/mL DOX for 48 h. The optimal protective concentration was observed at 1.2 μg/mL. AS-IV, astragaloside IV; CCK-8, Cell Counting Kit-8; DOX, doxorubicin.

From Figure 1A, DOX controlled the growth of H9c2. As the concentration increased, the cell survival rate significantly declined. When the DOX was 0.5 µg/mL, the cell survival rate dropped to 56.20%±3.80%, close to the half-lethal concentration (IC50). This concentration can not only cause significant cell damage to simulate clinical cardiotoxicity, but also retain an appropriate amount of viable cells for subsequent research on the protective mechanism. Therefore, it was selected as the modeling concentration for subsequent experiments. The protective effect of different concentrations of AS-IV on cell damage induced by 0.5 µg/mL DOX was further evaluated. As shown in Figure 1B, compared with the DOX group, AS-IV intervention significantly increased cell viability, and showed a certain dose-dependent trend. When the concentration of AS-IV reached 1.2 µg/mL, the cell survival rate returned to 68.5%±5.3%, and the protective effect was the most significant (P=0.003). However, when the concentration was further increased to 1.5 µg/mL, the protective effect was not significantly improved (69.3%±4.8%). Taking into account the efficacy and economy, 1.2 µg/mL was finally determined as the optimal in vitro protective concentration of AS-IV.

AS-IV improves DOX-induced cellular oxidative stress

Among the mechanisms of DOX-induced cardiotoxicity, oxidative stress is considered to be the core driving factor. During the intracellular metabolism of DOX, a single-electron reduction reaction occurs, producing semiquinone free radicals, which in turn generate ROS and deplete the endogenous antioxidant defense system. To explore whether AS-IV exerts a protective effect by reshaping cellular redox homeostasis, the study first detected the levels of key antioxidant enzymes and oxidation products in H9c2 cardiomyocytes, as shown in Figure 2.

Figure 2.

Figure 2

Effect of AS-IV on oxidative stress markers in DOX-treated H9c2 cells. H9c2 cells were treated with DOX (0.5 μg/mL) alone or co-treated with AS-IV (1.2 μg/mL) for 24 h. Intracellular levels of (A) SOD, (B) GSH, and (C) MDA. Data are presented as mean ± standard deviation (n=3). *, P<0.05; **, P<0.01; ***, P<0.001 vs. control group. AS-IV, astragaloside IV; DOX, doxorubicin; GSH, glutathione; MDA, malondialdehyde; PBS, phosphate buffered saline; SOD, superoxide dismutase.

From Figure 2A, the intracellular SOD activity in the DOX (0.5 µg/mL) significantly decreased from 11.4±0.94 to 5.1±0.40 U/mgprot. As shown in Figure 2B, the GSH content decreased from 7.6±0.35 to 4.7±0.45 µmol/gprot. The lipid peroxidation end product MDA increased sharply, as shown in Figure 2C, reaching nearly 3 times that of the CG. However, after intervention with 1.2 µg/mL AS-IV, the above pathological changes were significantly reversed: the SOD activity rebounded to 8.7±0.63 U/mgprot, the GSH reserves recovered to 6.4±0.39 µmol/gprot, and the accumulation of MDA was effectively inhibited to 7.26±0.63 nmol/mgprot (P=0.004 vs. DOX group). To quantify this observation, the study conducted mean fluorescence intensity (MFI) analysis on laser confocal images. The specific numerical statistics are shown in Table 6.

Table 6. Quantitative analysis of intracellular ROS fluorescence intensity in H9c2 cells.
Group MFI (arbitrary units) Relative ROS level
(% of control)
Control 340±25 100.0±7.4
DOX 1,631±86 479.7±25.3
DOX + AS-IV 1,134±69 333.5±20.3

AS-IV, astragaloside IV; DOX, doxorubicin; MFI, mean fluorescence intensity; ROS, reactive oxygen species.

The quantitative data in Table 6 showed that the ROS fluorescence intensity in the DOX was 4.8 times that of the CG (1,631±86 vs. 340±25), while the MFI in the DOX + AS-IV group was significantly reduced to 1,134±69 (P=0.002). This is highly fitted with the detection results of biochemical indicators, and strongly proves that AS-IV can effectively clear excess ROS induced by DOX and reduce oxidative damage to cardiomyocytes. AS-IV inhibits DOX-induced ROS accumulation in H9c2 cardiomyocytes as presented in Figure 3.

Figure 3.

Figure 3

AS-IV inhibits DOX-induced ROS accumulation in H9c2 cardiomyocytes. (A) Representative fluorescence images of intracellular ROS levels detected by DCFH-DA staining. H9c2 cells were treated with DOX (0.5 μg/mL) alone or co-treated with AS-IV (1.2 μg/mL) for 24 h. Green fluorescence indicates the presence of ROS, and nuclei were stained with DAPI (blue). Scale bar =20 μm. (B) The MFI of ROS in each group. Data are presented as mean ± standard deviation (n=3). *, P<0.05 vs. CG. AS-IV, astragaloside IV; CG, control group; DAPI, 4',6-diamidino-2-phenylindole; DCFH-DA, dichlorodihydrofluorescein diacetate; DOX, doxorubicin; MFI, mean fluorescence intensity; PBS, phosphate buffered saline; ROS, reactive oxygen species.

From Figure 3A, the cells in the PBS only demonstrated poor green background fluorescence, indicating that the basal ROS level was low. In contrast, the cytoplasm of cells in the DOX group was filled with high-intensity bright green fluorescence and was widely distributed, indicating that DOX induced the explosive generation of intracellular ROS. After adding AS-IV (1.2 µg/mL) for co-incubation, the green fluorescence intensity was significantly weakened compared with the DOX. The fluorescence distribution range was narrowed, indicating that AS-IV effectively inhibited the accumulation of ROS. As shown in the quantitative analysis of Figure 3B, consistent with the microscopic observation results, the MFI of the DOX group was significantly increased, reaching 4.8 times that of the CG (1,631±86 vs. 340±25, P<0.001). After AS-IV intervention, the fluorescence intensity dropped significantly to 1,134±69 (P=0.002 vs. DOX group).

AS-IV exerts cytoprotective effects by regulating gene expression

In view of the previous experiments confirming that AS-IV can significantly alleviate oxidative stress and inhibit cell damage, to further elucidate its potential mechanism at the molecular level, the RT-qPCR was applied to detect the mRNA of key genes closely related to antioxidant defense and apoptosis in H9c2 cardiomyocytes. Sirt1, as a NAD+-dependent deacetylase, is considered to be a key upstream regulator of mitochondrial function and resistance to oxidative stress, while Nrf2 is the most important endogenous antioxidant signaling pathway transcription factor in cells, as shown in Table 7.

Table 7. Relative mRNA of oxidative stress and apoptosis-related genes in H9c2 cells (n=3).
Gene symbol Control group DOX group (0.5 μg/mL) DOX + AS-IV group (1.2 μg/mL) P value (DOX vs. DOX + AS-IV)
Sirt1 1.00±0.00 0.38±0.05 0.79±0.08 0.004
Nrf2 1.00±0.00 0.45±0.06 0.82±0.07 0.003
HO-1 1.00±0.00 0.32±0.04 0.75±0.05 0.005
Bax 1.00±0.00 3.52±0.24 1.65±0.18 0.002
Bcl-2 1.00±0.00 0.28±0.04 0.71±0.06 0.003
Bax/Bcl-2 ratio 1 12.57 2.32

Data are presented as mean ± standard deviation. , P<0.05 vs. DOX group. AS-IV, astragaloside IV; DOX, doxorubicin; mRNA, messenger RNA.

From Table 7, compared with the normal CG, DOX treatment inhibited the transcriptional activity of the antioxidant signaling pathway in cardiomyocytes, causing the Sirt1 mRNA to decrease to 0.38±0.05. The transcription levels of the downstream factor Nrf2 and its target gene HO-1 also decreased to 45% and 32% of the CG (P=0.005). This explains the molecular basis of the lack of antioxidant enzyme activity (SOD and GSH) in the cells of the DOX group. However, after intervention with 1.2 µg/mL AS-IV, the expression of the above genes was positively regulated. In the DOX + AS-IV, the level of Sirt1 mRNA rose back to 0.79±0.08, accompanied by a significant recovery of Nrf2 and HO-1 expression, suggesting that AS-IV may activate the cell’s endogenous antioxidant defense mechanism by activating the Sirt1/Nrf2 signaling axis. The study also examined the transcriptional changes of the key genes of the mitochondrial apoptosis pathway, Bax (pro-apoptotic) and Bcl-2 (anti-apoptotic). DOX caused a sharp increase in the Bax mRNA (3.52±0.24), while the Bcl-2 mRNA was reduced (0.28±0.04), causing a serious imbalance in the Bax/Bcl-2 ratio, thereby driving cells toward apoptosis. Notably, the AS-IV effectively reversed this situation, not only downregulating the transcription of Bax but also restoring the level of Bcl-2 to near normal levels (0.71±0.06).

In vitro drug release

AS-IV improves the general condition, growth and development of young mice

During the observation period after administration, the young mice in each group showed obvious differences in physiological status. The mice in the CG were in good mental state, had glossy coats, were responsive, and had a normal diet and drinking water. However, the mice in the DOX group showed typical poisoning symptoms such as listlessness, arched backs, dull coat color, and reduced activity 24 hours after administration. Some animals were accompanied by diarrhea and a significant decrease in food intake. In contrast, the above-mentioned symptoms of mice treated with AS-IV combination were significantly reduced, their mental state was close to normal levels, and no obvious behavioral abnormalities were observed, as shown in Figure 4.

Figure 4.

Figure 4

Effect of AS-IV on body weight changes and myocardial injury markers in DOX-treated juvenile mice. (A) Time-course of body weight changes in mice from Day 0 to Day 3. DOX treatment caused significant growth retardation, which was attenuated by AS-IV. (B) Quantitative analysis of serum CK-MB levels in each group. **, P<0.01 vs. control group. AS-IV, astragaloside IV; CK-MB, creatine kinase-muscle/brain; DOX, doxorubicin; PBS, phosphate buffered saline.

In Figure 4A, the weight of the young mice in the CG showed a steady growth trend, which was consistent with the normal development characteristics of 3-week-old mice. However, the growth of mice in the DOX group was severely inhibited, and their weight growth almost stagnated after administration, and even showed negative growth on the third day. AS-IV intervention significantly alleviated this growth retardation. The weight curve in the treatment group was above that of the DOX group, exhibiting a sustained upward trend. To quantify this protective effect more accurately, the specific weight values at each time point and the final weight growth rate are summarized in Table 8.

Table 8. BW changes and general growth parameters of juvenile mice in each group (n=15).
Group Initial BW (Day 0), g Final BW (Day 3), g Weight gain (%) Daily food intake (g/mouse)
Control 13.20±0.85 16.42±0.98 24.4±3.5 3.5±0.4
DOX 13.15±0.92 12.85±1.12 −2.3±4.1 1.8±0.3
DOX + AS-IV 13.30±0.78 15.10±0.85 13.5±2.8 2.9±0.3

Data are presented as mean ± standard deviation. , P<0.05 vs. DOX group. AS-IV, astragaloside IV; BW, body weight; DOX, doxorubicin.

In Table 8, the average body weight (day 3) in the DOX group was only 12.85±1.12g, which was significantly lower than that in the CG (16.42±0.98 g, P<0.001). In contrast, the DOX + AS-IV recovered to 15.10±0.85 g. Furthermore, the weight gain increased from −2.3% in the DOX group to 13.5%, indicating that AS-IV effectively counteracted DOX-induced systemic depletion and growth inhibition. In addition, changes in organ index further reflect the toxic effects of the drugs on major organs. DOX-induced cardiotoxicity is often manifested as myocardial atrophy or abnormal heart weight due to congestion, and metabolic organs such as liver and kidney may also be affected. The organ index of young mice is presented in Table 9.

Table 9. Organ indices (organ weight/BW ratios) of juvenile mice (n=15).
Group Cardiac index (mg/g) Liver index (mg/g) Kidney index (mg/g) Spleen index (mg/g)
Control 5.25±0.42 45.3±3.2 12.5±1.1 3.8±0.5
DOX 4.12±0.35 38.5±4.5* 11.8±1.4 2.1±0.4
DOX + AS-IV 4.98±0.38 43.8±3.6 12.2±1.0 3.2±0.6

Data are presented as mean ± standard deviation. *, P<0.05 vs. control group. , P<0.05 vs. DOX group. AS-IV, astragaloside IV; BW, body weight; DOX, doxorubicin.

From Table 9, the cardiac index of mice in the DOX was lower than that of the CG, suggesting that young hearts may have experienced rapid atrophy or developmental arrest during the acute injury period. After AS-IV treatment, the cardiac index returned to 4.98±0.38 mg/g, which was close to the normal level. There were no abnormal fluctuations in the liver and kidney indexes of the AS-IV group, further confirming that while the drug protects the heart, it has no obvious side effects on other organs of young animals and has good potential for pediatric drug safety.

AS-IV improves heart pumping function and myocardial enzyme profile

The main clinical manifestations of cardiotoxicity caused by DOX are decreased left ventricular systolic function and ventricular remodeling. To assess the protective effect of AS-IV on the heart pumping function, the study used a high-resolution small animal ultrasound imaging system to conduct non-invasive testing on mice in each group on the third day after administration. M-mode echocardiography analysis results showed that mice in the CG had strong ventricular wall movement and regular contraction rhythm. Mice in the DOX group showed obvious left ventricular dilation and weakened ventricular wall movement, indicating impaired systolic function. Quantitative analysis parameters are shown in Table 10.

Table 10. Echocardiographic parameters of cardiac function in juvenile mice (n=6).
Group LVEF (%) LVFS (%) LVIDd (mm) LVIDs (mm) HR (bpm)
Control 76.5±4.2 42.8±3.5 3.25±0.21 1.86±0.18 485±25
DOX 48.2±5.1 24.5±3.2 3.82±0.28* 2.89±0.25 410±32*
DOX + AS-IV 65.4±4.8 36.2±3.9 3.41±0.24 2.18±0.20 462±28

Data are presented as mean ± standard deviation. *, P<0.05 vs. control group. , P<0.05 vs. DOX group. AS-IV, astragaloside IV; DOX, doxorubicin; HR, heart rate; LVEF, left ventricular ejection fraction; LVFS, left ventricular fractional shortening; LVIDd, left ventricular internal diameter at end-diastole; LVIDs, left ventricular internal diameter at end-systole.

From Table 10, the left ventricular ejection fraction (LVEF) in the DOX group dropped significantly from 76.5%±4.2% to 48.2%±5.1%, and the left ventricular fractional shortening (LVFS) dropped from 42.8%±3.5% to 24.5%±3.2% (P<0.001), indicating that the heart’s pumping ability was significantly weakened. The left ventricular internal diameter at end-diastole (LVIDd) increased significantly at end-systole (P=0.006), reflecting the pathological expansion of the cardiac chamber. AS-IV intervention effectively improved the above-mentioned hemodynamic disorders. The LVEF and LVFS of mice in the DOX + AS-IV group rebounded to 65.4%±4.8% and 36.2%±3.9%, respectively, and the LVIDs were smaller than those in the DOX group, indicating that AS-IV can effectively maintain the contractile reserve function of young hearts and prevent the acute heart failure. In addition to imaging evidence, serum myocardial enzyme spectrum is a sensitive biochemical indicator that reflects the destruction of myocardial cell membrane integrity and cell necrosis.

AS-IV maintains myocardial tissue redox homeostasis

In vitro experiments have confirmed that AS-IV can effectively inhibit the ROS burst in cardiomyocytes. To further verify whether this protective effect also exists at the living tissue, the study examined oxidative stress-related biochemical indicators in the myocardial tissue of young mice in each group. Depleted antioxidant enzyme systems and accumulated lipid peroxidation products are typical pathological features of DOX cardiotoxicity. The changes in specific indicators are shown in Figure 5.

Figure 5.

Figure 5

Effect of AS-IV on oxidative stress markers. Levels of SOD, GSH, and MDA in myocardial tissue homogenates were measured 3 days after DOX administration. AS-IV treatment significantly restored antioxidant enzyme activities and reduced lipid peroxidation (A-C). *, P<0.05; **, P<0.01 vs. control group. AS-IV, astragaloside IV; DOX, doxorubicin; GSH, glutathione; MDA, malondialdehyde; PBS, phosphate buffered saline; SOD, superoxide dismutase.

From Figure 5, oxidative stress-related indicators in the myocardial tissue showed obvious inter-group differences. Compared with the PBS, the antioxidant enzyme defense system in the DOX was severely inhibited, which was intuitively reflected in the sharp decrease in the height of the histograms of SOD activity and GSH content. The MDA content, which represents the degree of lipid peroxidation, increased significantly, suggesting that DOX induced severe cardiac oxidative damage. After AS-IV treatment, the above pathological trends were significantly reversed. The SOD and GSH in the DOX + AS-IV exceeded those in the DOX, and the abnormal accumulation of MDA was effectively inhibited. AS-IV can keep the redox homeostasis of myocardial tissue. Biochemical analysis of oxidative stress parameters is presented in Table 11.

Table 11. Biochemical analysis of oxidative stress parameters (n=6).
Group SOD activity (U/mgprot) GSH content (μmol/gprot) MDA content (nmol/mgprot)
Control 51.6±6.4 13.2±1.10 6.47±0.39
DOX 22.7±3.7 5.3±0.63 10.50±0.83
DOX + AS-IV 38.4±2.1 9.6±0.83 8.85±0.72

Data are presented as mean ± standard deviation. , P<0.05 vs. DOX group. , P<0.05 vs. control group. AS-IV, astragaloside IV; DOX, doxorubicin; GSH, glutathione; MDA, malondialdehyde; SOD, superoxide dismutase.

From Table 11, the quantitative biochemical analysis results confirmed the destruction of myocardial antioxidant capacity by DOX and the protective effect of AS-IV. The cardiac SOD activity in the PBS remained at 51.6±6.4 U/mgprot, while in the DOX group, it dropped significantly to 22.7±3.7 U/mgprot. After AS-IV intervention, SOD activity significantly recovered to 38.4±2.1 U/mgprot. Similarly, the non-enzymatic antioxidant GSH content in the DOX group was only 5.3±0.63 µmol/gprot, less than half of the 13.2±1.10 µmol/gprot in the CG, while the AS-IV group significantly increased to 9.6±0.83 µmol/gprot. In terms of oxidative damage products, the MDA content in the myocardial tissue of the DOX group increased to 10.50±0.83 nmol/mgprot, which was much higher than the 6.47±0.39 nmol/mgprot of the CG, while the AS-IV group effectively reduced it to 8.85±0.72 nmol/mgprot. These data confirm that AS-IV has significant antioxidant effects at the tissue level.

AS-IV reduces myocardial pathological structural damage and cell apoptosis

Histopathological examination is the most intuitive gold standard for evaluating the cardiotoxicity and protective effect of drugs. To confirm the protective effect of AS-IV from a morphological level, the study used H&E staining to observe the microstructure of the myocardial tissue of young mice in each group, as shown in Figure 6.

Figure 6.

Figure 6

Histopathological examination and apoptosis detection in myocardial tissues of juvenile mice. (A) Representative H&E staining images of heart sections (scale bar =50 μm). DOX group showed disorganized myofibrils and cytoplasmic vacuolization, which were attenuated by AS-IV. (B) Immunofluorescence staining for caspase-3 (red) and nuclei (DAPI, blue) (scale bar =50 μm). Arrows indicate typical DOX-induced histopathological lesions including myofibrillar disarray and cytoplasmic vacuolization. AS-IV treatment reduced the quantity of caspase-3 positive apoptotic cells induced by DOX. AS-IV, astragaloside IV; DAPI, 4',6-diamidino-2-phenylindole; DOX, doxorubicin; H&E, hematoxylin-eosin; PBS, phosphate buffered saline.

From Figure 6A, the myocardial tissue structure in the PBS was clear, the myocardial fibers were neatly and tightly arranged, the cell nuclei had normal morphology and were located in the center of the cells, and there was no obvious inflammatory infiltration or breakage. In contrast, the DOX showed typical toxic pathological changes: myocardial fiber arrangement was disordered, extensive fragmentation, dissolution, and vacuolation degeneration occurred, intercellular spaces were significantly widened due to edema, and obvious inflammatory cell infiltration was visible. After AS-IV intervention, the above-mentioned pathological damage was significantly improved, the arrangement of myocardial fibers tended to be neat, the myofibril breakage and cell edema were significantly reduced, and the inflammatory infiltration foci were significantly reduced.

Quantitative histopathological scoring further confirmed these microscopic observations, revealing a significantly elevated myocardial damage score in the DOX group and a significant decrease after intervention with AS-IV.

Discussion

The core goal of this study is to explore the protective effect of AS-IV on the developing heart to address the long-term cardiovascular risks caused by DOX in childhood cancer treatment. As noted in the cohort study by Nathan et al. anthracycline-induced cardiotoxicity is a key driver of increased morbidity in long-term survivors, and cumulative dose is positively associated with risk (25). The review by Shackebaei et al. also further highlights that pediatric lymphoma survivors face evolving cardiovascular health challenges after treatment, making the search for low-toxic and highly effective cardioprotective adjuvant drugs a top priority in pediatric oncology (26). The study used young mouse models and confirmed that AS-IV can significantly improve DOX-induced decline in cardiac function (LVEF 65.4% vs. 48.2%). It not only protects the myocardial structure in the acute phase, but also provides experimental basis for reducing the risk of long-term cardiac events. Studies have found that AS-IV can effectively maintain the growth, development and cardiac reserve function of young animals, which is significant for enhancing the prognosis of children in adulthood. Based on a longitudinal analysis of the St Jude Lifetime Cohort, Hammoud et al. indicated that childhood cancer survivors have a significant burden of cardiovascular disease and that the risk of major adverse cardiovascular events increases significantly with age (27). Furthermore, in a review on cardio-oncology, Hammoud et al. noted that early intervention targeting modifiable cardiometabolic risk factors is key to improving the long-term health (28). The results show that AS-IV inhibits oxidative stress through the Sirt1/Nrf2 pathway, effectively blocking the “first hit” of DOX toxicity. This early pathophysiological correction may help break the vicious cycle of progression from acute injury to chronic heart failure, responding to the early risk control strategy proposed by the above-mentioned scholars.

In the prevention and treatment strategy, current clinical focus is mostly on monitoring and management after injury occurs. Leerink and Feijen explored pathways to secondary prevention of anthracycline cardiotoxicity, emphasizing the importance of identifying abnormalities in the subclinical stage, and also pointing to the limitations of existing approaches in reversing established damage (9). In contrast, the AS-IV combined administration regimen proposed in the study is a primary prevention strategy and aims to block the damage cascade from the source. The latest research by Wang and Zhang reveals the genetic and epigenetic basis underlying the long-term side effects of childhood cancer treatment, suggesting that cardioprotection may need to extend to the level of molecular regulation (29). Studies have found that AS-IV can up-regulate Sirt1 and activate the downstream Nrf2 antioxidant system (30). This is different from traditional antioxidants that simply scavenge ROS. AS-IV may provide a more durable and comprehensive protective effect by reshaping the epigenetic homeostasis or endogenous defense network of cardiomyocytes, making up for the shortcomings of a single monitoring strategy.

Although the current findings demonstrate a strong correlation between AS-IV administration and the Sirt1/Nrf2 pathway up-regulation, direct causal evidence remains limited. To definitively confirm that the cardioprotective efficacy is functionally dependent on this specific mechanism, further targeted interventions utilizing specific Sirt1 inhibitors (such as EX-527) or Nrf2 inhibitors are strictly required. Pharmacologically blocking this signaling axis in future experimental models would robustly elucidate whether the abrogation of oxidative stress and apoptosis by AS-IV is entirely mediated through Sirt1/Nrf2 activation.

Another notable limitation of the current research is the exclusive focus on the acute phase of pediatric cardiotoxicity, evaluated solely at three days post-administration. Because anthracycline-induced cardiac damage frequently progresses into delayed and chronic cardiomyopathy, these short-term findings cannot definitively confirm the sustained prevention of long-term cardiac remodeling and late-onset heart failure.

Moreover, the reliance on rat-derived H9c2 myoblast-like cells rather than fully differentiated primary cardiomyocytes presents an in vitro limitation, as these cells may not entirely replicate the complex functional and metabolic responses of mature heart tissue. The absence of specific pharmacological blockers to validate and prove the exact dependency on the Sirt1/Nrf2 signaling pathway remains a notable limitation of the current experimental design. Future investigations incorporating targeted pathway blockade are rigorously required to definitively confirm these mechanistic findings.

Conclusions

Aiming at the DOX cardiotoxicity in children’s chemotherapy, the study used 3-week-old young mice and H9c2 cell models to explore the protective effect of AS-IV. AS-IV could significantly protect against damage to young myocardium: At the cellular level, it increased Sirt1 mRNA expression from 0.38 to 0.79, corrected the Bax/Bcl-2 ratio (12.57 to 2.32), and significantly reduced ROS fluorescence intensity (1,631 to 1,134). At the tissue level, AS-IV restored myocardial index to near normal (increased from 4.12 to 4.98 mg/g), doubled SOD activity (increased from 22.7 to 38.4 U/mgprot), and significantly reduced pathological damage. The mechanism shows that AS-IV mainly inhibits oxidative stress and apoptosis by activating the Sirt1/Nrf2. The limitation of this study is the absence of long-term prognostic observations and the lack of direct mechanistic validation utilizing specific Sirt1 or Nrf2 pharmacological inhibitors to substantiate the pathway dependency.

Supplementary

The article’s supplementary files as

tcr-15-04-321-rc.pdf (422.7KB, pdf)
DOI: 10.21037/tcr-2026-1-0080
tcr-15-04-321-coif.pdf (274.7KB, pdf)
DOI: 10.21037/tcr-2026-1-0080

Acknowledgments

None.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were performed under a project license (No. DWLL202307004) granted by Ethics Committee of Hebei University of Chinese Medicine, in compliance with Chinese national or institutional guidelines for the care and use of animals.

Footnotes

Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0080/rc

Funding: This work was supported by the Scientific Research Plan Project of Hebei Provincial Administration of Traditional Chinese Medicine (No. 2024101).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0080/coif). The authors have no conflicts of interest to declare.

Data Sharing Statement

Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0080/dss

tcr-15-04-321-dss.pdf (71.4KB, pdf)
DOI: 10.21037/tcr-2026-1-0080

References

  • 1.Zou X, Xiao H, Bai X, et al. Astragaloside IV drug-loaded exosomes (AS-IV EXOs) derived from endothelial progenitor cells improve the viability and tube formation in high-glucose impaired human endothelial cells by promoting miR-214 expression. Endokrynol Pol 2022;73:336-45. 10.5603/EP.a2022.0011 [DOI] [PubMed] [Google Scholar]
  • 2.Wen LP, Gao SW, Chen HX, et al. Astragaloside IV Ameliorates Colonic Adenomatous Polyps Development by Orchestrating Gut Bifidobacterium and Serum Metabolome. Am J Chin Med 2024;52:1527-54. 10.1142/S0192415X24500605 [DOI] [PubMed] [Google Scholar]
  • 3.Li N, Mu YP, Liu CY, et al. Effect of astragaloside IV on the expression of NOD-like receptor protein 3 inflammasome in neonatal rats with hypoxic-ischemic brain damage. Zhongguo Dang Dai Er Ke Za Zhi 2021;23:402-9. 10.7499/j.issn.1008-8830.2010053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Liu X, Wang S, Wu X, et al. Astragaloside IV Alleviates Depression in Rats by Modulating Intestinal Microbiota, T-Immune Balance, and Metabolome. J Agric Food Chem 2024;72:259-73. 10.1021/acs.jafc.3c04063 [DOI] [PubMed] [Google Scholar]
  • 5.Xiong W, Huang XL, Li CY, et al. Astragaloside IV - mediated endothelial progenitor cell exosomes promote autophagy and inhibit apoptosis in hyperglycemic damaged endothelial cells via miR-21/PTEN axis. Folia Histochem Cytobiol 2022;60:323-34. 10.5603/FHC.a2022.0030 [DOI] [PubMed] [Google Scholar]
  • 6.Ehrhardt MJ, Leerink JM, Mulder RL, et al. Systematic review and updated recommendations for cardiomyopathy surveillance for survivors of childhood, adolescent, and young adult cancer from the International Late Effects of Childhood Cancer Guideline Harmonization Group. Lancet Oncol 2023;24:e108-20. 10.1016/S1470-2045(23)00012-8 [DOI] [PubMed] [Google Scholar]
  • 7.de Baat EC, van Dalen EC, Mulder RL, et al. Primary cardioprotection with dexrazoxane in patients with childhood cancer who are expected to receive anthracyclines: recommendations from the International Late Effects of Childhood Cancer Guideline Harmonization Group. Lancet Child Adolesc Health 2022;6:885-94. 10.1016/S2352-4642(22)00239-5 [DOI] [PubMed] [Google Scholar]
  • 8.Chow EJ, Aggarwal S, Doody DR, et al. Dexrazoxane and Long-Term Heart Function in Survivors of Childhood Cancer. J Clin Oncol 2023;41:2248-57. 10.1200/JCO.22.02423 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Leerink JM, Feijen EAM. Secondary prevention of anthracycline cardiotoxicity in childhood cancer survivors. Lancet Oncol 2024;25:154-6. 10.1016/S1470-2045(24)00001-9 [DOI] [PubMed] [Google Scholar]
  • 10.Tian W, Zhang P, Yang L, et al. Astragaloside IV Alleviates Doxorubicin-Induced Cardiotoxicity by Inhibiting Cardiomyocyte Pyroptosis through the SIRT1/NLRP3 Pathway. Am J Chin Med 2024;52:453-69. 10.1142/S0192415X24500198 [DOI] [PubMed] [Google Scholar]
  • 11.Luo LF, Guan P, Qin LY, et al. Astragaloside IV inhibits adriamycin-induced cardiac ferroptosis by enhancing Nrf2 signaling. Mol Cell Biochem 2021;476:2603-11. 10.1007/s11010-021-04112-6 [DOI] [PubMed] [Google Scholar]
  • 12.Kalkan KK, Kekeçoğlu M. Ethical principles and rules in experimental animal studies: a comprehensive review. Duzce Med J 2024;26:1-13. [Google Scholar]
  • 13.Yu X, Han Z, Guo L, et al. The novel combination of astragaloside IV and formononetin protects from doxorubicin-induced cardiomyopathy by enhancing fatty acid metabolism. Chin J Nat Med 2025;23:1171-82. 10.1016/S1875-5364(25)60868-5 [DOI] [PubMed] [Google Scholar]
  • 14.Sevgi S, Cavusoglu Nalbantoglu I, Kerimoglu G, et al. Astragalus membranaceus Fisch. ex Bunge-derived astragaloside IV recovers bilateral cavernous nerve injury-induced erectile dysfunction and corporal fibrosis by inhibiting the TGF-β1/Smad2 pathway in rats. J Ethnopharmacol 2026;355:120640. [DOI] [PubMed] [Google Scholar]
  • 15.Bottinor W, Chow EJ. Mitigating, monitoring, and managing long-term chemotherapy- and radiation-induced cardiac toxicity. Hematology Am Soc Hematol Educ Program 2022;2022:251-8. 10.1182/hematology.2022000342 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liang PL, Chen XL, Gong MJ, et al. Guang Chen Pi (the pericarp of Citrus reticulata Blanco's cultivars 'Chachi') inhibits macrophage-derived foam cell formation. J Ethnopharmacol 2022;293:115328. 10.1016/j.jep.2022.115328 [DOI] [PubMed] [Google Scholar]
  • 17.Kan LL, Chan BC, Yue GG, et al. Immunoregulatory and Anti-cancer Activities of Combination Treatment of Novel Four-Herb Formula and Doxorubicin in 4T1-Breast Cancer Bearing Mice. Chin J Integr Med 2024;30:311-21. 10.1007/s11655-023-3745-6 [DOI] [PubMed] [Google Scholar]
  • 18.Zhang C, Shi D, Yang P. Sirtuin-3 Regulates the Mechanism of Doxorubicin-induced Cardiotoxicity. Int Heart J 2025;66:527-39. 10.1536/ihj.24-546 [DOI] [PubMed] [Google Scholar]
  • 19.Temtanakitpaisan Y, Saengnipanthkul S. Monitoring of Metabolic Syndrome and Cardiovascular Disease in Childhood Cancer Survivors. J Adolesc Young Adult Oncol 2022;11:17-26. 10.1089/jayao.2021.0001 [DOI] [PubMed] [Google Scholar]
  • 20.Mulrooney DA. Challenges Predicting the Cardiovascular Future for Survivors of Childhood Cancer. Cancer Epidemiol Biomarkers Prev 2022;31:515-7. 10.1158/1055-9965.EPI-21-1329 [DOI] [PubMed] [Google Scholar]
  • 21.Tonorezos ES, Cohn RJ, Glaser AW, et al. Long-term care for people treated for cancer during childhood and adolescence. Lancet 2022;399:1561-72. 10.1016/S0140-6736(22)00460-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.George IA, Souder B, Berkman A, et al. Obesity Predisposes Anthracycline-Treated Survivors of Childhood and Adolescent Cancers to Subclinical Cardiac Dysfunction. Pediatr Cardiol 2025;46:362-71. 10.1007/s00246-024-03423-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Teixeira N. The evolution of sustainable investment: The role of decentralized finance and green bonds in the efficiency and transparency of green finance. FinTech Sustain Innovat 2025;1:A1. [Google Scholar]
  • 24.Waqas M, Naseem A. Artificial intelligence in sustainable industrial transformation: A comparative study of industry 4.0 and industry 5.0. FinTech Sustain Innovat 2025;1:A2. [Google Scholar]
  • 25.Nathan P, Kulkarni K, MacDonald T. Incidence and risk factors of anthracycline-induced cardiotoxicity in long-term survivors of pediatric cancer: A population based cohort study. Pediat Hematol Oncol J 2022;7:136-41. [Google Scholar]
  • 26.Shackebaei D, Yari K, Rahimi N, et al. Targeting the NLRP3 by Natural Compounds: Therapeutic Strategies to Mitigate Doxorubicin-Induced Cardiotoxicity. Cell Biochem Biophys 2025;83:2779-91. 10.1007/s12013-025-01723-4 [DOI] [PubMed] [Google Scholar]
  • 27.Hammoud RA, Liu Q, Dixon SB, et al. The burden of cardiovascular disease and risk for subsequent major adverse cardiovascular events in survivors of childhood cancer: a prospective, longitudinal analysis from the St Jude Lifetime Cohort Study. Lancet Oncol 2024;25:811-22. 10.1016/S1470-2045(24)00157-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hammoud RA, Mulrooney DA, Rhea IB, et al. Modifiable Cardiometabolic Risk Factors in Survivors of Childhood Cancer: JACC: CardioOncology State-of-the-Art Review. JACC CardioOncol 2024;6:16-32. 10.1016/j.jaccao.2023.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wang Z, Zhang J. Genetic and epigenetic bases of long-term adverse effects of childhood cancer therapy. Nat Rev Cancer 2025;25:129-44. 10.1038/s41568-024-00768-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu D, Wang C, Chen Y, et al. Protein Kinase C Epsilon Overexpression Protects the Heart Against Doxorubicin-Induced Cardiotoxicity Via Activating SIRT1. Cardiovasc Toxicol 2025;25:915-28. 10.1007/s12012-025-09995-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    The article’s supplementary files as

    tcr-15-04-321-rc.pdf (422.7KB, pdf)
    DOI: 10.21037/tcr-2026-1-0080
    tcr-15-04-321-coif.pdf (274.7KB, pdf)
    DOI: 10.21037/tcr-2026-1-0080

    Data Availability Statement

    Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0080/dss

    tcr-15-04-321-dss.pdf (71.4KB, pdf)
    DOI: 10.21037/tcr-2026-1-0080

    Articles from Translational Cancer Research are provided here courtesy of AME Publications

    RESOURCES