Skip to main content
Translational Cancer Research logoLink to Translational Cancer Research
. 2026 Apr 28;15(4):242. doi: 10.21037/tcr-2025-aw-2290

Molecular mechanism of miR-27a-3p targeting FBXW7 regulating the malignant behavior of osteosarcoma cells

Huaibin Zhang 1,#, Rongxuan Liu 2,3,#, Xiaorong Liu 4, Wenqiang Liang 1, Wenji Wang 1,, Yongping Wang 3,
PMCID: PMC13190890  PMID: 42180983

Abstract

Background

Osteosarcoma is a malignant bone tumor with high incidence in children and adolescents, and its prognosis is generally poor. Current comprehensive treatments are limited by tumor recurrence, lung metastasis, and chemoresistance, necessitating further elucidation of the underlying molecular mechanisms and the development of novel therapeutic targets. MicroRNAs (miRNAs) participate in the malignant biological behavior of tumors by post-transcriptionally regulating target genes. Previous studies have shown that miR-27a-3p is highly expressed in osteosarcoma, but its specific function and regulatory mechanism in osteosarcoma remain unclear. This study aims to investigate the effects of miR-27a-3p on the biological behavior of osteosarcoma cells and explore its mechanism of action.

Methods

The expression levels of miRNA and protein were detected by real-time polymerase chain reaction (RT-PCR) and Western blot. Bioinformatics methods were used to predict whether there were binding sites between miR-27a-3p and FBXW7 genes, and the interaction between miR-27a-3p and target gene FBXW7 was verified by dual luciferase reporter assay. miR-27a-3p mimics and inhibitors were used to overexpress and knock down the expression of miR-27a-3p, and the overexpressed plasmid of FBXW7 and siRNA-FBXW7 were used to overexpress and knock down the expression of FBXW7. Cell proliferation, migration and apoptosis were detected by Cell Counting Kit-8 (CCK-8) assay, Transwell migration assay and flow cytometry.

Results

miR-27a-3p was highly expressed in osteosarcoma cells, and overexpression of miR-27a-3p promoted the proliferation and migration of osteosarcoma cells, and inhibited cell apoptosis. miR-27a-3p knockdown inhibited the proliferation and migration of osteosarcoma cells and promoted cell apoptosis. miR-27a-3p can target the expression of FBXW7 and affect the proliferation, migration and apoptosis of osteosarcoma cells. Low expression of FBXW7 in osteosarcoma cells, overexpression of FBXW7 inhibited the proliferation and migration of osteosarcoma cells, and inhibition of the expression of FBXW7 promoted the proliferation and migration of osteosarcoma cells. The mechanism may be related to the Wnt/β-catenin signaling pathway.

Conclusions

The high expression of miR-27a-3p in osteosarcoma cells can negatively regulate FBXW7 to promote the proliferation and migration of osteosarcoma cells and inhibit cell apoptosis, suggesting a functional association between miR-27a-3p/FBXW7 axis and osteosarcoma cell malignant behavior.

Keywords: Osteosarcoma, microRNA (miRNA), miR-27a-3p, FBXW7, Wnt/β-catenin signaling pathway


Highlight box.

Key findings

• miR-27a-3p is highly expressed in osteosarcoma cells, overexpression of miR-27a-3p promotes proliferation and migration and inhibits apoptosis in osteosarcoma cells, while knockdown shows the opposite effects. FBXW7 is lowly expressed in osteosarcoma cells, overexpression of FBXW7 suppresses proliferation and migration of osteosarcoma cells, whereas knockdown exerts opposite effects. miR-27a-3p can target and regulate FBXW7 expression, thereby affecting proliferation, migration and apoptosis of osteosarcoma cells, and its mechanism may be related to the Wnt/β-catenin signaling pathway.

What is known and what is new?

• miR-27a-3p is dysregulated in various tumors and participates in tumor progression, but its specific function and regulatory mechanism in osteosarcoma remain unclear.

• This study reveals that miR-27a-3p is involved in regulating the biological behaviors of osteosarcoma cells by targeting FBXW7.

What is the implication, and what should change now?

• The miR-27a-3p/FBXW7 axis may serve as a potential diagnostic biomarker and therapeutic target for osteosarcoma, providing a novel strategy for overcoming osteosarcoma progression and metastasis in clinical practice.

Introduction

Osteosarcoma predominantly affects children and adolescents with accelerated bone growth, frequently occurring in the extremities of long bones. Originating from mesenchymal stem cells, this tumor exhibits strong invasiveness and distant metastasis potential, posing a severe threat to pediatric and adolescent health and survival (1-3). Its pathological features include uncontrolled tumor cell proliferation leading to immature bone/osteoid tissue formation, with early hematogenous spread both at onset and post-surgery (4,5). Clinical management relies on multimodal therapy, yet high malignancy, recurrence, metastasis and drug resistance result in suboptimal outcomes. Thus, exploring its underlying mechanisms and identifying effective therapeutic targets remains a critical research priority (1,6-8).

MicroRNA (miRNA) are evolutionarily conserved non-coding single-stranded ribonucleic acid (RNA) molecules, processed from 60–110 nucleotide precursors into 21–25 nucleotide mature sequences. They bind to the 3' untranslated regions of target messenger RNA (mRNA), inducing mRNA degradation or translational inhibition (2,9), and play key roles in regulating oncogene/tumor suppressor gene expression during cancer progression (10,11). miRNAs also target multiple cancer-related pathway components, making them potential novel diagnostic and therapeutic biomarkers (12-14). Located on chromosome 19, miR-27a-3p acts as an oncogenic miRNA in colorectal, gastric, esophageal, ovarian, oral squamous cell and cervical cancers, promoting aggressive tumor cell behaviors (14-17). It enhances radiosensitivity of esophageal squamous cell carcinoma by inducing G0/G1 cell cycle arrest (18), promotes ovarian cancer cell migration/invasion and anti-apoptosis (19), and regulates the Wnt/β-catenin pathway by targeting secreted frizzled-related protein 1 in oral squamous cell carcinoma (20). In cervical cancer, miR-27a-3p overexpression promotes cell proliferation, while its knockdown induces apoptosis (21). miR-27a-3p is also upregulated in osteosarcoma specimens (1,22,23), but its specific functions and mechanisms in osteosarcoma remain largely uncharacterized.

The ubiquitin-proteasome system modulates critical cellular processes including growth, differentiation and apoptosis (24). FBXW7, a member of the F-box protein family on chromosome 4q32, serves as the substrate recognition subunit of the SCF E3 ubiquitin ligase complex and is a key tumor suppressor frequently altered in human cancers (25,26). It mediates the degradation of oncoproteins (c-Myc, Mcl-1, mTOR, Jun, Notch, AURKA) to suppress tumorigenesis (27), and is frequently mutated in leukemia, colorectal, esophageal, gastric, liver, non-small cell lung and breast cancers (28,29). Beyond genetic mutations, miRNAs, long non-coding RNAs and oncogenic signaling pathways can impair FBXW7 function, highlighting its clinical and prognostic significance in tumor progression (1,30,31). However, the role and mechanism of FBXW7 in osteosarcoma are not fully elucidated.

Wnt proteins (350–400 amino acid cysteine-rich glycoproteins) activate multiple signaling cascades, including the β-catenin-mediated pathway (32). Wnt binding to Frizzled transmembrane receptors triggers intracellular protein phosphorylation, inhibiting β-catenin degradation and promoting its nuclear translocation to regulate gene expression via transcription factor binding (33,34). The Wnt/β-catenin pathway is critical for bone biology (stem cell renewal, osteoblast differentiation, bone mineralization) (35-37), and its abnormal activation induces excessive osteocyte proliferation and osteosarcoma development (1,2,38). Given elevated β-catenin pathway activity in osteosarcoma, investigating miRNA-Wnt/β-catenin interactions may provide new therapeutic strategies.

Bioinformatics analysis predicted FBXW7 as a downstream target of miR-27a-3p, suggesting miR-27a-3p may regulate osteosarcoma cell biological behaviors by targeting FBXW7 and modulating the Wnt/β-catenin pathway (1-3,39). This study explored the effects and regulatory mechanisms of miR-27a-3p and FBXW7 on osteosarcoma cell functions via in vitro experiments, aiming to provide experimental support for osteosarcoma molecular targeted therapy. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2290/rc).

Methods

Cell culture

Osteosarcoma cell lines MG-63 (RRID: CVCL_0426) and Saos-2 (RRID: CVCL_0548), as well as the normal human osteoblast hFOB1.19 (RRID: CVCL_3889), were sourced from Servicebio company (Wuhan, China). All cell lines were confirmed to be free of mycoplasma contamination (tested by mycoplasma detection kit, Servicebio, Cat. No. G1211) and not listed in the ICLAC Database of Cross-Contaminated or Misidentified Cell Lines. The latest authentication of cell lines was performed in March 2024 via short tandem repeat (STR) profiling. The culture history of the cells showed that MG-63 and Saos-2 were used at passages 15–20, and hFOB1.19 at passages 12–16. The sex of origin for all cell lines is not applicable as per the supplier’s specification. No genetic modification was performed on the cell lines except for the experimental transfections described below.

Human osteoblasts hFOB1.19 were maintained in DMEM/F12 medium (Servicebio, Cat. No. G5002) supplemented with 10% fetal bovine serum (FBS, Servicebio, Cat. No. G5003) and 1% dual antibody (streptomycin 100 µg/mL + penicillin 100 U/mL, Servicebio, Cat. No. G1408; Penicillin-Streptomycin is an antibiotic mixture and does not contain antibodies.) at 37 °C with 5% CO2. Osteosarcoma cell lines MG-63 and Saos-2 were cultured in RPMI-1640 medium (Servicebio, Cat. No. G5001) under the same conditions as hFOB1.19.

Cell grouping and transfection

The small RNA molecules and expression plasmids, including miR-27a-3p mimics (Cat. No. IBS-miR-027a-3p-M), miR-27a-3p inhibitors (Cat. No. IBS-miR-027a-3p-I), negative control (NC, Cat. No. IBS-NC-001), siRNA targeting FBXW7 (siRNA-FBXW7-1074, Cat. No. IBS-siFBXW7-1074), and the overexpression vector pcDNA3.1-FLAG-FBXW7 (Cat. No. IBS-pcDNA-FBXW7), were all synthesized by IBSBIO (Shanghai, China) following standard molecular biology protocols. The sequences of siRNA-FBXW7-1074 are as follows: sense 5'-GGAUUAUCCUGUCAUUCUUTT-3', antisense 5'-AAGAAUGACAGGAUAAUCCTT-3'.

Cells were seeded in 6-well plates at a density of 5×105 cells/well and cultured to 70–80% confluence before transfection. Transfection was performed using Lipo6000TM Transfection Reagent (Beyotime, Shanghai, China, Cat. No. C0526) following the manufacturer’s specified protocol. The final concentration of miR-27a-3p mimics, inhibitors, and siRNA-FBXW7 was 50 nM, and the concentration of pcDNA3.1-FLAG-FBXW7 was 2 µg/mL. Following a 48-hour cultivation period, the cells were collected to facilitate subsequent experimental procedures.

Real-time polymerase chain reaction (RT-PCR)

Total RNA was extracted from osteosarcoma cells MG-63, Saos-2 and osteoblast hFOB1.19 using Trizol (Servicebio, Wuhan, China, Cat. No. G3500) following the manufacturer’s protocol. RNA purity and concentration were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA), with A260/A280 ratios between 1.8 and 2.0 considered acceptable. Subsequently, complementary DNA (cDNA) synthesis was carried out utilizing a cDNA synthesis kit (Servicebio, Cat. No. G3330) for mRNA, and a miRNA cDNA synthesis kit (Servicebio, Cat. No. G3310) for miR-27a-3p.

Quantitative real-time polymerase chain reaction (qPCR) was conducted on an Applied Biosystems 7900 Sequence Detection system (Applied Biosystems) with the SYBR premixed Ex Taq Kit (Takara, Tokyo, Japan, Cat. No. RR420A). The qPCR reaction utilized specific amplification primers as listed in Table 1, with U6 serving as the internal reference gene for miR-27a-3p and GAPDH (primer sequences: forward 5'-GAAGGTGAAGGTCGGAGTC-3', reverse 5'-GAAGATGGTGATGGGATTTC-3') as the internal reference for FBXW7 mRNA. PCR reactions were conducted in strict accordance with the manufacturer’s protocol: pre-denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. For each specimen, testing was conducted in three biological replicates, and the outcomes were processed using the 2-ΔΔCT method for analysis.

Table 1. The primer sequence of qPCR.

Name Primer sequence
miR-27a-3p Forward: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCGGAACT
Reverse: ACACTCCAGCTGGGTTCACAGTGGCTAAG
U6 Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCGT

qPCR, quantitative real-time polymerase chain reaction.

Western blot

To obtain total proteins from cells, protein lysate (Servicebio, Cat. No. G2002) supplemented with 1% protease inhibitor cocktail (Servicebio, Cat. No. G2007) was applied to cell samples. The total protein concentration was quantified using a BCA protein assay kit (Servicebio, Cat. No. G2026). Subsequently, 30 µg of extracted proteins were separated through 10% SDS-PAGE gel electrophoresis (Servicebio, Cat. No. G1200), followed by transfer to PVDF membranes (Millipore, USA, Cat. No. IPVH00010). Membranes were blocked with 5% skim milk (Servicebio, Cat. No. G5006) for 1 hour at room temperature.

The membrane was incubated with diluted primary antibodies at 4 °C overnight: rabbit anti-human FBXW7 monoclonal antibody (Cell Signaling Technology, USA, Cat. No. 8022S, RRID: AB_10829223, 1:800), rabbit anti-human β-catenin monoclonal antibody (Cell Signaling Technology, Cat. No. 8480S, RRID: AB_11127855, 1:1,000), and rabbit anti-human GAPDH polyclonal antibody (Servicebio, Cat. No. GB11002, RRID: AB_2854986, 1:1,000). After washing with TBST three times (10 min each), the membrane was incubated with diluted sheep anti-rabbit IgG-HRP (Servicebio, Cat. No. GB23303, RRID: AB_2854987, 1:2,000) at room temperature for 1h. Following this, ECL chemiluminescence reagent (Servicebio, Cat. No. G2014) was employed to develop the color and analyze the protein bands. Gray value evaluation was performed using Image J software (Version 1.8.0, National Institutes of Health, USA).

Cell proliferation assay

The CCK-8 method was employed to monitor the proliferation status of osteosarcoma cells both prior to and following the transfection process. Transfected cells were gathered and prepared into a cell suspension with a density of 1×104 cells per milliliter, which was then transferred into a 96-well plate at a volume of 100 µL per well. Following the seeding process, the cells were incubated at 37 °C for durations of 24, 48, 72, and 96 hours. At each time point, 10 µL of CCK-8 reagent (YEASEN, Shanghai, China, Cat. No. 40203ES60) was added to each well, and the cultures were further sustained for an additional 2 hours. The absorbance value at 450 nm was determined using a microplate reader (Thermo Fisher Scientific, USA). Each measurement in this experiment was performed with three biological replicates to ensure data reliability.

Cell migration assay

A Transwell migration assay was employed to assess the effect of transfection on osteosarcoma cell movement. Transfected cells were first harvested and maintained in serum-free culture medium for a duration of 12 hours. These cells were then re-suspended in the same serum-free medium to create a cell suspension with a concentration of 1×105 cells per milliliter. A volume of 100 µL of this cell suspension was carefully introduced into the upper chamber of the Transwell insert (Servicebio, Cat. No. C6610), and 600 µL of medium supplemented with 10% fetal bovine serum was added to each well of the lower chamber. The entire system was then incubated at 37 °C for a period of 24 hours.

After the cultivation period, the Transwell insert was taken out, and the culture medium within each well was discarded. The cells were subjected to two washes with PBS, followed by a 30-minute fixation in 4% paraformaldehyde (Servicebio, Cat. No. G1101) and a 20-minute staining with 0.1% crystal violet (Servicebio, Cat. No. G1063). Non-migrated cells on the upper surface were removed using a cotton swab, and the remaining cells were gently rinsed with PBS three times. Migrated cells were photographed under an inverted microscope (Olympus, Japan) at 200× magnification, and the number of migrated cells was counted using Image J software. Every test was conducted a minimum of three biological replicates.

Cell apoptosis assay

The apoptosis status of osteosarcoma cells was analyzed using flow cytometry both prior to and subsequent to the transfection process. Stable transfectants were washed twice with ice-cold phosphate-buffered saline (PBS, Servicebio, Cat. No. G4202) and then re-suspended in binding buffer [100 mmol/L sodium chloride, 25 mmol/L calcium chloride, and 100 mmol/L 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.4] at a density of 1×106 cells/ml. These cells were stained using an annexin V-FITC/PI staining kit (YEASEN, Shanghai, China, Cat. No. 40302ES20) for a duration of 15 minutes at room temperature while being protected from light.

The apoptotic proportion was analyzed by flow cytometry (BD FACS Calibur, Becton, Dickinson and Company Biosciences, San Jose, USA). Early apoptotic cells were defined as annexin V-positive and PI-negative, and late apoptotic cells were defined as annexin V-positive and PI-positive; the total apoptotic rate was the sum of early and late apoptotic cell rates. The percentage of apoptotic cells (annexin V-positive and PI-negative) was calculated using FlowJo software (Version 10.0, Tree Star, USA). Flow cytometry gating strategies for apoptosis analysis are provided in Figure 1, including the gating of viable cells, early apoptotic cells, late apoptotic cells and necrotic cells. Every trial was conducted a minimum of three biological replicates.

Figure 1.

Figure 1

The role of miR-27a-3p in osteosarcoma cells. (A) Expression levels of miR-27a-3p in normal osteoblasts hFOB1.19 and osteosarcoma cells Saos-2 and MG-63. (B,C) The influence of introducing miR-27a-3p mimic and inhibitor on the expression of miR-27a-3p in osteosarcoma cell lines MG-63 and SAOS-2. (D-F) CCK-8 assay, Transwell migration assay and FCM assay were used to detect the changes in cell proliferation, migration ability and apoptosis levels of osteosarcoma cells MG-63 and Saos-2 transfected with miR-27a-3p mimic and inhibitor. Stained with crystal violet; magnification: ×200. *, P<0.05; **, P<0.01. CCK-8, Cell Counting Kit-8; FCM, flow cytometry; NC, negative control.

Dual-luciferase reporter assay

The target genes of miR-27a-3p were identified and selected through the use of TargetScans Human7.2 database. Based on the identified sequence information and predicted binding sites between miR-27a-3p and the FBXW7 gene, researchers designed and constructed specific luciferase reporter vector plasmids, including FBXW7-WT1/FBXW7-Mut1 and FBXW7-WT2/FBXW7-Mut2 (IBSBIO, Shanghai, China). The wild-type (WT) plasmids contained the intact binding sites of miR-27a-3p in the 3'UTR of FBXW7, while the mutant (Mut) plasmids contained mutated binding sites (mutation sites: FBXW7-WT1 5'-AACUGUGAA-3' → Mut1 5'-AACACACAA-3'; FBXW7-WT2 5'-AACUGUGAA-3' → Mut2 5'-AACACACAA-3').

Cells were seeded in 48-well plates at a density of 2×104 cells/well and cultured to 70% confluence. Plasmids FBXW7-WT1/FBXW7-Mut1 and FBXW7-WT2/FBXW7-Mut2 (0.2 µg/well) were each co-transfected with either miR-27a-3p mimic or miR-NC (50 nM) using Lipo6000TM transfection reagent. A Renilla luciferase plasmid (pRL-TK, 0.02 µg/well, Promega, USA, Cat. No. E2241) was co-transfected as an internal control. Forty-eight hours post-transfection, the luciferase activity was assayed using a Dual-Luciferase Reporter Assay System (Promega, Cat. No. E1910) in accordance with the manufacturer’s guidelines. The relative luciferase activity was calculated as the ratio of firefly luciferase activity to Renilla luciferase activity. Each experiment was performed in three biological replicates.

Statistical analysis

Statistical analysis of the experimental outcomes was conducted using SPSS 20.0 and GraphPad Prism 8 software. Quantitative data were presented as mean ± standard deviation (SD). Differences between two groups were analyzed via unpaired Student’s t-test, while comparisons among multiple groups employed one-way analysis of variance (ANOVA) followed by the LSD-t test for pairwise comparisons. Sample size determination was performed using G*Power software (Version 3.1.9.7), with a power of 80% and a significance level (α) of 0.05. P<0.05 was considered statistically significant. All experiments were designed with randomization (cell grouping via random number table method) and blinding (experimental operators and result analysts were blinded to group assignments).

Results

Expression of miR-27a-3p in osteosarcoma cells and its effect on osteosarcoma cell function

The expression levels of miR-27a-3p in normal human osteoblasts hFOB1.19 and osteosarcoma cells Saos-2 and MG-63 were examined by RT-PCR, and it was found that compared with osteoblasts hFOB1.19, The expression of miR-27a-3p was increased in osteosarcoma cells Saos-2 (P=0.03) and MG-63 (P=0.003) (Figure 1A). After transfection of miR-27a-3p mimic and miR-27a-3p inhibitor in MG-63 cells, RT-PCR results showed that compared with NC group, the expression of miR-27a-3p in the mimic group was significantly increased (P=0.004). The expression of miR-27a-3p in inhibitor group cells was decreased (P=0.04) (Figure 1B); After transfection of miR-27a-3p mimic and miR-27a-3p inhibitor in Saos-2 cells, RT-PCR results showed that compared with NC group, the expression of miR-27a-3p in the mimic group was increased (P=0.03). The expression of miR-27a-3p in inhibitor group cells was decreased (P=0.02) (Figure 1C).

In order to explore how miR-27a-3p influences the biological behaviors of MG-63 and Saos-2 osteosarcoma cell lines, researchers performed transfections of miR-27a-3p mimic and inhibitor on both cell types. Subsequently, CCK-8 assay, Transwell migration assay and flow cytometry were employed to assess the variations in cell proliferation, migration capacity, and apoptosis following the transfection process. These experiments revealed that, upon upregulating miR-27a-3p via mimic, the proliferative capacity of osteosarcoma cells was notably increased (as depicted in Figure 1D), whereas downregulating miR-27a-3p through inhibitor resulted in a significant reduction in their proliferation. Transwell migration assay showed that the migration ability of osteosarcoma cells was increased after transfection of miR-27a-3p mimic (P=0.04, P=0.009), while the migration ability of osteosarcoma cells was decreased after transfection of miR-27a-3p inhibitor (P=0.02, P=0.03) (Figure 1E). Flow cytometry results showed that cell apoptosis was decreased after transfection of miR-27a-3p mimic (P=0.03, P=0.04), after transfection of miR-27a-3p inhibitor, The level of apoptosis was increased (P=0.01, P=0.04) (Figure 1F).

Targeted regulation of miR-27a-3p on FBXW7

Bioinformatics analysis using Targetscan software identified two potential binding sites between miR-27a-3p and FBXW7 (Figure 2A). The results of dual luciferase reporter gene assay showed that compared with the negative control group, the transfection of miR-27a-3p mimic could down-regulate the luciferase activity of wild-type FBXW7-WT plasmid group, and the difference was statistically significant (P=0.002, P<0.001). However, the luciferase activity of the mutant FBXW7-MUT plasmid group had no significant change (P>0.05) (Figure 2B), suggesting that FBXW7 is the downstream target of miR-27a-3p.

Figure 2.

Figure 2

The interaction between miR-27a-3p and FBXW7. (A) A diagram illustrating the complementary binding sites between miR-27a-3p and the 3’-untranslated region of FBXW7. (B) The results of a dual-luciferase reporter gene assay. (C,D) Effect of miR-27a-3p on expression of FBXW7 in osteosarcoma cells MG-63 (C) and Saos-2 (D). *, P<0.05; **, P<0.01; ***, P<0.001; ns, not significant. NC, negative control.

In order to explore how miR-27a-3p influences the level of FBXW7 protein in MG-63 and Saos-2 osteosarcoma cell lines, researchers performed transfection experiments using both the miR-27a-3p mimic and inhibitor on these two types of cells. Following the transfection process, Western blot analysis was employed to examine and compare the levels of FBXW7 protein in the treated and control groups of osteosarcoma cells. The results showed that in MG-63 cells, the expression of FBXW7 in miR-27a-3p mimic group was decreased (P=0.03). The expression level of FBXW7 in miR-27a-3p inhibitor group was increased (P=0.04) (Figure 2C). In Saos-2 cells, the expression of FBXW7 in miR-27a-3p mimic group was decreased (P=0.02). The expression of FBXW7 in miR-27a-3p inhibitor group was increased (P=0.04) (Figure 2D).

Following the transfection of osteosarcoma MG-63 and Saos-2 cells with miR-27a-3p inhibitor and miR-27a-3p inhibitor combined with siFBXW7, the expression level of FBXW7 was analyzed via Western blot. The results showed that in MG-63 cells, the expression of FBXW7 in miR-27a-3p inhibitor group was increased (P=0.004), compared with miR-27a-3p inhibitor group, the expression of FBXW7 in miR-27a-3p inhibitor + siFBXW7 co-action group was decreased (P=0.005) (Figure 3A). In Saos-2 cells, the expression of FBXW7 in miR-27a-3p inhibitor group was increased (P=0.001), compared with miR-27a-3p inhibitor group, the expression of FBXW7 in miR-27a-3p inhibitor+siFBXW7 co-action group was decreased (P=0.04) (Figure 3B). Subsequently, CCK-8 assay and Transwell migration assay were employed to assess the variations in cell proliferation and migration capacities following the transfection process. The outcomes of the CCK-8 test demonstrated that when osteosarcoma cells MG-63 and Saos-2 were treated with the miR-27a-3p inhibitor, their capacity for growth was diminished. However, when this inhibitor was combined with siFBXW7, the proliferation potential of these cells partially recovered (Figure 3C). The results of Transwell migration assay showed that the migration ability of osteosarcoma cells MG-63 and Saos-2 was decreased after transfection with miR-27a-3p inhibitor (P<0.001, P=0.003). However, the migration ability of miR-27a-3p inhibitor+siFBXW7 was restored to a certain extent (P=0.002, P=0.02) (Figure 3D).

Figure 3.

Figure 3

The targeted regulation of miR-27a-3p on FBXW7. (A,B) Effect of miR-27a-3p inhibitor combined with siFBXW7 on the expression of FBXW7 in osteosarcoma cells MG-63 (A) and Saos-2 (B). (C,D) CCK-8 assay (C), Transwell migration assay (D) were used to detect the changes in cell proliferation and migration ability levels of osteosarcoma cells MG63 and Saos-2 transfected with miR-27a-3p inhibitor+siFBXW7. Stained with crystal violet; magnification: ×200. *, P<0.05; **, P<0.01; ***, P<0.001. CCK-8, Cell Counting Kit-8; NC, negative control.

Expression of FBXW7 in osteosarcoma cells and its effect on osteosarcoma cell function

RT-PCR analysis of FBXW7 mRNA expression in normal human osteoblasts hFOB1.19 and osteosarcoma cells Saos-2 and MG-63 showed that compared with osteoblasts hFOB1.19, The expression levels of FBXW7 mRNA in osteosarcoma cells Saos-2 (P=0.02) and MG-63 (P<0.001) were decreased to varying degrees (Figure 4A). To assess the impact of miR-27a-3p inhibition combined with FBXW7 silencing, subsequent experiments were conducted by transfecting MG-63 and Saos-2 osteosarcoma cells with specific siRNA targeting FBXW7 (siRNA-FBXW7-1265, siRNA-FBXW7-1074, and siRNA-FBXW7-1828), followed by RT-PCR analysis to quantify the mRNA expression level of FBXW7 in the treated cells. The results showed that in MG-63 cells, compared with the NC group, the expression of FBXW7 mRNA in each transfected group was decreased, and the most significant reduction was found in the siRNA-FBXW7-1074 group (P<0.001) (Figure 4B). In Saos-2 cells, the mRNA reduction of FBXW7 in siRNA-FBXW7-1074 group was the most significant (P=0.002) (Figure 4C), so siRNA-FBXW7-1074 group was selected for subsequent experiments. Subsequently, to further investigate the functional impact of FBXW7 silencing, Western blot analysis was performed to examine the protein expression of FBXW7 and its downstream target β-catenin in the same osteosarcoma cell lines. The results showed that: compared with NC group, the expression level of FBXW7 in pcDNA3.1-FLAG-FBXW7 group was increased P=0.02), and the expression level of FBXW7 in siRNA group was decreased (P<0.001), and the expression level of β-catenin protein was consistent with that of FBXW7 (Figure 4D). After transfection of pcDNA3.1-FLAG-FBXW7 and siRNA-FBXW7 in Saos-2 cells, Western blot results showed that: the expression of FBXW7 in pcDNA3.1-FLAG-FBXW7 group was increased (P=0.01), and the expression of FBXW7 in siRNA group was significantly decreased (P=0.005). The expression of β-catenin protein was consistent with that of FBXW7 (Figure 4E).

Figure 4.

Figure 4

The expression of FBXW7 in osteosarcoma cells. (A) The mRNA levels of FBXW7 in normal osteoblasts hFOB1.19 and osteosarcoma cells Saos-2, MG-63 were also analyzed. (B,C) To explore the impact of FBXW7 on the biological behavior of osteosarcoma cells Saos-2 and MG-63, the researchers performed transfections on these two osteosarcoma cell lines using pcDNA3.1-FLAG-FBXW7 and siRNA-FBXW7. (D,E) Effect of transfection of pcDNA3.1-FLAG-FBXW7 and siRNA-FBXW7 on expression of FBXW7 and β-catenin in osteosarcoma cells MG-63 (D) and Saos-2 (E). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, not significant. NC, negative control; OE, overexpression.

To explore how FBXW7 influences the biological behaviors of osteosarcoma cell lines MG-63 and Saos-2, researchers conducted transfections on these two osteosarcoma cell models using pcDNA3.1-FLAG-FBXW7 and siRNA-FBXW7 to modulate FBXW7 expression levels. Subsequently, CCK-8 assay and Transwell migration assay were used to assess the variations in cell propagation and migration following the transfection process. The outcomes of the CCK-8 test revealed that the introduction of pcDNA3.1-FLAG-FBXW7 led to a reduction in the proliferative potential of osteosarcoma cells, whereas the transfection of siRNA-FBXW7 was associated with an increase in their proliferative capacity. Transwell migration assay showed that the migration ability of osteosarcoma cells was decreased after transfection of pcDNA3.1-FLAG-FBXW7 (P=0.004, P=0.006), and increased after transfection of siRNA-FBXW7 (P=0.03, P=0.04) (Figure 5).

Figure 5.

Figure 5

The role of FBXW7 in osteosarcoma cells. (A,B) CCK-8 assay, Transwell migration assay were used to detect the changes in cell proliferation and migration ability of osteosarcoma cells MG-63 and Saos-2 transfected with pcDNA3.1-FLAG-FBXW7 and siRNA-FBXW7. Stained with crystal violet; magnification: ×200. *, P<0.05; **, P<0.01. CCK-8, Cell Counting Kit-8; NC, negative control; OE, overexpression.

Discussion

Osteosarcoma is the most common primary bone malignancy in children and adolescents, with strong local invasion and distant metastasis potential, seriously endangering the health and survival of patients (2,3,40). Identifying early diagnostic markers and effective therapeutic targets is crucial for improving the prognosis of osteosarcoma patients.

miRNAs are non-coding small RNAs that regulate gene expression by binding to the 3'UTR of target mRNAs, and play important regulatory roles in tumor occurrence and development (2,10,11). Due to their tissue specificity, stability, and easy detection, miRNAs have great potential as tumor diagnostic and prognostic biomarkers (13,41,42). miR-27a-3p has been reported to be an oncogenic miRNA in a variety of malignancies, promoting tumor cell proliferation, migration and invasion (14-17). In this study, we found that miR-27a-3p was highly expressed in osteosarcoma cells, and functional experiments showed that overexpression of miR-27a-3p promoted osteosarcoma cell proliferation and migration, and inhibited apoptosis, while knockdown of miR-27a-3p showed the opposite effects. These results were further verified in normal human osteoblast hFOB1.19 cells, where miR-27a-3p mimic/inhibitor had no significant effect on normal cell migration and apoptosis, and only a weak effect on proliferation, confirming the specific oncogenic role of miR-27a-3p in osteosarcoma cells and excluding the artifact of cancer cell lines.

FBXW7 is a key tumor suppressor that mediates the degradation of multiple oncoproteins and is frequently inactivated in human cancers (26,43,44). FBXW7 is highly expressed in normal human tissues, and its expression is significantly downregulated in a variety of tumor tissues, including glioma, pancreatic cancer, hepatocellular carcinoma and lung adenocarcinoma (45-47). In this study, we found that FBXW7 was low expressed in osteosarcoma cells, and overexpression of FBXW7 inhibited osteosarcoma cell proliferation and migration, while silencing of FBXW7 promoted osteosarcoma cell malignant behaviors, confirming the tumor suppressor role of FBXW7 in osteosarcoma. We optimized the siRNA concentration and screened the most effective siRNA sequence to enhance the silencing efficiency of FBXW7, and the restored malignant behaviors of osteosarcoma cells after co-transfection of miR-27a-3p inhibitor and siFBXW7 further confirmed that miR-27a-3p exerts its oncogenic effect by targeting FBXW7.

miRNAs are important regulators of FBXW7 expression, and multiple miRNAs have been reported to target FBXW7 and inhibit its expression, including miR-223, miR-25, miR-27, miR-32 and miR-92 (26,48-50). In this study, bioinformatics analysis and dual luciferase reporter assay confirmed that miR-27a-3p has two potential binding sites with FBXW7 3'UTR, and miR-27a-3p mimic can significantly inhibit the luciferase activity of wild-type FBXW7 plasmid, but has no effect on the mutant plasmid. Western blot and mRNA detection results further confirmed that miR-27a-3p negatively regulates the expression of FBXW7 at both transcriptional and translational levels. Although the inhibitory effect of miR-27a-3p on FBXW7 expression was modest, the combination of multiple experimental methods (dual luciferase reporter assay, RT-PCR, Western blot) and functional rescue experiments confirmed the specific targeting relationship between miR-27a-3p and FBXW7. The modest regulatory effect may be due to the synergistic regulation of FBXW7 by multiple miRNAs in osteosarcoma cells, which is consistent with previous studies showing that FBXW7 expression is usually regulated by multiple miRNAs or other mechanisms (51,52).

The Wnt/β-catenin signaling pathway is abnormally activated in osteosarcoma and plays an important role in osteosarcoma cell proliferation and migration (1,2,38). In this study, we found that the expression of β-catenin protein was consistent with the expression of FBXW7 in osteosarcoma cells, suggesting that FBXW7 may regulate the malignant behavior of osteosarcoma cells by modulating the Wnt/β-catenin signaling pathway. This is consistent with previous studies showing that FBXW7 can regulate the Wnt/β-catenin pathway by mediating the degradation of β-catenin or its upstream regulators (38,53-56). However, the specific molecular mechanism by which FBXW7 regulates the Wnt/β-catenin pathway in osteosarcoma needs to be further explored in subsequent studies.

It should be noted that this study is an in vitro study, and the functional association between miR-27a-3p/FBXW7 axis and osteosarcoma cell malignant behavior needs to be further verified by in vivo animal experiments and clinical samples. In addition, the clinical significance of miR-27a-3p and FBXW7 in osteosarcoma patients, such as their correlation with clinical pathological features and prognosis, needs to be further investigated.

Conclusions

Osteosarcoma cell lines exhibit elevated levels of miR-27a-3p, with the overexpression of this microRNA resulting in increased cell proliferation and migration capacities, alongside a reduction in apoptotic cell death. Conversely, when miR-27a-3p expression is suppressed, the opposite effects are observed, including decreased proliferation, impaired migration, and enhanced apoptosis. Mechanistically, miR-27a-3p has been shown to exert these biological effects by directly regulating the expression of FBXW7, thereby influencing the key cellular processes of proliferation, migration, and apoptosis in osteosarcoma. Conversely, the expression level of FBXW7 in osteosarcoma cells is relatively low. When FBXW7 is overexpressed, the growth and spread abilities of osteosarcoma cells are significantly suppressed, while reducing FBXW7 expression tends to enhance these abilities. This suggests that FBXW7 may play a crucial role in regulating the biological behaviors of osteosarcoma cells. The underlying mechanism might be associated with the Wnt/β-catenin signaling pathway.

Supplementary

The article’s supplementary files as

tcr-15-04-242-rc.pdf (177.5KB, pdf)
DOI: 10.21037/tcr-2025-aw-2290
tcr-15-04-242-coif.pdf (782.2KB, pdf)
DOI: 10.21037/tcr-2025-aw-2290

Acknowledgments

None.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Footnotes

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2290/rc

Funding: This work was funded by Academic Enhancement Support Program of Hainan Medical University (No. XSTS2026092) and Lanzhou Talent Entrepreneurship and Innovation Project (No. 2021-RC-114).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2290/coif). The authors have no conflicts of interest to declare.

Data Sharing Statement

Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2290/dss

tcr-15-04-242-dss.pdf (72.6KB, pdf)
DOI: 10.21037/tcr-2025-aw-2290

References

  • 1.Zhou Y, Yang K, Cui W. Global research trends in bone tumors: a bibliometric analysis of medical imaging. Front Oncol 2025;15:1579339. 10.3389/fonc.2025.1579339 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ogura K, Morizane C, Satake T, et al. Incidence and age- and site-specific characteristics of osteosarcoma: a population-based study using National Cancer Registry 2016-2019. Jpn J Clin Oncol 2025;55:1037-45. 10.1093/jjco/hyaf086 [DOI] [PubMed] [Google Scholar]
  • 3.Zhao Q, Hu W, Xia Y, et al. Feasibility of machine learning-based modeling and prediction to assess osteosarcoma outcomes. Sci Rep 2025;15:17386. 10.1038/s41598-025-00179-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sarhadi VK, Daddali R, Seppänen-Kaijansinkko R. Mesenchymal Stem Cells and Extracellular Vesicles in Osteosarcoma Pathogenesis and Therapy. Int J Mol Sci 2021;22:11035. 10.3390/ijms222011035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chang X, Ma Z, Zhu G, et al. New perspective into mesenchymal stem cells: Molecular mechanisms regulating osteosarcoma. J Bone Oncol 2021;29:100372. 10.1016/j.jbo.2021.100372 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shi S, Ou X, Liu C, et al. NF-κB signaling and the tumor microenvironment in osteosarcoma: implications for immune evasion and therapeutic resistance. Front Immunol 2025;16:1518664. 10.3389/fimmu.2025.1518664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhang L, Jiang H, Ma H. Progress in immune microenvironment, immunotherapy and prognostic biomarkers in pediatric osteosarcoma. Front Immunol 2025;16:1548527. 10.3389/fimmu.2025.1548527 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Tian H, Cao J, Li B, et al. Managing the immune microenvironment of osteosarcoma: the outlook for osteosarcoma treatment. Bone Res 2023;11:11. 10.1038/s41413-023-00246-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wang R, Lahiri DK. Effects of microRNA-298 on APP and BACE1 translation differ according to cell type and 3'-UTR variation. Sci Rep 2022;12:3074. 10.1038/s41598-022-05164-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Inoue J, Inazawa J. Cancer-associated miRNAs and their therapeutic potential. J Hum Genet 2021;66:937-45. 10.1038/s10038-021-00938-6 [DOI] [PubMed] [Google Scholar]
  • 11.Zhang Z, Huang Q, Yu L, et al. The Role of miRNA in Tumor Immune Escape and miRNA-Based Therapeutic Strategies. Front Immunol 2021;12:807895. 10.3389/fimmu.2021.807895 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Arghiani N, Shah K. Modulating microRNAs in cancer: next-generation therapies. Cancer Biol Med 2021;19:289-304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kim T, Croce CM. MicroRNA: trends in clinical trials of cancer diagnosis and therapy strategies. Exp Mol Med 2023;55:1314-21. 10.1038/s12276-023-01050-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mirahmadi Y, Nabavi R, Taheri F, et al. MicroRNAs as Biomarkers for Early Diagnosis, Prognosis, and Therapeutic Targeting of Ovarian Cancer. J Oncol 2021;2021:3408937. 10.1155/2021/3408937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lei J, Guo S, Li K, et al. Lysophosphatidic acid receptor 6 regulated by miR-27a-3p attenuates tumor proliferation in breast cancer. Clin Transl Oncol 2022;24:503-16. 10.1007/s12094-021-02704-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yang Y, Yang Z, Zhang R, et al. MiR-27a-3p enhances the cisplatin sensitivity in hepatocellular carcinoma cells through inhibiting PI3K/Akt pathway. Biosci Rep 2021;41:BSR20192007. 10.1042/BSR20192007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bongolo CC, Thokerunga E, Yan Q, et al. Exosomes Derived from microRNA-27a-3p Overexpressing Mesenchymal Stem Cells Inhibit the Progression of Liver Cancer through Suppression of Golgi Membrane Protein 1. Stem Cells Int 2022;2022:9748714. 10.1155/2022/9748714 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wang X, An D, Liu X, et al. MicroRNA-27a downregulates the expression of Hsp90 and enhances the radiosensitivity in esophageal squamous cell carcinoma. Onco Targets Ther 2019;12:5967-77. 10.2147/OTT.S197456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Li E, Han K, Zhou X. microRNA-27a-3p Down-regulation Inhibits Malignant Biological Behaviors of Ovarian Cancer by Targeting BTG1. Open Med (Wars) 2019;14:577-85. 10.1515/med-2019-0065 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lei Y, Chen L, Zhang G, et al. MicroRNAs target the Wnt/β‑catenin signaling pathway to regulate epithelial‑mesenchymal transition in cancer (Review). Oncol Rep 2020;44:1299-313. 10.3892/or.2020.7703 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ben W, Zhang G, Huang Y, et al. MiR-27a-3p Regulated the Aggressive Phenotypes of Cervical Cancer by Targeting FBXW7. Cancer Manag Res 2020;12:2925-35. 10.2147/CMAR.S234897 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lin T, Ma Q, Zhang Y, et al. MicroRNA-27a functions as an oncogene in human osteosarcoma by targeting CCNG1. Oncol Lett 2018;15:1067-71. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 23.Liu J, Li M, Liu X, et al. miR-27a-3p promotes the malignant phenotypes of osteosarcoma by targeting ten-eleven translocation 1. Int J Oncol 2018;52:1295-304. 10.3892/ijo.2018.4275 [DOI] [PubMed] [Google Scholar]
  • 24.Awan AB, Osman MJA, Khan OM. Ubiquitination Enzymes in Cancer, Cancer Immune Evasion, and Potential Therapeutic Opportunities. Cells 2025;14:69. 10.3390/cells14020069 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Xing L, Xu L, Zhang Y, et al. Recent Insight on Regulations of FBXW7 and Its Role in Immunotherapy. Front Oncol 2022;12:925041. 10.3389/fonc.2022.925041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen S, Lin J, Zhao J, et al. FBXW7 attenuates tumor drug resistance and enhances the efficacy of immunotherapy. Front Oncol 2023;13:1147239. 10.3389/fonc.2023.1147239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sailo BL, Banik K, Girisa S, et al. FBXW7 in Cancer: What Has Been Unraveled Thus Far? Cancers (Basel) 2019;11:246. 10.3390/cancers11020246 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Jiménez-Izquierdo R, Morrugares R, Suanes-Cobos L, et al. FBXW7 tumor suppressor regulation by dualspecificity tyrosine-regulated kinase 2. Cell Death Dis 2023;14:202. 10.1038/s41419-023-05724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shen W, Zhou Q, Peng C, et al. FBXW7 and the Hallmarks of Cancer: Underlying Mechanisms and Prospective Strategies. Front Oncol 2022;12:880077. 10.3389/fonc.2022.880077 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang W, Jiang K, Liu X, et al. FBXW7 and human tumors: mechanisms of drug resistance and potential therapeutic strategies. Front Pharmacol 2023;14:1278056. 10.3389/fphar.2023.1278056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tandon V, de la Vega L, Banerjee S. Emerging roles of DYRK2 in cancer. J Biol Chem 2021;296:100233. 10.1074/jbc.REV120.015217 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Anand AA, Khan M, V M, et al. The Molecular Basis of Wnt/β-Catenin Signaling Pathways in Neurodegenerative Diseases. Int J Cell Biol 2023;2023:9296092. 10.1155/2023/9296092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Liu J, Xiao Q, Xiao J, et al. Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther 2022;7:3. 10.1038/s41392-021-00762-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Shah K, Kazi JU. Phosphorylation-Dependent Regulation of WNT/Beta-Catenin Signaling. Front Oncol 2022;12:858782. 10.3389/fonc.2022.858782 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yang P, Wang H, Meng L, et al. Methylase METTL3 regulates oxidative stress-induced osteoblast apoptosis through Wnt/β-catenin signaling pathway. J Mol Histol 2025;56:86. 10.1007/s10735-025-10358-x [DOI] [PubMed] [Google Scholar]
  • 36.Abo-Elenin MHH, Kamel R, Nofal S, et al. The crucial role of beta-catenin in the osteoprotective effect of semaglutide in an ovariectomized rat model of osteoporosis. Naunyn Schmiedebergs Arch Pharmacol 2025;398:2677-93. 10.1007/s00210-024-03378-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Huang K, Cai S, Fu T, et al. Wnt10b regulates osteogenesis of adipose-derived stem cells through Wnt/β-catenin signalling pathway in osteoporosis. Cell Prolif 2024;57:e13522. 10.1111/cpr.13522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ding Y, Chen Q. Wnt/β-catenin signaling pathway: an attractive potential therapeutic target in osteosarcoma. Front Oncol 2024;14:1456959. 10.3389/fonc.2024.1456959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lu B, Feng Z, Fan B, et al. Blocking miR-27a-3p sensitises Taxol resistant osteosarcoma cells through targeting Fbxw7. Bull Cancer 2021;108:596-604. 10.1016/j.bulcan.2021.01.006 [DOI] [PubMed] [Google Scholar]
  • 40.Zhao X, Wu Q, Gong X, et al. Osteosarcoma: a review of current and future therapeutic approaches. Biomed Eng Online 2021;20:24. 10.1186/s12938-021-00860-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Metcalf GAD. MicroRNAs: circulating biomarkers for the early detection of imperceptible cancers via biosensor and machine-learning advances. Oncogene 2024;43:2135-42. 10.1038/s41388-024-03076-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Aswathy R, Chalos VA, Suganya K, et al. Advancing miRNA cancer research through artificial intelligence: from biomarker discovery to therapeutic targeting. Med Oncol 2024;42:30. 10.1007/s12032-024-02579-z [DOI] [PubMed] [Google Scholar]
  • 43.Qi Y, Rezaeian AH, Wang J, et al. Molecular insights and clinical implications for the tumor suppressor role of SCF(FBXW7) E3 ubiquitin ligase. Biochim Biophys Acta Rev Cancer 2024;1879:189140. 10.1016/j.bbcan.2024.189140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Zhong Z, Virshup DM. Recurrent mutations in tumor suppressor FBXW7 bypass Wnt/β-catenin addiction in cancer. Sci Adv 2024;10:eadk1031. 10.1126/sciadv.adk1031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yin L, Zhang J, Zhu Z, et al. The FBXW7-KMT2 axis in cancer-associated fibroblasts controls tumor growth via an epigenetic-paracrine mechanism. Proc Natl Acad Sci U S A 2025;122:e2423130122. 10.1073/pnas.2423130122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.He J, Du Y, Li G, et al. Myeloid Fbxw7 Prevents Pulmonary Fibrosis by Suppressing TGF-β Production. Front Immunol 2021;12:760138. 10.3389/fimmu.2021.760138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lan H, Sun Y. Tumor Suppressor FBXW7 and Its Regulation of DNA Damage Response and Repair. Front Cell Dev Biol 2021;9:751574. 10.3389/fcell.2021.751574 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Liu Z, Ma T, Duan J, et al. MicroRNA‑223‑induced inhibition of the FBXW7 gene affects the proliferation and apoptosis of colorectal cancer cells via the Notch and Akt/mTOR pathways. Mol Med Rep 2021;23:154. 10.3892/mmr.2020.11793 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Cao J, Yu U, Li L, et al. circKL inhibits the growth and metastasis of kidney cancer by sponging miR‑182‑5p and upregulating FBXW7. Oncol Rep 2022;47:75. 10.3892/or.2022.8286 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhang J, Zhou M, Zhao X, et al. Long noncoding RNA LINC00173 is downregulated in cervical cancer and inhibits cell proliferation and invasion by modulating the miR-182-5p/FBXW7 axis. Pathol Res Pract 2020;216:152994. 10.1016/j.prp.2020.152994 [DOI] [PubMed] [Google Scholar]
  • 51.Xiao G, Lu W, Yuan J, et al. Fbxw7 suppresses carcinogenesis and stemness in triple-negative breast cancer through CHD4 degradation and Wnt/β-catenin pathway inhibition. J Transl Med 2024;22:99. 10.1186/s12967-024-04897-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Zhang J, Chen Z, Liu X, et al. Gain of circBRAF Represses Glioma Progression by Regulating miR-1290/FBXW7 Axis. Neurochem Res 2021;46:1203-13. 10.1007/s11064-021-03259-4 [DOI] [PubMed] [Google Scholar]
  • 53.Wan X, Guo W, Zhan Z, et al. Dysregulation of FBW7 in malignant lymphoproliferative disorders. Front Oncol 2022;12:988138. 10.3389/fonc.2022.988138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Liu J, Wei L, Hu N, et al. FBW7-mediated ubiquitination and destruction of PD-1 protein primes sensitivity to anti-PD-1 immunotherapy in non-small cell lung cancer. J Immunother Cancer 2022;10:e005116. 10.1136/jitc-2022-005116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Xia L, Chen J, Huang M, et al. The functions of long noncoding RNAs on regulation of F-box proteins in tumorigenesis and progression. Front Oncol 2022;12:963617. 10.3389/fonc.2022.963617 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Di Fiore R, Suleiman S, Drago-Ferrante R, et al. The Role of FBXW7 in Gynecologic Malignancies. Cells 2023;12:1415. 10.3390/cells12101415 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    The article’s supplementary files as

    tcr-15-04-242-rc.pdf (177.5KB, pdf)
    DOI: 10.21037/tcr-2025-aw-2290
    tcr-15-04-242-coif.pdf (782.2KB, pdf)
    DOI: 10.21037/tcr-2025-aw-2290

    Data Availability Statement

    Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2290/dss

    tcr-15-04-242-dss.pdf (72.6KB, pdf)
    DOI: 10.21037/tcr-2025-aw-2290

    Articles from Translational Cancer Research are provided here courtesy of AME Publications

    RESOURCES